Skip to main content
Neurotherapeutics logoLink to Neurotherapeutics
. 2026 Jan 31;23(1):e00841. doi: 10.1016/j.neurot.2026.e00841

Single-dose psilocybin promotes cell-type-specific changes of neurons in the orbitofrontal cortex

Ziran Huang a,1, Xiaoyan Wei a,1, Yihui Wang a,1, Jing Tian a,1, Jihui Dong a, Bo Liang b, Lin Lu c, Wen Zhang a,d,
PMCID: PMC12976539  PMID: 41620327

Abstract

Recent clinical breakthroughs hold great promise for the application of psilocybin in the treatments of psychological disorders, such as depression, addiction, and obsessive-compulsive disorder. Psilocybin is a psychedelic whose metabolite, psilocin, is a 5-HT2A receptor agonist. Nevertheless, the underlying mechanisms for the effects of psilocybin on the brain are not fully illustrated, and cell type-specific and circuit effects of psilocybin are not fully understood. Here, we combined single-nucleus RNA-seq with functional assays to study the long-term effects of psilocybin on the orbitofrontal cortex (OFC) of male mouse, a brain region vulnerable to psychological disorders such as depression. We found that a single dose of psilocybin induced long-term genetic and functional changes in neurons of the OFC, and the layer 5 pyramidal neurons showed the most significant changes. The layer 5 pyramidal neurons in the OFC showed reduced expressions of glutamate receptors and the gene expressions of multiple intercellular signaling pathways involved in the excitatory synapse formation and maintenance after psilocybin injection, which was consistent with the decreased excitatory synaptic transmission of these neurons. Meanwhile, both Parvalbumin- and Somatostatin-positive inhibitory neurons of the OFC showed meager changes after psilocybin injection. Furthermore, knockdown of 5-HT2A receptor in the layer 5 pyramidal neurons but not the Parvalbumin-positive inhibitory neurons abated psilocybin-induced functional changes and the anti-depressant effect. Together, these results showed the cell type-specific mechanisms of psilocybin and shed light on the brain region difference in the effect of psychedelics.

Keywords: Orbitofrontal cortex, Psilocybin, Neuron, 5-HT2A receptor

Introduction

The increase in the prevalence of depression globally has put a great burden on the global economy [1]. Compared with the last decade, the prevalence of depression disorders increased by more than 120 million globally [1], and the COVID-19 pandemic further exacerbated such a trend [2]. On the other hand, treatments with traditional anti-depressants were still unsatisfactory [3,4]. Such a gap urges the development of novel medications with higher efficiency. Recently, psychedelics have been proposed as a fast-acting anti-depressant, and clinical trials suggest their promising roles in treating addiction, obsessive-compulsive disorder (OCD), and post-traumatic stress disorder (PTSD) [[5], [6], [7], [8], [9], [10], [11]]. However, similar to traditional anti-depressants, the underlying cellular and circuit mechanisms of psychedelics are still not fully understood. Considering the hallucinogenic effects of psychedelics, the lack of mechanistic understanding could limit their clinical use, since they might require extra costs for medical supervision and safety monitoring during treatments.

Studies have shown that psychedelics, such as psilocybin, lysergic acid diethylamide (LSD), and N,N-Dimethyltryptamine (DMT), activate the 5-HT2A receptor, which activates Gαq and β-arrestin signaling pathways and then lead to downstream effects [12]. Evidence also suggested that psychedelics, such as psilocybin, induced plasticity changes in neurons, such as an increase of spines of excitatory neurons [[13], [14], [15]]. Meanwhile, brain functions require concerted activities of both the excitatory and inhibitory neurons, which not only underlies the plasticity of the brain, but the shift of such balance between excitation and inhibition also could predispose neurological disorders, such as autism and schizophrenia [16,17]. In the cortex, inhibition is mostly mediated by GABAergic interneurons, which exhibit both genetic and physiological diversity [18]. Such diversity requires cell type-specific investigation of interneuron functions in both physiological and pathological conditions, as both brain region and layer-specific effects of interneurons on the output exist in the cortex [19,20]. However, the effects and mechanisms of psychedelics action on different types of cortical neurons are not fully illustrated, which further dampens our understanding of the mechanisms of effects of psychedelics on neuron circuits in the brain.

Furthermore, while reports suggest that psychedelics increase the dendritic spines in the frontal cortex and somatosensory cortex [21,22], studies also found that such effect might not be consistent across brain regions. For example, the default mode network (DMN) is a conserved brain network vulnerable to brain disorders, which showed hyperconnectivity in depressive patients [23]. Single-dose application of psychedelics to healthy subjects and patients with treatment-resistant depression decreased DMN activity and functional connectivity [24,25]. The orbitofrontal cortex (OFC) is a brain region that showed extensive enervation to brain regions in the DMN in both human and rodents [26,27], and psilocybin and other anti-depressants reduced the activity of the OFC or the functional connectivity of the OFC with brain region in the DMN [28,29]. Besides depressive disorders, it is well-established that the OFC is one of the most vulnerable brain regions in addiction [30,31] and obsessive-compulsive disorder [32,33], and current clinal trials showed that psilocybin and other psychedelics targeting 5-HT2A receptor are effective for the treatments of these disorders [5,7,[34], [35], [36], [37]]. However, the underlying mechanisms of psilocybin and other psychedelics on the activity and functional changes of the OFC are still not clear.

To illustrate the impact of psychedelics on the brain and its possible cell type-specific effect, in the present study, we combined single-nucleus RNA-seq, electrophysiology, and behavior tests to study the effect of single-dose application of psilocybin on gene expression and the function of cortical neurons in the OFC. Additionally, we also explored their possible contributions to the anti-depressant effect of psilocybin.

Materials and Methods

Mouse

Male C57BL/6J mice (RRID:IMSR_JAX:000664) and PV-Cre driver strain (B6.Cg-Pvalbtm1.1(cre)Aibs/J, RRID:IMSR_JAX:012358) were used. Mice genotyping was performed following the guidance of the Jackson Laboratory. Adult male mice aged 7–10 weeks-old were used, except for PV-Cre mice in repeated forced swimming test, which used mice aged 12–16 weeks-old. Mice were maintained on a 12-h light/dark cycle with food and water ad libitum. All experiments were performed in the dark cycle, and mice were randomly allocated to treatment condition.

All procedures are in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and have been approved by Peking University Animal Care and Use Committee.

Single-nucleus RNA sequencing (snRNA-seq) analysis

Mice were anesthetized with isoflurane and decapitated, the orbitofrontal cortex was dissected on ice, then froze and stored at −80 °C before further experiments (N = 4/group). Nuclei were isolated following 10x Genomics single cell protocols, suspended and loaded into the 10x Genomics controller. Single cell GEMs and libraries generation were performed according to Chromium Next GEM Single Cell 3ʹ kit workflow, then sequenced on the 10x Genomics sequencing platform with Illumina NovaSeq 6000.

Cellranger (v7.0.1, RRID:SCR_023221) analysis pipeline was used for sequence alignment and UMI counting. snRNA-seq analysis was performed with Seurat (v4.3.0, RRID:SCR_016341) [38] and scCustomize (v1.1.3) [39] in R (v4.2.2, RRID: SCR_001905). For cell-cell interaction analysis, CellChat (v1.6.0, RRID:SCR_021946) was used [40].

Virus injection and stereotaxic surgery

Adeno-associated viruses (AAV) were used in the present study. They were AAV2/9-SST-mCherry-WPRE-bGHpolyA (titer: 5.6 × 1012 GC/mL, BrainVTA), AAV/9-CaMKIIα-Cre (titer: 2.0 × 1012 GC/mL, BrainCase), and AAV/9-EF1α-DIO-mCherry (titer: titer: ≥ 5.0 × 1012 GC/mL, BrainCase), AAV-CaMKIIα-EYFP-WPRE-PA(titer: 5.33 × 1012 GC/mL, BrainVTA), AAV/9-EF1α-DIO-EGFP-5′miR-30a-shRHA(mHtr2a)-3′miR-30a (titer: ≥ 5.0 × 1012 GC/mL, BrainCase), and AAV/9-EF1α-DIO-EGFP-5′miR-30a-shRHA(Scramble)-3′miR-30a (titer: ≥ 5.0 × 1012 GC/mL, BrainCase). The sequences of sh-Htr2a and Scramble are GCTCTGTGCCGTCTGGATTTA and CCTAAGGTTAAGTCGCCCTCG, respectively. A total of 250 nL of virus solution was delivered at a rate of 50 nL/min with Micro4 controller (World Precision Instruments) to the injection site (A/P: +2.4; M/L: 1.2, DV: 2.5 mm).

RNAscope in situ hybridization assay and immunostaining

To analyze the expression of Htr2a mRNA neurons, we performed RNA in situ hybridization to quantify mRNAs as described previously [16,41]. Probes against the mRNAs of Htr2a (Advanced Cell Diagnostics, Cat#401291), Slc17a7 (Cat#416631 and #501101), Sst (Cat# 404631), and Pvalb (Cat# 421931) were used.

For immunostaining, 25-μm coronal sections were prepared with a cryostat (Leica). Primary antibodies used were Rabbit Anti-Glutamate receptor 1 (1:150, Millipore, Cat# AB1504, RRID:AB_2113602).

We acquired fluorescent images with a confocal microscope (Leica TCS-SP8 STED) using a 63 × objective (NA 1.4). The maximal projection of a 5 μm thick stack was analyzed with ImageJ (v1.53t, RRID:SCR_003070) based FIJI (RRID:SCR_002285). The analysis was performed as previously described [42]. For in situ hybridization assay, the combined region of Slc17a7, Pvalb, or Sst and enclosed DAPI area was defined as the cell area.

Electrophysiological recordings

To label PV+ and SST + neurons, we injected AAV-EF1α-DIO-mCherry or AAV-SST-mCherry into the OFC of PV-Cre + or C57BL/6J mice, respectively. Mice were allowed for at least 12 days to recover. Mice were i.p. injected with saline or psilocybin (1 mg/mL) randomly, and we performed electrophysiology experiments 24 h after the injection.

Recordings were performed as previously described [41,42], adult male mice aged 9–12 wks-old were used. Layer 5 pyramidal neuron in the orbitofrontal cortex (OFC) was identified by cell morphology and size. Parvalbumin- and Somatostatin-positive neurons were identified with fluorescence under the microscope (Olympus BX51WI).

Recordings were made with Multiclamp 700B amplifier and PCIe-6321 (National Instruments) controlled by AxoGraph X (AxoGraph). Data were filtered at 4 kHz and digitized at 20 kHz. Data were analyzed with Axograph X and NeuroMatic [43] (RRID: SCR_004186) in Igor Pro (Wavemetrics, RRID: SCR_000325).

Behavior tests

Repeated forced swimming test

The repeated forced swimming test was conducted as described in previous studies [[44], [45], [46]]. Briefly, the mice were forced to swim for 5 min daily for five consecutive days and then tested again on day 13. On day 6 and 24 h after the fifth forced swimming test, the mice were i.p. injected with 0.2–0.3 mL saline or 1 mg/kg body weight psilocybin dissolved in saline. Mice were gently transferred into a glass beaker (18 cm diameter, 13 cm water height at 26 ± 2 °C water). The behavior was recorded and analyzed offline by an observer blind to the treatment. After test, animals were dried with towel and placed in a warmer cage till fur fully dried, then returned to home cages.

Open field test and head-twitch response

Prior to testing, mice were transported to the test room and left undisturbed for at least 30 min. Animal activity in a plastic test arena (40 × 40 × 40 cm) was recorded with a camera mounted above the center. Mice were placed in the center of the arena for open field test. The activities of mice over 10 min were recorded. For open field test the first 5 min of animal activities in the arena were analyzed with Matlab (MathWorks, RRID:SCR_001622). The central area was defined as the 30 × 30 cm square space in the middle of the arena. The variables measured were distance traveled, time in the perimeter versus in the central area. For head twitches, the 10-mins video clips of animal activities in the arena were scored. The presence of “rapid paroxysmal rotational movement of the head” was recorded as a single head-twitch response. The behavior was recorded and counted by an observer blind to the treatment.

Drug

Ketanserin tartrate (1 mg/kg, Tocris) and MDL 100907 (0.75 mg/kg, Tocris) were administered intraperitoneally. Psilocybin (Cayman and GLPBIO) was dissolved in sterile saline and administered at a dose of 1 mg/mL intraperitoneally.

Statistical analysis

All reported sample numbers represent biological replicates. Sample sizes were estimated based on experience and those presented in the literature. Besides behavior and image analyses, all other data were collected and analyzed without the investigator blinded to treatment conditions. All statistical analyses and data plotting were performed with R (v4.2.2, RRID: SCR_001905), and the non-base attached packages for R were ggpubr (v0.6.0, RRID:SCR_021139), rstatix (v0.7.2, RRID:SCR_021240), tidyverse (v2.0.0, RRID:SCR_019186), emmeans (v1.8.5, RRID:SCR_018734). For boxplots, whiskers denoted 1.5 ∗ IQR from the hinges, which corresponded to the first and third quartiles of distribution. For comparisons between two groups, Wilcoxon test was used. For comparisons between multiple groups, Shapiro-Wilk test was used for normality test, and Levene's test was used for variance test. For multiple groups, two-way ANOVA with post hoc Tukey's test or one-way ANOVA with post hoc Holm-Bonferroni procedure were used based on experiment design. n, sample number of cells; N, sample number of mice. P < 0.05 is considered statistically significant.

Data and code availability

The raw and processed snRNA-seq data reported in this paper are available online (GEO: GSE246451). Any additional information that supports the findings of this study are available from the corresponding author upon request.

For detailed methods, see Supplementary Material and Methods.

Results

Single-cell landscape of the orbitofrontal cortex after psilocybin injection

To understand how psilocybin induced long-term changes in the cortex, we injected a single dose of psilocybin (1 mg/kg, intraperitoneally [i.p.]) into adult male mice (8-12 weeks-old) with mice injected with vehicle (saline) as control. Studies have shown that such dosage induced a sharp rise of head-twitch response, which is considered as hallucinatory behavior in rodents, dwindled to normal ∼3 h after injection in mice, while cortical neurons still showed persistent functional changes afterward [47]. We did not observe a difference in the head-twitch responses between saline- and psilocybin-injected (Saline and Psilocybin, respectively) mice 24 h after injection (Supplementary Fig. 1A and B), and these mice showed no difference in the open field test (Supplementary Fig. 1C). We dissected the brain region of the orbitofrontal cortex (OFC) 24 h after injection, then extracted the nucleus of cells to perform single-nucleus RNA sequencing (snRNA-seq, Fig. 1A). We generated data on 25237 cells post-quality control (Supplementary Fig. 2A) with 12246 cells from Saline mice and 12991 cells from Psilocybin mice (N = 4 mice per group, Supplementary Table 1). We identified 20 clusters of cells, all of which contain cells from both Saline and Psilocybin mice (Fig. 1B and Supplementary Table 1). These clusters were grouped into 3 major cell types based on known cortical cell markers [[48], [49], [50], [51]], including Glutamatergic, GABAergic, and non-neuronal cells (Fig. 1C). We further analyzed Glutamatergic cell clusters by the expression of cell-type specific genes of cortical excitatory neurons (Supplementary Fig. 2B) [[52], [53], [54]]. The results suggest the cells of Ex1 cluster were majorly composed of layer 5 excitatory Glutamatergic neurons.

Fig. 1.

Fig. 1

Single nucleus RNA sequencing of cells in the OFC of saline- and psilocybin-injected mice. (A) The sampled for single nucleus RNA sequencing (snRNA-seq) experiment was performed 24 h after i.p. injection of psilocybin (Psilocybin) or the vehicle (Saline). (B) Visualization of cell clusters in the OFC with t-distributed stochastic neighbor embedding (t-SNE). Dots represent individual cells, which were clustered into 3 major groups, 20 subgroups (Saline, n = 12246; Psilocybin, n = 12991; N = 4/group). (C) Dot plot of the expression of cell-type markers in clusters. (D) Violin plot of Htr2a expression in clusters. (E) RNAScope in situ hybridization analysis of Htr2a in layer 5 excitatory (Slc17a7+), inhibitory PV+ (Pvalb+), and inhibitory SST+ (Sst+) neurons of the OFC in Saline and Psilocybin mice. Top panels, characteristic images of Htr2a mRNA puncta in Slc17a7+, Pvalb+, and Sst + cells in layer 5 of OFC. Bottom boxplots, the comparisons of the density of Htr2a puncta in the three cell types (Two-way ANOVA, F(2, 345)cell type = 94.57, p < 0.00001; post hoc Games-Howell test; Slc17a7+: Saline, n = 52; Psilocybin, n = 55; Pvalb+: Saline, n = 74; Psilocybin, n = 68; Sst+: Saline, n = 50; Psilocybin, n = 52; N = 3/group). (F) Volcano plots of the differential gene expression analysis of the Ex1, Pvalb, and Sst cluster of snRNA-seq data between Psilocybin and Saline mice. (G) Reactome pathway-based gene set enrichment analysis of differential gene expressions in the Ex1 cluster between Psilocybin and Saline mice. (H) Network analysis of genes showing differential expression in Psilocybin mice with top annotated Reactome pathway categories of the Ex1 cluster.

Psilocybin is metabolized and dephosphorylated to psilocin in the body, which is an agonist of the 5-hydroxytryptamine receptor subunit 2A (5-HT2AR). In the medial frontal cortices of primates and rodents, 5-HT2ARs are densely expressed in layer 5 pyramidal neurons and interneurons [55,56]. We examined the expression of the mRNA (Htr2a) of 5-HT2AR in cell clusters of the OFC. We found Htr2a majorly expressed in the Glutamatergic and GABAergic neurons but not in those non-neuronal cells of the cortex (Fig. 1D). We then quantified the expression of the mRNAs of Htr2a in the OFCs with RNAscope in situ hybridization in major Glutamatergic (Slc17a7-positive) and inhibitory GABAergic (Pvalb- and Sst-positive) neurons of the layer 5 [41] (Fig. 1E and Supplementary Fig. 3). The mRNAs of Htr2a were more abundant in the Glutamatergic neurons than both types of inhibitory neurons, while there was no difference between Pvalb- and Sst-positive inhibitory neurons. We also found no difference in Htr2a expression in these types of neurons between Saline and Psilocybin mice, which suggests that psilocybin might not change Htr2a transcription in the OFC.

Psilocybin induced cell-type-specific gene expression changes in the OFC

To characterize the effect of psilocybin on gene expressions in the OFC, we performed differential gene expression analyses of cell clusters in the OFC. In the layer 5 of the OFC, we showed that layer 5 Glutamatergic pyramidal neurons and inhibitory Pvalb- and Sst-positive neurons assembled into a microcircuit, the integrated activity of this microcircuit controls the output of those pyramidal neurons [41]. Considering this we focused on the Ex1, Pvalb, and Sst clusters. We found that the cell cluster Ex1, the purported layer 5 pyramidal neurons, showed significant changes in gene expression (Fig. 1F). Meanwhile, both Pvalb and Sst clusters showed less differential expression of genes than the Ex1 cell cluster (Fig. 1F). These results suggest psilocybin-induced cell-type-dependent gene expression change. For the Ex1 cluster, we performed gene enrichment analysis based on the Reactome pathway database [57]. We found the majority of genes showing differential expression in Psilocybin mice enriched in synaptic transmissions and cell-cell interactions (Fig. 1G and Supplementary Table 2), such as glutamate receptor subunits (Fig. 1H and Supplementary Fig. 4), suggesting changes in synapse functions.

Psilocybin reduced cell-cell interactions among neurons in the OFC

The gene enrichment analysis showed gene expression changes of multiple signaling pathways involved in cell-cell interactions (Fig. 1G), especially in the synapse formation and maintenance of the Ex1 cluster. To identify the major signaling changes in these intercellular communications between cell clusters, we utilized CellChat [40] to analyze snRNA-seq results to characterize and compare the inferred cell-cell communication networks between clusters of Saline and Psilocybin mice. CellChat quantifies the signaling communication probability between two clusters incorporating the core interaction between ligands and receptors and protein bindings, such as cell-adhesion molecules involved in synapse formation and maintenance. The inferred cell-cell interactions change with CellChat from snRNA-seq data could offer insight into the possible changes in cell-cell communications [40].

We calculated the relative interaction strength of both outgoing and incoming interactions of clusters and found that the majority of clusters showed reductions in those interactions of Psilocybin mice (Fig. 2A). We compared the changes in cell-cell interaction signaling pathways between each cluster, and found that for the majority of cell-cell interaction between clusters, Psilocybin mice showed reductions in both the numbers of interactions between a given cluster-pair and the calculated interaction strength between such pair (Fig. 2B).

Fig. 2.

Fig. 2

Psilocybin affected cell-cell interactions in the OFC. (A) Comparison of the outgoing and incoming cell-cell interaction strength of clusters between Saline and Psilocybin mice with CellChat and snRNA-seq. (B) Heatmaps of the changes in the number of interactions (left panel) and the interaction strength (right panel) between clusters of Psilocybin compared with Saline mice. For heatmaps, the top bar plot represents the sum of column of values displayed in the heatmap (incoming signaling). The right bar plot represents the sum of row of values (outgoing signaling). (C - E) Chord diagrams of the changed cell-cell interaction signaling pathways of Ex1 (C), Pvalb (D), and Sst (E) clusters with other neuronal cell clusters in Psilocybin mice. Arrows in chord diagrams indicate the target clusters of cell-cell interactions. For the parts of the chord diagrams with double arcs, the inner ones indicate the targets that receive signal from the corresponding outer arcs, and the arc size is proportional to the signal strength received by the target.

We further analyzed all the interactions sending or receiving from the Ex1, Pvalb, and Sst clusters to other neuron clusters. Consistent with the change of global cell-cell interaction in clusters (Fig. 2B), the Ex1, Pvalb, and Sst clusters showed more down-regulated pathways in Psilocybin mice than up-regulated (Fig. 2C–E). We found that the affected cell-cell interaction pathways accumulated into 9 cell-cell interaction signaling pathways (Fig. 2C–E), namely CADM, CDH, EPHA, FGF, NGL, NRG, NRXN, PTN, SEMA6 signaling pathways (Supplementary Fig. 5 - 13). These down-regulated pathways in Psilocybin mice (Fig. 2C–E) were important for synapse functions, especially excitatory synapse formation and maintenance [[58], [59], [60], [61], [62], [63], [64], [65], [66]]. Combined with the gene set enrichment analysis of differential gene expression of the Ex1 cluster (Fig. 1G and H), these analyses strongly suggest psilocybin induced changes in neuronal activity and synaptic transmissions of the Ex1 cluster.

Psilocybin induced a reduction of activity in the OFC

In the OFC, our previous study have shown that layer 5 excitatory neuron, PV + inhibitory neuron, and SST + inhibitory neuron assembled a microcircuit which is critical to the output of the OFC [41]. Our analysis of snRNA-seq results also showed that the purported layer 5 pyramidal neuron cluster (Ex1 cluster), PV + neuron cluster (Pvalb cluster), and SST + neuron cluster (Sst cluster) all exhibited changes in gene expressions after single-dose psilocybin injection (Fig. 1, Fig. 2). To understand the functional changes of the OFC after psilocybin injection, we characterized the electrophysiological properties of these types of neurons in the OFC. We recorded synaptic and intrinsic properties of the layer 5 Glutamatergic pyramidal neurons, GABAergic PV+, and GABAergic SST+ neurons in the OFC. Consistent with the differential gene expression analyses of cell clusters, Psilocybin mice showed cell type-specific changes in activities. The layer 5 pyramidal neurons showed reduced the output as less firing was observed (Fig. 3A), while we did not observe a change in membrane properties or the properties of action potentials (Supplementary Fig. 14A). We also recorded spontaneous EPSCs, and consistent with a reduction in Gria1 expression in the Ex1 cluster (Supplementary Fig. 4A), we observed decreased excitatory transmission (Fig. 3B). On the other hand, the spontaneous IPSCs of pyramidal neurons did not change (Supplementary Fig. 15A). These results showed a decrease in synaptic activities and the output of pyramidal neurons.

Fig. 3.

Fig. 3

Psilocybin induced cell-type specific changes of neuronal activities in the OFC. (A) F–I plot shows reduced excitability of excitatory layer 5 pyramidal neurons in psilocybin mice (Two-way ANOVA, F(3, 269) = 12.1; Saline, n = 22, N = 4; Psilocybin, n = 17; N = 6). (B) Reduced frequency of spontaneous EPSC of excitatory layer 5 pyramidal neurons of Psilocybin mice (p, Wilcoxon test; Saline, n = 22, N = 4; Psilocybin, n = 20; N = 5). (C) SST + neurons didn't show change of intrinsic excitability (Saline, n = 28, N = 3; Psilocybin, n = 20; N = 3). (D) F–I plot showed enhanced excitability of inhibitory PV + neurons (Two-way ANOVA, F(3, 332) = 5.6; Saline, n = 18, N = 5; Psilocybin, n = 30; N = 7). (E) PV + neurons showed intrinsic properties changes. The threshold (left panel) and half-width (right panel) of action potential decreased (p, Wilcoxon test; Saline, n = 25, N = 6; Psilocybin, n = 30; N = 7). (F) Increased amplitude of spontaneous IPSC of PV + neurons of Psilocybin mice (p, Wilcoxon test; Saline, n = 14, N = 6; Psilocybin, n = 12; N = 6).

For the GABAergic SST + neurons, we observed no difference in intrinsic properties or synaptic inputs of SST + neurons between Saline and Psilocybin mice (Fig. 3C, Supplementary Fig. 14C, and Supplementary Fig. 15C).

Last, we recorded GABAergic PV + neurons; the firing of these neurons increased in Psilocybin mice, with the threshold and half-width of action potential decreased (Fig. 3D, E and Supplementary Fig. 14B). Interestingly, while the excitatory transmission did not change, the amplitude of sIPSC increased (Fig. 3F, Supplementary Fig. 14B, and Supplementary Fig. 15B).

Taken together, considering layer 5 pyramidal neurons are the major output neurons and these three types of neurons assembled into a microcircuit in the OFC [41], these data suggest psilocybin reduced the output of the OFC.

Blockage of 5-HT2A receptors abolished psilocybin induced neuronal activity changes

Psilocin, the metabolite of psilocybin not only binds to 5-HT2A receptors, also the 5-HT1A and 5-HT2C receptors [67]. To understand whether the long-term changes of neuronal activities in the OFC were mediated by 5-HT2A receptor, we pre-treated mice with MDL 100907 (MDL, 0.75 mg/kg), a high affinity antagonist of 5-HT2A receptors [68,69] or ketanserin tartrate (KET, 1 mg/kg), then evaluated the effects of psilocybin on mice. MDL and KET were i.p. injected 30 min before the i.p. injection of psilocybin (Fig. 4A). We counted the occurrence of the head twitch response (HTR) of mice 10 min after psilocybin injection. As shown in Fig. 4B, pre-treatment with MDL and KET blocked increased HTR after psilocybin injection. 24 h after psilocybin injection with MDL and KET pre-treatment, we recorded the neuronal activities of layer 5 pyramidal neurons in the OFC. We found that compared with mice injected with saline, injection of psilocybin with MDL or KET pre-treatment did not change the output (Fig. 4C) or the intrinsic properties (Fig. 4D) of these neurons. Furthermore, the recordings of spontaneous EPSCs also showed the excitatory synaptic activities of these neurons did not change when compared with mice injected with saline (Fig. 4E). These results suggest that psilocybin induced long-term activity change in the OFC was majorly mediated by the 5-HT2A receptors.

Fig. 4.

Fig. 4

Pretreatment with MDL 100907 and Ketanserin blocked psilocybin induced changes of neuronal activities in the OFC. (A) Experiment diagram. Mice were injected with MDL 100907 (MDL), Ketanserin (KET), or vehicle 30 min before psilocybin (PSI) injection. Then, the head twitch responses (HTR) of mice were analyzed during the 10th to the 20th mins following psilocybin injection. 24 h after psilocybin injection, the intrinsic properties and synaptic activities of layer 5 pyramidal neurons (L5 Pyr) were recorded. (B) Pretreatment with MDL and KET blocked HTR after psilocybin injection in mice (Kruskal-Wallis Test, p = 0.0159; post hoc Games Howell Test; Veh + Saline, N = 3, Veh + PSI, N = 4; KET + PSI, N = 4; MDL + PSI, N = 3). (CD) Mice injected with psilocybin after pretreatment of MDL or KET did not show changes of intrinsic properties of L5 Pyr neurons in compared with mice injected with saline. (C) F–I plot of action potentials (Two-way ANOVA, F(3, 498) = 1.067). (D) Box plots of intrinsic properties of L5 Pyr neurons. (Welch's ANOVA; Veh + Saline, N = 3, n = 22; KET + PSI, N = 4, n = 24; MDL + PSI, N = 3, n = 26). (E) Mice injected with psilocybin after pretreatment of MDL or KET did not show changes of excitatory synaptic transmission of L5 Pyr neurons in compared with mice injected with saline. (Welch's ANOVA; Veh + Saline, N = 3, n = 22; KET + PSI, N = 4, n = 24; MDL + PSI, N = 3, n = 26).

Cell-type-specific deletion of Htr2a in the OFC compromised the anti-depressant effect of psilocybin

To understand the mechanism of cell-type specific changes of neuronal activities in the OFC and their contribution to the animal behavior, we first performed cell-type specific deletion of the Htr2a in neurons of the OFC and examined mRNA expressions in these neurons. By AAV-mediated Cre-dependent shRNA, we found that sh-Htr2a reduced the expressions of the Htr2a mRNA in the infected neurons while excitatory neurons in the adjacent non-infected frontal association cortex (FrA) did not show changes in the mRNA of Htr2a (Fig. 5A and Supplementary Fig. 16A and B). Neurons not only show plasticity with external stimuli, they also exhibit “homeostatic plasticity” that acts to stabilize neuronal and circuit activity to counterbalance activity changes of other neurons [70]. The snRNA-seq results showed in the purported layer 5 excitatory neurons cluster (Ex1 cluster), the mRNA of AMPA receptor subunit GluR1 (Gria1) showed reduction after single-dose psilocybin injection (Fig. 1F), which might be mediated by homeostatic regulations. We then evaluated sh-Htr2a on GluR1 expression in layer 5 excitatory neurons, and found AAV-mediated deletion of Htr2a in the layer 5 excitatory neurons abolished the reduction of GluR1 after psilocybin injection, suggesting such a reduction of GluR1 in excitatory neurons in the OFC is a direct effect of the activation of 5-HT2AR by psilocybin, but not via homeostatic regulation of the local circuit (Fig. 5B).

Fig. 5.

Fig. 5

Knockdown of Htr2a blocked psilocybin induced GluR1 down-regulation and anti-depressant effect in rFST. (A) shRNA reduced the expression of mRNA of Htr2a in the infected layer 5 excitatory neurons of the OFC but not adjacent non-infected layer 5 excitatory neurons of the FrA (Two-way ANOVA, F(3,339) = 13.1, p = 0.00034; post hoc Games-Howell Test: Scramble vs sh-Htr2a in the OFC, p = 0.0003; Scramble vs sh-Htr2a in the FrA, p = 0.307; Scramble of the OFC, n = 86; sh-Htr2a of the OFC, n = 103; Scramble of the FrA, n = 78; sh-Htr2a of the FrA, n = 76; N = 3/group). (B) sh-Htr2a blocked psilocybin induced GluR1 down-regulation in layer 5 pyramidal neurons. Psilocybin or saline was i.p. injected 24 h before tissue collection (Two-way ANOVA, F(3,156) = 5.04, p = 0.026; post hoc Tukey test: Saline + Scramble vs Psilocybin + Scramble, p = 0.0046; Psilocybin + Scramble vs Psilocybin + sh-Htr2a, p = 0.00049; Saline + sh-Htr2a vs Psilocybin + Scramble, p = 0.00084; Saline + Scramble, n = 39; Saline + sh-Htr2a, n = 33; Psilocybin + Scramble, n = 46; Psilocybin + sh-Htr2a, n = 42; N = 3/group). (C) Cell-type specific knockdown of Htr2a on the anti-depressant effect of psilocybin in rFST. Top panel, experiment timeline, arrowheads indicate timepoints of FSTs. Psilocybin or saline was i.p. injected 24 h after the FST on day 5 (Pre-Test). Bottom panel, the comparisons of the difference in immobile times of the last two FSTs, namely FST on day 13 (Test) and FST on day 5 (Pre-Test) (One-way ANOVA, F [3,29] = 10.09, p = 0.0001; post hoc Holm test: Camk2-Scramble + Saline vs Camk2-Scramble + Psilocybin, p = 6.3 × 10−5; Camk2-Scramble + Psilocybin vs Camk2-sh-Htr2a + Psilocybin, p = 0.02; Camk2-Scramble + Saline vs PV-sh-Htr2a + Psilocybin, p = 0.02; Camk2-Scramble + Saline, N = 10; Camk2-Scramble + Psilocybin, N = 10; Camk2-sh-Htr2a + Psilocybin, N = 6; PV-sh-Htr2a + Psilocybin, N = 7).

Recent studies have shown the therapeutic potential of psilocybin as an anti-depressant. A single dose of psilocybin promoted a quick and long-lasting anti-depressant effect in both animal and clinical studies [8,21,44,71,72]. To illustrate the contribution of the neurons in the OFC to the anti-depressant effect of psilocybin, we induced cell-type specific deletion of Htr2a, then evaluated the effect of single-dose injection of psilocybin on animal behavior (Fig. 5C and Supplementary Fig. 16D). We injected Cre-dependent sh-Htr2a into the OFC of mice and then evaluated the anti-depressant effect of psilocybin with a chronic stress model, specifically, repeated forced swimming, which induces a depressive-like behavior in mice [[44], [45], [46]] (Fig. 5C and Supplementary Fig. 16B and C). Compared with mice injected with saline, a single injection of psilocybin reduced the immobile time of mice in the repeated forced swimming test. Furthermore, knockdown of Htr2a in excitatory neurons in the OFC abated the anti-depressant effect of psilocybin, while knockdown of Htr2a in PV + neurons only partially reduced the anti-depressant effect of psilocybin.

Discussion

In the present study, we combined single nucleus RNA-seq with functional assays to study the long-term effect of psilocybin on cells of the orbitofrontal cortex (OFC), especially on neurons. We showed psilocybin-induced gene expression changes in neurons of the OFC, which contribute to the functional changes in these neurons and the OFC. Furthermore, such function changes depending on the expression of 5-HT2A receptors in excitatory neurons of the deep layers as knockdown of Htr2a reversed psilocybin-induced changes in GluR1 (Gria1) and its anti-depressant effect.

Our recordings from layer 5 pyramidal excitatory neurons, inhibitory PV+, and SST + neurons showed that psilocybin induced different neuronal activity changes in these three types of neurons. In the agranular cortex, including prefrontal cortical regions and the motor cortex, our studies and others have shown that in a microcircuit composed of these three types of neurons, while the pyramidal neurons serve as the main output, the tone of inhibition to these neurons is determined by PV + neuron activity with SST + neurons mainly modulate PV + neuron activity [41,42,73]. In the present study, we observed decreased synaptic transmission and output from layer 5 pyramidal neurons and increased output from PV + neurons, while those of the SST + neurons did not change after psilocybin injection. Our findings indicate that psilocybin led to decreased network activity in the OFC. Such a reduction is also consistent with previous studies, which showed that activation of 5-HT2AR in the OFC decreased population neuronal activity [74].

Our snRNA-seq results showed that the Ex1 cluster of the OFC neurons showed the most significant gene expression changes in Psilocybin mice. Besides reduced expression of glutamate receptors, the most affected genes are involved in synaptic transmission, cell-adhesion at synapse, and synapse formation and maintenance. Analysis of those cell-cell interaction signaling pathways showed that besides the Epha5-Efna5 signaling pathway, other affected pathways between neuronal clusters all majorly showed reductions in Psilocybin mice. Meanwhile, it is interesting that we did not observe changes in the expression of genes involved in excitatory synaptic transmission or recorded changes in sEPSCs in both PV+ and SST + neurons. Furthermore, deletion of Htr2a in PV + neurons did not abolish the anti-depressant effect of psilocybin. These data suggest that these two types of interneurons might not be the main target of psilocybin, which in part supports the view that deep-layer pyramidal neurons are important for the effects of psilocybin. It is unclear whether the relatively low expression of Htr2a in these neurons contributes to their relative insensitivity to psilocybin.

Psilocybin is metabolized into psilocin in the body, which is an agonist of 5-HT2A receptor (5-HT2AR). 5-HT2ARs are G-protein coupled receptors, which activates intracellular Gαq-like G proteins and β-arrestin signaling pathway. While the downstream targets of the activation of 5-HT2AR is not fully illustrated, studies have shown that psilocybin and other psychedelics induced long-term plasticity change and gene expression change in neurons [75], suggesting increased excitatory transmission in the brain. On the other hand, studies also showed that lesion or chronic inactivation of the OFC decreased depression-like behavior in rats [76,77].

In the present study, both the analysis of the snRNA-seq data and electrophysiological recordings of the neurons in the OFC showed changes in the excitatory transmission of the layer 5 excitatory neurons. We observed reductions of the mRNAs of both AMPA and NMDA receptors in the Ex1 cluster, which is mainly composed of the layer 5 excitatory neurons. Besides, we also observed reduced excitatory synaptic transmission of layer 5 pyramidal neurons with no changes in the amplitude of spontaneous EPSCs. These results suggest a possible reduction in the excitatory synapses, which may lead to decreased output of these neurons, as we observed. Consistent with this, the analysis of cell-cell interaction pathways based on snRNA-seq data showed reduced expression of mRNAs in several inter-neuronal signaling pathways involved in synapse formation and maintenance. Of these signaling pathways, the NGL signaling pathway showed a specific reduction in the Ex1 cluster, but not in either the Pvalb or Sst clusters of inhibitory neurons. Of molecules in the NGL signaling pathway, we found both Lrrc4 and Lrrc4c reduced after psilocybin treatment in the Ex1 cluster. Lrrc4 interacts directly with ERK1/2, and its activation inhibits the MEK/ERK signaling pathway in glioma cells [78,79]. Studies have shown that 5-HT2A receptor activation could activate the MEK/ERK signaling pathway in neurons [[80], [81], [82], [83], [84], [85]], and both Gαq and β-arrestin signaling pathways could activate the MEK/ERK pathway [[86], [87], [88]]. Furthermore, activated ERK helps to recruit the transcription factor AP-2 to DNA sites, which promotes the expression of microRNA-182, and microRNA-182 suppresses Lrrc4 expression [[89], [90], [91]]. These studies suggest the possibility that 5-HT2A receptor activation by a single-dose psilocybin might affect the expression of Lrrc4 via the MEK/ERK pathway. Previous studies have shown that the reduction of both Lrrc4 and Lrrc4c leads to reduced excitatory synapses [[92], [93], [94], [95]]. Both Lrrc4 and Lrrc4c are post-synaptic proteins, and we did not observe changes in their pre-synaptic counterparts (Ntng1 and Ntng2) [94,96]. Considering these, Lrrc4 and the NGL signaling pathway of the layer 5 pyramidal neurons could be candidates for the reduced activities of the OFC after single-dose psilocybin injection. Consistent with this, we didn't observe changes in the excitatory synaptic activities of both Parvalbumin- and Somatostatin-positive inhibitory neurons. These results suggest that the single-dose psilocybin treatment mainly affects the layer 5 excitatory neurons of the OFC. Consistently, we also found that the cell-type-specific knockdown of 5-HT2A receptors in layer 5 pyramidal neurons, but not Parvalbumin-positive inhibitory neurons, abated the anti-depressant effect of psilocybin on the depressive-like behavior of mice. Similarly, a recent study on the medial frontal cortex reported that the layer 5 pyramidal neurons played a key role in the effect of psilocybin on brain activities [97]. Together, our findings indicate that psilocybin selectively reduces excitatory transmission and the output of layer 5 pyramidal neurons of the OFC through the regulation of molecules involved in synapse formation and maintenance, which may underlie its effects on cortical activity.

The orbitofrontal cortex is well known for its role in decision making and is essential for encoding information about rewards [98]. Recent studies also showed that the OFC is vulnerable in psychological disorders. For example, clinical studies have shown that in both adults and adolescents with MDD the OFC were one of the most affected brain regions, showing thinner cortical gray matter or reduced total surface area [99]. Furthermore, the effectiveness of the antidepressant treatment is associated with the decrease of the activation of the OFC [29], and anti-depressants on healthy subjects reduced connectivity of the OFC with subcortical regions, such as the amygdala and the striatum [100]. The OFC connect with many cortical and subcortical regions, among its targets both the ventral medial prefrontal cortex and the posterior cingulate cortex are also major components of the default-mode network (DMN) [26]. The DMN exists not only in human, also in primates and rodents [101,102]. Studies implicated depressive symptomology associated with hyperconnectivity of the DMN [23], increased functional connectivity of the posterior cingulate cortex with the OFC in MDD patients, and anti-depressants also reduced this functional connectivity [28]. Furthermore, in the brain, psilocybin and other psychedelics reduced the activity and functional connectivity of the DMN [25,103], while single dose of psilocybin also decreased DMN recruitment in patients with treatment-resistant depression [24]. Taken together, these studies have suggested that the anti-depressant effect of psychedelics and traditional anti-depressants is associated with reduced activity and/or output of the OFC.

In conclusion, by combining snRNA-seq with electrophysiology and behavior tests, we showed that psilocybin induced cell-type-specific long-term changes in the neurons of the OFC. Among neurons in the OFC, the layer 5 pyramidal neurons were the major neuronal type affected by a single-dose injection of psilocybin with both genetic and functional changes. Furthermore, cell-type-specific deletion of 5-HT2A receptor in layer 5 pyramidal neurons but not Parvalbumin-positive inhibitory neurons reduced the anti-depressant effect of psilocybin injection. These findings provide novel insights into the cellular mechanisms underlying the therapeutic effects of psilocybin and may help the development of strategies for the treatment of depression.

Author contributions

W.Z. conceived and designed the experiments. Z.H., X.W., Y.W., and T.J. performed the experiments. Z.H., X.W., Y.W., J.T., J.D, B.L., and W.Z. analyzed and interpreted the data. W.Z. and L.B. wrote the manuscript with inputs from other authors.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgment

Research was supported in part by Ministry of Science and Technology of China (STI2030-Major Projects 2021ZD0202900 and 2019YFA0706201, W.Z.), National Natural Science Foundation of China (32170960, W.Z.).

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.neurot.2026.e00841.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.docx (7.8MB, docx)

References

  • 1.Collaborators GBDMD Global, regional, and national burden of 12 mental disorders in 204 countries and territories, 1990-2019: a systematic analysis for the global burden of disease study 2019. Lancet Psychiatry. 2022;9(2):137–150. doi: 10.1016/S2215-0366(21)00395-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Collaborators C-MD Global prevalence and burden of depressive and anxiety disorders in 204 countries and territories in 2020 due to the COVID-19 pandemic. Lancet. 2021;398(10312):1700–1712. doi: 10.1016/S0140-6736(21)02143-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cipriani A., Furukawa T.A., Salanti G., Chaimani A., Atkinson L.Z., Ogawa Y., et al. Comparative efficacy and acceptability of 21 antidepressant drugs for the acute treatment of adults with major depressive disorder: a systematic review and network meta-analysis. Lancet. 2018;391(10128):1357–1366. doi: 10.1016/S0140-6736(17)32802-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wiesinger T., Kremer S., Bschor T., Baethge C. Antidepressants and quality of life in patients with major depressive disorder - systematic review and meta-analysis of double-blind, placebo-controlled RCTs. Acta Psychiatr Scand. 2023;147(6):545–560. doi: 10.1111/acps.13541. [DOI] [PubMed] [Google Scholar]
  • 5.Moreno F.A., Wiegand C.B., Taitano E.K., Delgado P.L. Safety, tolerability, and efficacy of psilocybin in 9 patients with obsessive-compulsive disorder. J Clin Psychiatry. 2006;67(11):1735–1740. doi: 10.4088/jcp.v67n1110. [DOI] [PubMed] [Google Scholar]
  • 6.Bogenschutz M.P., Forcehimes A.A., Pommy J.A., Wilcox C.E., Barbosa P.C., Strassman R.J. Psilocybin-assisted treatment for alcohol dependence: a proof-of-concept study. J Psychopharmacol. 2015;29(3):289–299. doi: 10.1177/0269881114565144. [DOI] [PubMed] [Google Scholar]
  • 7.Bogenschutz M.P., Ross S., Bhatt S., Baron T., Forcehimes A.A., Laska E., et al. Percentage of heavy drinking days following psilocybin-assisted psychotherapy vs placebo in the treatment of adult patients with alcohol use disorder: a randomized clinical trial. JAMA Psychiatry. 2022;79(10):953–962. doi: 10.1001/jamapsychiatry.2022.2096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Carhart-Harris R.L., Bolstridge M., Rucker J., Day C.M., Erritzoe D., Kaelen M., et al. Psilocybin with psychological support for treatment-resistant depression: an open-label feasibility study. Lancet Psychiatry. 2016;3(7):619–627. doi: 10.1016/S2215-0366(16)30065-7. [DOI] [PubMed] [Google Scholar]
  • 9.Mithoefer M.C., Mithoefer A.T., Feduccia A.A., Jerome L., Wagner M., Wymer J., et al. 3,4-methylenedioxymethamphetamine (MDMA)-assisted psychotherapy for post-traumatic stress disorder in military veterans, firefighters, and police officers: a randomised, double-blind, dose-response, phase 2 clinical trial. Lancet Psychiatry. 2018;5(6):486–497. doi: 10.1016/S2215-0366(18)30135-4. [DOI] [PubMed] [Google Scholar]
  • 10.Mitchell J.M., Ot'alora G.M., van der Kolk B., Shannon S., Bogenschutz M., Gelfand Y., et al. MDMA-assisted therapy for moderate to severe PTSD: a randomized, placebo-controlled phase 3 trial. Nat Med. 2023;29(10):2473–2480. doi: 10.1038/s41591-023-02565-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Leonard H.L., Rapoport J.L. Relief of obsessive-compulsive symptoms by LSD and psilocin. Am J Psychiatr. 1987;144(9):1239–1240. doi: 10.1176/ajp.144.9.1239b. [DOI] [PubMed] [Google Scholar]
  • 12.Kwan A.C., Olson D.E., Preller K.H., Roth B.L. The neural basis of psychedelic action. Nat Neurosci. 2022;25(11):1407–1419. doi: 10.1038/s41593-022-01177-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ly C., Greb A.C., Cameron L.P., Wong J.M., Barragan E.V., Wilson P.C., et al. Psychedelics promote structural and functional neural plasticity. Cell Rep. 2018;23(11):3170–3182. doi: 10.1016/j.celrep.2018.05.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yoshida H., Kanamaru C., Ohtani A., Li F., Senzaki K., Shiga T. Subtype specific roles of serotonin receptors in the spine formation of cortical neurons in vitro. Neurosci Res. 2011;71(3):311–314. doi: 10.1016/j.neures.2011.07.1824. [DOI] [PubMed] [Google Scholar]
  • 15.Jones K.A., Srivastava D.P., Allen J.A., Strachan R.T., Roth B.L., Penzes P. Rapid modulation of spine morphology by the 5-HT2A serotonin receptor through kalirin-7 signaling. Proc Natl Acad Sci U S A. 2009;106(46):19575–19580. doi: 10.1073/pnas.0905884106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhang W., Daly K.M., Liang B., Zhang L., Li X., Li Y., et al. BDNF rescues prefrontal dysfunction elicited by pyramidal neuron-specific DTNBP1 deletion in vivo. J Mol Cell Biol. 2017;9(2):117–131. doi: 10.1093/jmcb/mjw029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang W., Peterson M., Beyer B., Frankel W.N., Zhang Z.W. Loss of MeCP2 from forebrain excitatory neurons leads to cortical hyperexcitation and seizures. J Neurosci. 2014;34(7):2754–2763. doi: 10.1523/JNEUROSCI.4900-12.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yuste R., Hawrylycz M., Aalling N., Aguilar-Valles A., Arendt D., Armananzas R., et al. A community-based transcriptomics classification and nomenclature of neocortical cell types. Nat Neurosci. 2020;23(12):1456–1468. doi: 10.1038/s41593-020-0685-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Campagnola L., Seeman S.C., Chartrand T., Kim L., Hoggarth A., Gamlin C., et al. Local connectivity and synaptic dynamics in mouse and human neocortex. Science. 2022;375(6585):eabj5861. doi: 10.1126/science.abj5861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Xu H., Jeong H.Y., Tremblay R., Rudy B. Neocortical somatostatin-expressing GABAergic interneurons disinhibit the thalamorecipient layer 4. Neuron. 2013;77(1):155–167. doi: 10.1016/j.neuron.2012.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shao L.X., Liao C., Gregg I., Davoudian P.A., Savalia N.K., Delagarza K., et al. Psilocybin induces rapid and persistent growth of dendritic spines in frontal cortex in vivo. Neuron. 2021;109(16):2535. doi: 10.1016/j.neuron.2021.06.008. 44.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.de la Fuente Revenga M., Zhu B., Guevara C.A., Naler L.B., Saunders J.M., Zhou Z., et al. Prolonged epigenomic and synaptic plasticity alterations following single exposure to a psychedelic in mice. Cell Rep. 2021;37(3) doi: 10.1016/j.celrep.2021.109836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hamilton J.P., Furman D.J., Chang C., Thomason M.E., Dennis E., Gotlib I.H. Default-mode and task-positive network activity in major depressive disorder: implications for adaptive and maladaptive rumination. Biol Psychiatry. 2011;70(4):327–333. doi: 10.1016/j.biopsych.2011.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Daws R.E., Timmermann C., Giribaldi B., Sexton J.D., Wall M.B., Erritzoe D., et al. Increased global integration in the brain after psilocybin therapy for depression. Nat Med. 2022;28(4):844–851. doi: 10.1038/s41591-022-01744-z. [DOI] [PubMed] [Google Scholar]
  • 25.Carhart-Harris R.L., Erritzoe D., Williams T., Stone J.M., Reed L.J., Colasanti A., et al. Neural correlates of the psychedelic state as determined by fMRI studies with psilocybin. Proc Natl Acad Sci USA. 2012;109(6):2138–2143. doi: 10.1073/pnas.1119598109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ongur D., Price J.L. The organization of networks within the orbital and medial prefrontal cortex of rats, monkeys and humans. Cerebr Cortex. 2000;10(3):206–219. doi: 10.1093/cercor/10.3.206. [DOI] [PubMed] [Google Scholar]
  • 27.Whitesell J.D., Liska A., Coletta L., Hirokawa K.E., Bohn P., Williford A., et al. Regional, layer, and cell-type-specific connectivity of the mouse default mode network. Neuron. 2021;109(3):545–559 e8. doi: 10.1016/j.neuron.2020.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cheng W., Rolls E.T., Qiu J., Xie X., Wei D., Huang C.C., et al. Increased functional connectivity of the posterior cingulate cortex with the lateral orbitofrontal cortex in depression. Transl Psychiatry. 2018;8(1):90. doi: 10.1038/s41398-018-0139-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Delaveau P., Jabourian M., Lemogne C., Guionnet S., Bergouignan L., Fossati P. Brain effects of antidepressants in major depression: a meta-analysis of emotional processing studies. J Affect Disord. 2011;130(1-2):66–74. doi: 10.1016/j.jad.2010.09.032. [DOI] [PubMed] [Google Scholar]
  • 30.Koob G.F., Volkow N.D. Neurocircuitry of addiction. Neuropsychopharmacology. 2010;35(1):217–238. doi: 10.1038/npp.2009.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Volkow N.D., Wang G.J., Fowler J.S., Logan J., Schlyer D., Hitzemann R., et al. Imaging endogenous dopamine competition with [11C]raclopride in the human brain. Synapse. 1994;16(4):255–262. doi: 10.1002/syn.890160402. [DOI] [PubMed] [Google Scholar]
  • 32.Menzies L., Chamberlain S.R., Laird A.R., Thelen S.M., Sahakian B.J., Bullmore E.T. Integrating evidence from neuroimaging and neuropsychological studies of obsessive-compulsive disorder: the orbitofronto-striatal model revisited. Neurosci Biobehav Rev. 2008;32(3):525–549. doi: 10.1016/j.neubiorev.2007.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Milad M.R., Rauch S.L. Obsessive-compulsive disorder: beyond segregated cortico-striatal pathways. Trends Cognit Sci. 2012;16(1):43–51. doi: 10.1016/j.tics.2011.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Calder A.E., Hasler G. Towards an understanding of psychedelic-induced neuroplasticity. Neuropsychopharmacology. 2023;48(1):104–112. doi: 10.1038/s41386-022-01389-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Krebs T.S., Johansen P.O. Lysergic acid diethylamide (LSD) for alcoholism: meta-analysis of randomized controlled trials. J Psychopharmacol. 2012;26(7):994–1002. doi: 10.1177/0269881112439253. [DOI] [PubMed] [Google Scholar]
  • 36.Johnson M.W., Garcia-Romeu A., Cosimano M.P., Griffiths R.R. Pilot study of the 5-HT2AR agonist psilocybin in the treatment of tobacco addiction. J Psychopharmacol. 2014;28(11):983–992. doi: 10.1177/0269881114548296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wilcox J.A. Psilocybin and obsessive compulsive disorder. J Psychoact Drugs. 2014;46(5):393–395. doi: 10.1080/02791072.2014.963754. [DOI] [PubMed] [Google Scholar]
  • 38.Hao Y., Hao S., Andersen-Nissen E., Mauck W.M., 3rd, Zheng S., Butler A., et al. Integrated analysis of multimodal single-cell data. Cell. 2021;184(13):3573–3587 e29. doi: 10.1016/j.cell.2021.04.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Marsh S. 2021. scCustomize: custom visualizations & functions for streamlined analyses of single cell sequencing. [Google Scholar]
  • 40.Jin S., Guerrero-Juarez C.F., Zhang L., Chang I., Ramos R., Kuan C.H., et al. Inference and analysis of cell-cell communication using CellChat. Nat Commun. 2021;12(1):1088. doi: 10.1038/s41467-021-21246-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Huang Z., Wei X., Tian J., Fu Y., Dong J., Wang Y., et al. A disinhibitory microcircuit of the orbitofrontal cortex mediates cocaine preference in mice. Mol Psychiatr. 2024;29(10):3160–3169. doi: 10.1038/s41380-024-02579-5. [DOI] [PubMed] [Google Scholar]
  • 42.Zhang W., Zhang L., Liang B., Schroeder D., Zhang Z.W., Cox G.A., et al. Hyperactive somatostatin interneurons contribute to excitotoxicity in neurodegenerative disorders. Nat Neurosci. 2016;19(4):557–559. doi: 10.1038/nn.4257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Rothman J.S., Silver R.A. NeuroMatic: an integrated open-source software toolkit for acquisition, analysis and simulation of electrophysiological data. Front Neuroinf. 2018;12:14. doi: 10.3389/fninf.2018.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Moliner R., Girych M., Brunello C.A., Kovaleva V., Biojone C., Enkavi G., et al. Psychedelics promote plasticity by directly binding to BDNF receptor TrkB. Nat Neurosci. 2023;26(6):1032–1041. doi: 10.1038/s41593-023-01316-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Normann C., Frase S., Haug V., von Wolff G., Clark K., Munzer P., et al. Antidepressants rescue stress-induced disruption of synaptic plasticity via serotonin transporter-independent inhibition of L-Type calcium channels. Biol Psychiatry. 2018;84(1):55–64. doi: 10.1016/j.biopsych.2017.10.008. [DOI] [PubMed] [Google Scholar]
  • 46.Vestring S., Serchov T., Normann C. Animal models of depression - chronic Despair Model (CDM) J Vis Exp. 2021;(175) doi: 10.3791/62579. [DOI] [PubMed] [Google Scholar]
  • 47.Shao L.X., Liao C., Gregg I., Davoudian P.A., Savalia N.K., Delagarza K., et al. Psilocybin induces rapid and persistent growth of dendritic spines in frontal cortex in vivo. Neuron. 2021;109(16):2535–25344 e4. doi: 10.1016/j.neuron.2021.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Franzen O., Gan L.M., Bjorkegren J.L.M. PanglaoDB: a web server for exploration of mouse and human single-cell RNA sequencing data. Database. 2019:2019. doi: 10.1093/database/baz046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Network B.I.C.C. A multimodal cell census and atlas of the mammalian primary motor cortex. Nature. 2021;598(7879):86–102. doi: 10.1038/s41586-021-03950-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Yao Z., Liu H., Xie F., Fischer S., Adkins R.S., Aldridge A.I., et al. A transcriptomic and epigenomic cell atlas of the mouse primary motor cortex. Nature. 2021;598(7879):103–110. doi: 10.1038/s41586-021-03500-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Bakken T.E., Jorstad N.L., Hu Q., Lake B.B., Tian W., Kalmbach B.E., et al. Comparative cellular analysis of motor cortex in human, marmoset and mouse. Nature. 2021;598(7879):111–119. doi: 10.1038/s41586-021-03465-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lui J.H., Nguyen N.D., Grutzner S.M., Darmanis S., Peixoto D., Wagner M.J., et al. Differential encoding in prefrontal cortex projection neuron classes across cognitive tasks. Cell. 2021;184(2):489–506 e26. doi: 10.1016/j.cell.2020.11.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Baker A., Kalmbach B., Morishima M., Kim J., Juavinett A., Li N., et al. Specialized subpopulations of deep-layer pyramidal neurons in the neocortex: bridging cellular properties to functional consequences. J Neurosci. 2018;38(24):5441–5455. doi: 10.1523/JNEUROSCI.0150-18.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mao X., Staiger J.F. Multimodal cortical neuronal cell type classification. Pflügers Archiv. 2024;476(5):721–733. doi: 10.1007/s00424-024-02923-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Willins D.L., Deutch A.Y., Roth B.L. Serotonin 5-HT2A receptors are expressed on pyramidal cells and interneurons in the rat cortex. Synapse. 1997;27(1):79–82. doi: 10.1002/(SICI)1098-2396(199709)27:1<79::AID-SYN8>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
  • 56.Jakab R.L., Goldman-Rakic P.S. 5-Hydroxytryptamine2A serotonin receptors in the primate cerebral cortex: possible site of action of hallucinogenic and antipsychotic drugs in pyramidal cell apical dendrites. Proc Natl Acad Sci USA. 1998;95(2):735–740. doi: 10.1073/pnas.95.2.735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Gillespie M., Jassal B., Stephan R., Milacic M., Rothfels K., Senff-Ribeiro A., et al. The reactome pathway knowledgebase 2022. Nucleic Acids Res. 2022;50(D1):D687–D692. doi: 10.1093/nar/gkab1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Takahashi T., Fournier A., Nakamura F., Wang L.H., Murakami Y., Kalb R.G., et al. Plexin-neuropilin-1 complexes form functional semaphorin-3A receptors. Cell. 1999;99(1):59–69. doi: 10.1016/s0092-8674(00)80062-8. [DOI] [PubMed] [Google Scholar]
  • 59.Umemori H., Linhoff M.W., Ornitz D.M., Sanes J.R. FGF22 and its close relatives are presynaptic organizing molecules in the mammalian brain. Cell. 2004;118(2):257–270. doi: 10.1016/j.cell.2004.06.025. [DOI] [PubMed] [Google Scholar]
  • 60.Futai K., Doty C.D., Baek B., Ryu J., Sheng M. Specific trans-synaptic interaction with inhibitory interneuronal neurexin underlies differential ability of neuroligins to induce functional inhibitory synapses. J Neurosci. 2013;33(8):3612–3623. doi: 10.1523/JNEUROSCI.1811-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Woo J., Kwon S.K., Choi S., Kim S., Lee J.R., Dunah A.W., et al. Trans-synaptic adhesion between NGL-3 and LAR regulates the formation of excitatory synapses. Nat Neurosci. 2009;12(4):428–437. doi: 10.1038/nn.2279. [DOI] [PubMed] [Google Scholar]
  • 62.Huang Y.Z., Won S., Ali D.W., Wang Q., Tanowitz M., Du Q.S., et al. Regulation of neuregulin signaling by PSD-95 interacting with ErbB4 at CNS synapses. Neuron. 2000;26(2):443–455. doi: 10.1016/s0896-6273(00)81176-9. [DOI] [PubMed] [Google Scholar]
  • 63.Tang C., Wang M., Wang P., Wang L., Wu Q., Guo W. Neural stem cells behave as a functional niche for the maturation of newborn neurons through the secretion of PTN. Neuron. 2019;101(1):32–44 e6. doi: 10.1016/j.neuron.2018.10.051. [DOI] [PubMed] [Google Scholar]
  • 64.Yue Y., Chen Z.Y., Gale N.W., Blair-Flynn J., Hu T.J., Yue X., et al. Mistargeting hippocampal axons by expression of a truncated Eph receptor. Proc Natl Acad Sci USA. 2002;99(16):10777–10782. doi: 10.1073/pnas.162354599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Biederer T., Sara Y., Mozhayeva M., Atasoy D., Liu X., Kavalali E.T., et al. SynCAM, a synaptic adhesion molecule that drives synapse assembly. Science. 2002;297(5586):1525–1531. doi: 10.1126/science.1072356. [DOI] [PubMed] [Google Scholar]
  • 66.Miyatani S., Shimamura K., Hatta M., Nagafuchi A., Nose A., Matsunaga M., et al. Neural cadherin: role in selective cell-cell adhesion. Science. 1989;245(4918):631–635. doi: 10.1126/science.2762814. [DOI] [PubMed] [Google Scholar]
  • 67.Tyls F., Palenicek T., Horacek J. Psilocybin--summary of knowledge and new perspectives. Eur Neuropsychopharmacol. 2014;24(3):342–356. doi: 10.1016/j.euroneuro.2013.12.006. [DOI] [PubMed] [Google Scholar]
  • 68.Marek G.J., Aghajanian G.K. Excitation of interneurons in piriform cortex by 5-hydroxytryptamine: blockade by MDL 100,907, a highly selective 5-HT2A receptor antagonist. Eur J Pharmacol. 1994;259(2):137–141. doi: 10.1016/0014-2999(94)90502-9. [DOI] [PubMed] [Google Scholar]
  • 69.Schreiber R., Brocco M., Millan M.J. Blockade of the discriminative stimulus effects of DOI by MDL 100,907 and the 'atypical' antipsychotics, clozapine and risperidone. Eur J Pharmacol. 1994;264(1):99–102. doi: 10.1016/0014-2999(94)90643-2. [DOI] [PubMed] [Google Scholar]
  • 70.Turrigiano G. Homeostatic synaptic plasticity: local and global mechanisms for stabilizing neuronal function. Cold Spring Harbor Perspect Biol. 2012;4(1) doi: 10.1101/cshperspect.a005736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Griffiths R.R., Johnson M.W., Carducci M.A., Umbricht A., Richards W.A., Richards B.D., et al. Psilocybin produces substantial and sustained decreases in depression and anxiety in patients with life-threatening cancer: a randomized double-blind trial. J Psychopharmacol. 2016;30(12):1181–1197. doi: 10.1177/0269881116675513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Davis A.K., Barrett F.S., May D.G., Cosimano M.P., Sepeda N.D., Johnson M.W., et al. Effects of psilocybin-assisted therapy on major depressive disorder: a randomized clinical trial. JAMA Psychiatry. 2021;78(5):481–489. doi: 10.1001/jamapsychiatry.2020.3285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Xu H., Liu L., Tian Y., Wang J., Li J., Zheng J., et al. A disinhibitory microcircuit mediates conditioned social fear in the prefrontal cortex. Neuron. 2019;102(3):668–682 e5. doi: 10.1016/j.neuron.2019.02.026. [DOI] [PubMed] [Google Scholar]
  • 74.Wood J., Kim Y., Moghaddam B. Disruption of prefrontal cortex large scale neuronal activity by different classes of psychotomimetic drugs. J Neurosci. 2012;32(9):3022–3031. doi: 10.1523/JNEUROSCI.6377-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Nichols C.D., Sanders-Bush E. A single dose of lysergic acid diethylamide influences gene expression patterns within the mammalian brain. Neuropsychopharmacology. 2002;26(5):634–642. doi: 10.1016/S0893-133X(01)00405-5. [DOI] [PubMed] [Google Scholar]
  • 76.Kuniishi H., Ichisaka S., Matsuda S., Futora E., Harada R., Hata Y. Chronic inactivation of the orbitofrontal cortex increases anxiety-like behavior and impulsive aggression, but decreases depression-like behavior in rats. Front Behav Neurosci. 2016;10:250. doi: 10.3389/fnbeh.2016.00250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Chu Z., Han W., Liu P., Liu F., Lei G., Deng L., et al. Electrolytic lesions of the bilateral ventrolateral orbital cortex not only directly reduce depression-like behavior but also decreased desperate behavior induced by chronic unpredicted mild stress in rats. BMC Neurosci. 2021;22(1):69. doi: 10.1186/s12868-021-00677-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Wang Z., Guo Q., Wang R., Xu G., Li P., Sun Y., et al. The D Domain of LRRC4 anchors ERK1/2 in the cytoplasm and competitively inhibits MEK/ERK activation in glioma cells. J Hematol Oncol. 2016;9(1):130. doi: 10.1186/s13045-016-0355-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Feng J., Zhang Y., Ren X., Li D., Fu H., Liu C., et al. Leucine-rich repeat containing 4 act as an autophagy inhibitor that restores sensitivity of glioblastoma to temozolomide. Oncogene. 2020;39(23):4551–4566. doi: 10.1038/s41388-020-1312-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Marinova Z., Walitza S., Grunblatt E. 5-HT2A serotonin receptor agonist DOI alleviates cytotoxicity in neuroblastoma cells: role of the ERK pathway. Prog Neuropsychopharmacol Biol Psychiatry. 2013;44:64–72. doi: 10.1016/j.pnpbp.2013.01.017. [DOI] [PubMed] [Google Scholar]
  • 81.Johnson-Farley N.N., Kertesy S.B., Dubyak G.R., Cowen D.S. Enhanced activation of Akt and extracellular-regulated kinase pathways by simultaneous occupancy of Gq-coupled 5-HT2A receptors and Gs-coupled 5-HT7A receptors in PC12 cells. J Neurochem. 2005;92(1):72–82. doi: 10.1111/j.1471-4159.2004.02832.x. [DOI] [PubMed] [Google Scholar]
  • 82.Yuen E.Y., Jiang Q., Chen P., Feng J., Yan Z. Activation of 5-HT2A/C receptors counteracts 5-HT1A regulation of n-methyl-D-aspartate receptor channels in pyramidal neurons of prefrontal cortex. J Biol Chem. 2008;283(25):17194–17204. doi: 10.1074/jbc.M801713200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Zhong P., Yuen E.Y., Yan Z. Modulation of neuronal excitability by serotonin-NMDA interactions in prefrontal cortex. Mol Cell Neurosci. 2008;38(2):290–299. doi: 10.1016/j.mcn.2008.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Xing L., Kalebic N., Namba T., Vaid S., Wimberger P., Huttner W.B. Serotonin receptor 2A activation promotes evolutionarily relevant basal progenitor proliferation in the developing neocortex. Neuron. 2020;108(6):1113–11129 e6. doi: 10.1016/j.neuron.2020.09.034. [DOI] [PubMed] [Google Scholar]
  • 85.Florian J.A., Watts S.W. Integration of mitogen-activated protein kinase kinase activation in vascular 5-hydroxytryptamine2A receptor signal transduction. J Pharmacol Exp Therapeut. 1998;284(1):346–355. [PubMed] [Google Scholar]
  • 86.Wei H., Ahn S., Shenoy S.K., Karnik S.S., Hunyady L., Luttrell L.M., et al. Independent beta-arrestin 2 and G protein-mediated pathways for angiotensin II activation of extracellular signal-regulated kinases 1 and 2. Proc Natl Acad Sci U S A. 2003;100(19):10782–10787. doi: 10.1073/pnas.1834556100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Shenoy S.K., Drake M.T., Nelson C.D., Houtz D.A., Xiao K., Madabushi S., et al. beta-arrestin-dependent, G protein-independent ERK1/2 activation by the beta2 adrenergic receptor. J Biol Chem. 2006;281(2):1261–1273. doi: 10.1074/jbc.M506576200. [DOI] [PubMed] [Google Scholar]
  • 88.Dahl E.F., Wu S.C., Healy C.L., Perry J., O'Connell T.D. ERK mediated survival signaling is dependent on the Gq-G-protein coupled receptor type and subcellular localization in adult cardiac myocytes. J Mol Cell Cardiol. 2019;127:67–73. doi: 10.1016/j.yjmcc.2018.11.020. [DOI] [PubMed] [Google Scholar]
  • 89.Milanini J., Vinals F., Pouyssegur J., Pages G. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J Biol Chem. 1998;273(29):18165–18172. doi: 10.1074/jbc.273.29.18165. [DOI] [PubMed] [Google Scholar]
  • 90.Tang H., Liu X., Wang Z., She X., Zeng X., Deng M., et al. Interaction of hsa-miR-381 and glioma suppressor LRRC4 is involved in glioma growth. Brain Res. 2011;1390:21–32. doi: 10.1016/j.brainres.2011.03.034. [DOI] [PubMed] [Google Scholar]
  • 91.Li P., Xu G., Li G., Wu M. Function and mechanism of tumor suppressor gene LRRC4/NGL-2. Mol Cancer. 2014;13:266. doi: 10.1186/1476-4598-13-266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Choi Y., Park H., Jung H., Kweon H., Kim S., Lee S.Y., et al. NGL-1/LRRC4C deletion moderately suppresses hippocampal excitatory synapse development and function in an input-independent manner. Front Mol Neurosci. 2019;12:119. doi: 10.3389/fnmol.2019.00119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.DeNardo L.A., de Wit J., Otto-Hitt S., Ghosh A. NGL-2 regulates input-specific synapse development in CA1 pyramidal neurons. Neuron. 2012;76(4):762–775. doi: 10.1016/j.neuron.2012.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Kim S., Burette A., Chung H.S., Kwon S.K., Woo J., Lee H.W., et al. NGL family PSD-95-interacting adhesion molecules regulate excitatory synapse formation. Nat Neurosci. 2006;9(10):1294–1301. doi: 10.1038/nn1763. [DOI] [PubMed] [Google Scholar]
  • 95.Song Y.S., Lee H.J., Prosselkov P., Itohara S., Kim E. Trans-induced cis interaction in the tripartite NGL-1, netrin-G1 and LAR adhesion complex promotes development of excitatory synapses. J Cell Sci. 2013;126(Pt 21):4926–4938. doi: 10.1242/jcs.129718. [DOI] [PubMed] [Google Scholar]
  • 96.Lin J.C., Ho W.H., Gurney A., Rosenthal A. The netrin-G1 ligand NGL-1 promotes the outgrowth of thalamocortical axons. Nat Neurosci. 2003;6(12):1270–1276. doi: 10.1038/nn1148. [DOI] [PubMed] [Google Scholar]
  • 97.Shao L.X., Liao C., Davoudian P.A., Savalia N.K., Jiang Q., Wojtasiewicz C., et al. Psilocybin's lasting action requires pyramidal cell types and 5-HT(2A) receptors. Nature. 2025;642(8067):411–420. doi: 10.1038/s41586-025-08813-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Wallis J.D. Orbitofrontal cortex and its contribution to decision-making. Annu Rev Neurosci. 2007;30:31–56. doi: 10.1146/annurev.neuro.30.051606.094334. [DOI] [PubMed] [Google Scholar]
  • 99.Schmaal L., Hibar D.P., Samann P.G., Hall G.B., Baune B.T., Jahanshad N., et al. Cortical abnormalities in adults and adolescents with major depression based on brain scans from 20 cohorts worldwide in the ENIGMA Major Depressive Disorder Working Group. Mol Psychiatr. 2017;22(6):900–909. doi: 10.1038/mp.2016.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.McCabe C., Mishor Z. Antidepressant medications reduce subcortical-cortical resting-state functional connectivity in healthy volunteers. Neuroimage. 2011;57(4):1317–1323. doi: 10.1016/j.neuroimage.2011.05.051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Raichle M.E. The brain's default mode network. Annu Rev Neurosci. 2015;38:433–447. doi: 10.1146/annurev-neuro-071013-014030. [DOI] [PubMed] [Google Scholar]
  • 102.Lu H., Zou Q., Gu H., Raichle M.E., Stein E.A., Yang Y. Rat brains also have a default mode network. Proc Natl Acad Sci USA. 2012;109(10):3979–3984. doi: 10.1073/pnas.1200506109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Madsen M.K., Stenbaek D.S., Arvidsson A., Armand S., Marstrand-Joergensen M.R., Johansen S.S., et al. Psilocybin-induced changes in brain network integrity and segregation correlate with plasma psilocin level and psychedelic experience. Eur Neuropsychopharmacol. 2021;50:121–132. doi: 10.1016/j.euroneuro.2021.06.001. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (7.8MB, docx)

Data Availability Statement

The raw and processed snRNA-seq data reported in this paper are available online (GEO: GSE246451). Any additional information that supports the findings of this study are available from the corresponding author upon request.

For detailed methods, see Supplementary Material and Methods.


Articles from Neurotherapeutics are provided here courtesy of Elsevier

RESOURCES