Abstract
Background
Pyrazinamide is a drug that helps shorten the duration of tuberculosis treatment. Mutations in the pncA are the most common mechanism of pyrazinamide resistance in M. tuberculosis. This study aimed to investigate the association between overexpression of Efflux pump genes Rv0191 and Rv3008 and pyrazinamide resistance in multidrug-resistant M. tuberculosis in a multicenter setting.
Methods
In this study, 40 clinical isolates of pulmonary M. tuberculosis were gathered from septum specimens; confirmation of M.tuberculosis isolates was achieved by PCR and phenotypic methods using the IS6110 gene. The phenotypic microdilution broth method was evaluated for drug susceptibility testing. Frequency of pncA gene mutations associated with pyrazinamide resistance by the PCR method in M. tuberculosis isolates. The evaluation of the Rv0191 and Rv3008 efflux pump genes was performed on pyrazinamide-sensitive, pyrazinamide-resistant, and multidrug-resistant M. tuberculosis isolates.
Results
This study showed that, in MDR, resistance to pyrazinamide was associated with single-resistant strains and a high percentage of mutations in the pncA gene. The most effective method for detecting pyrazinamide resistance is sequencing the entire pncA gene to confirm resistance, rather than the conventional techniques that focus on mutated hotspots.
Conclusions
The study found that PZA resistance was common among MDR-TB isolates, with mutations occurring in the pcnA gene. The findings also showed that drug resistance in clinical isolates of M. tuberculosis is often associated with increased expression of efflux pump genes and mutations in target genes. In cases where there are no mutations, resistance may be related to overexpression of other efflux pumps.
Keywords: Pyrazinamide, Mycobacterium tuberculosis, Real-time PCR, Multidrug resistance, Efflux pumps
Background
Globally, tuberculosis remains the leading cause of death. In 2023, according to the World Health Organization, approximately ten million people were infected with tuberculosis, and 1.6 million died as a result [1]. In Iran, there were 10.88 tuberculosis cases (pulmonary and extrapulmonary) per 100,000 [2]. Khuzestan province in southwestern Iran recorded an incidence rate of 16 cases per 100,000 people [3]. In contrast, Khorasan Province in northeastern Iran has a much lower rate than in Khuzestan Province [4]. The global incidence of tuberculosis declined rapidly following the introduction of drugs such as isoniazid, rifampin, pyrazinamide, and ethambutol [1]. The drug resistance of M. tuberculosis (TB) is influenced by several factors, including the low permeability of its cell walls due to their lipid-rich nature and low porin content, drug inactivation, alteration of drug targets, and the presence of drug efflux pumps [5]. These factors contribute to intrinsic and acquired drug resistance. Additionally, they play an active role in the transfer of anti-tuberculosis drugs from thecell’s cytoplasm to the external environment [5]. ABC, MFS, SMR, MATE, and RND families and superfamilies account for many efflux systems in M. tuberculosis [6]. Several drugs are transported by the ABC family, which includes the DrrAB, Rv2686c-Rv2687c-Rv2688c, and Rv1456c-Rv1457c-Rv1458c pumps [7]. A wide range of substrates is associated with the RND-mediated efflux in M. tuberculosis [8]. Tetracycline, rifampin, and clofazimine are transported by the best-known efflux pump of the MFS family, Rv1258c [8]. M. tuberculosis also contains the efflux pump Rv3065 (MMR), a member of the SMR family that reduces sensitivity to dyes and antibiotics such as isoniazid, erythromycin, and fluoroquinolones [6]. PZA is a drug that can reduce the duration of treatment for tuberculosis from 12 months to 6 months. PZA is converted to pyrazinoic acid (POA) in the cytoplasm [9]. POA disrupts the formation of the RpsA-tmRNA complex by binding to RpsA [10]. In M. tuberculosis, resistance to PZA is mediated by mutations in genes encoding key enzymes or transcription factors, overexpression of efflux pumps, and the high expression of a two-component system that regulates adaptability to intracellular and extracellular environments [11]. Although pncA mutations are the most common mechanism of PZA resistance, systematic reviews show that ~ 18% of PZA-resistant Mycobacterium tuberculosis isolates lack pncA mutations, indicating alternative resistance mechanisms [12]. A significant association has been observed between the expression levels of the Rv3008 and Rv0191 efflux pumps, both of which are implicated in PZA resistance. Studies on M.tuberculosis isolates have identified four efflux pumps, Rv0191, Rv3008, Rv3756c, and Rv1667c, as potential candidates for binding to POA, the active form of PZA. Increased transcription of Rv0191 and Rv3008 has been linked to weak but statistically significant resistance to PZA. Moreover, overexpression of these genes in M. tuberculosis has led to increased resistance to PZA, suggesting that Rv0191 and Rv3008 may contribute to reduced drug efficacy [13]. The primary objective of this study is to investigate the relationship between the overexpression of efflux pump genes Rv0191 and Rv3008 and PZA resistance in multidrug-resistant M. tuberculosis. This will be achieved by comparing gene expression levels among multidrug-resistant (MDR), monodrug-resistant, and drug-sensitive M. tuberculosis isolates, correlating the expression of Rv0191 and Rv3008 in all isolates, and investigating the prevalence of mutations in the pncA gene.
Methods
Study population
In this study, 40 clinical isolates of pulmonary M. tuberculosis were collected from sputum specimens between December 2021 and December 2023. These isolates were obtained from patients referred to two regional tuberculosis reference laboratories in Iran, specifically from Khuzestan Province, which contributed 25 M. tuberculosis isolates (62.5%), and 15M. tuberculosis isolates (37.5%) from Khorasan Province.
Culture and Ziehl-Neelsen stain
All 40 clinical isolates of M. tuberculosis were phenotypically identified. Bacterial colonies were observed after the second week. Direct microscopic examination using the Ziehl-Neelsen staining was performed for bacteriological analysis [14]. M. tuberculosis strain H37Rv (ATCC 25618) served as the control strain.
Drug susceptibility testing by the microdilution broth method
Conventional drug susceptibility testing (DST) was performed using the indirect proportion method in Löwenstein-Jensen (LJ) medium with final drug concentrations of 40 µg/mL for rifampin and 0.2 µg/mL for isoniazid. The bacterial suspension was standardized to a 1 McFarland turbidity using sterile distilled water. Subsequently, 0.2 ml of the suspension was inoculated into LJ culture tubes containing antibiotics, into control tubes with antibiotics, and into control tubes without antibiotics. The tubes were incubatedat 37 °C, and bacterial growth was systematically monitored. Readings were taken on day 28 for the resistant group and on day 42 for the susceptible group. Multidrug-resistant tuberculosis (MDR-TB) is defined as M. tuberculosis resistant to at least isoniazid and rifampicin [15].
The preparation of the pyrazinamide medicinal solution with 7H10 Agar culture medium by the proportion method in M. tuberculosis isolates
10.5 g of 7H10 media was added to 450 mL, 0.5 g of hydrolyzed casein, and 2.5 cc of glycerol. After cooling the prepared solution to 54 °C, the OADC (oleic acid, albumin, dextrose, catalase) solution was added and immediately spread into McCartney containers. 100 mg of antibiotic powder was dissolved in 10 ml of distilled water to prepare an antibiotic culture medium from the PZA solution. The antibiotic solution was sterilized using a 0.22 μm membrane filter before use. Then, from this original solution, which had a PZA concentration of 10,000 µg/ml. Finally, the drug concentration in the culture medium for the antibiogram was 100 µg/ml [15]. The cultures were checked for bacterial growth after 28 days. If the bacteria grew, the strain was considered resistant; if there was no growth, the incubation continued for an additional 42 days. After 42 days, if the bacteria grew, the strain was considered resistant; if there was no growth, it was considered sensitive. The number of colonies should be counted on the control and antibiotic media. The colonies in the control medium represented live bacteria, while those in the antibiotic medium represented bacteria resistant to the antibiotic. If the colonies were less than 1% the control group, the strain was reported as sensitive, and if the ratio was greater than or equal to 1%, the strain was reported as resistant [16].
DNA extraction
The boiling method was used to extract genomic DNA from the collected samples. A loop of bacteria was dissolved in 500 µl of distilled water and boiled for 10 min at 100 °C. The bacteria were then kept in the freezer at 20 °C for 20 min to shock them and lyse their walls. Then, it was centrifuged for 10 min at 14,000 rpm. The supernatant containing DNA was collected, and its concentration was measured using a spectrophotometer (Eppendorf, Germany) at 260 nm [17].
Amplification of the IS6110 gene by the PCR method to confirm M.tuberculosis isolates
This method usesPCR and IS6110, as previously described [17]. Complementary sequence-specific primers and species belonging to M. tuberculosis are confirmed. In this method, the Master Mix mixture (Amplicon, UK) to reach a volume of 25 µl, including buffer (1x), deoxynucleotide triphosphate (200 µM), primer (0.4 µM), Taq polymerase enzyme (0.5 U), MgCl2 (2.5 mM), and template DNA (2 µl) is used. Additionally, the M. tuberculosis ATCC 25,177 strain, prepared at the Pasteur Institute of Iran, served as a positive control, and Escherichia coli ATCC 25,922 was used as a negative control. Each experiment was repeated three times for reliability.
Frequency of pncA gene mutations associated with pyrazinamide resistance by the PCR method in M. tuberculosis isolates
Mutations in the pncA gene are examined to determine pyrazinamide resistance in M. tuberculosis isolates, as previously described [16]. This involves using specific primers and base-pair fragments, along with a temperature program for amplification, after electrophoresis and amplification fragmentsobtaianed fragment at the desired gene’s wavelength. These mutations were analyzed using the nBLAST software to identify overlaps with sequences in the GenBank. Any sequences with mutations compared to the reference sequence M. tuberculosis H37Rv (ATCC 25618). Each experiment was repeated three times for reliability. Table 1 shows the primer used for the pncA gene.
Table 1.
Primer used for PCR of the pncA gene
| Target | ˈ primer | Sequence | Product length |
|---|---|---|---|
| pncA | forward | F: 5’GGCGTCATGGACCCTATA-3’ | 561 bp |
| reverse | R: 5’GTGAACAACCCGACCCAG − 3’ |
RNA extraction
To assess the functionality of the Rv0191 and Rv3008 efflux pumps in M. tuberculosis isolates, RNA was extracted from eight samples: four isolates without mutations, two with mutations, two sensitive isolates, and the M. tuberculosis H37Rv strain (ATCC 25618) serving as a positive control. The extraction was performed according to the SINACLON-Iran protocol. The quality of the RNA was evaluated by measuring absorbance ratios at 260/280 nm and 230/260 nm using a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA. Samples with a 230/280 ratio between 1.8 and 2.2 were selected for cDNA synthesis and stored at -80 °C for future analysis. To eliminate potential DNA contamination, DNase treatment was performed using a SINACLON DNase kit from Iran, according to the manufacturer’s guidelines.
cDNA synthesis
Total RNA was extracted from the colony of resistant isolates, the reference strain, and several sensitive isolatesgrown in LJ medium containing sub-MIC concentrations of the drug using the GeneJET RNA Purification kit (Thermo, Dreieich, Germany) according to the manufacturer’s instructions, with DNase I treatment. After quantifying the purified RNA using a Nanodrop spectrophotometer and verifying its quality via housekeeping gene amplification (absence of visible amplification product in 1.5% agarose gel electrophoresis stained with Safe stain), it was maintained at 80 °C until use. cDNA was synthesized using the RevertAid First Strand cDNA Synthesis kit (SINACLON, Iran) according to the manufacturer’s instructions. In the next step, it was placed in the thermocycler at 37 °C for 15 min, followed by 85 °C for 5 s, and finally at 4 °C, maintained at 80 °C until use.
Real-time PCR reaction
The real-time PCR method was used to measure the expression of the previously reported target genes [18, 19]. Specific primers were designed for each gene, and polA was used as the housekeeping gene for normalization. Reactions were performed using the SYBR Green high ROX Master Mix kit (Ampliqon, UK) on a Step One machine (Applied Biosystems, USA). Each reaction in a 12 µL microtube contained 6.25 µL SYBR1 Green high ROX Master Mix, 0.25 mL of each primer, 3 µL cDNA, and 2.25 µL of PCR-grade water (Metabion, Steinkirchen, Germany). Conditions included one cycle of 95 °C for 5 min, followed by 50 cycles of 95 °C for 20 s, 58 °C for 20 s, and 72 °C for 30 s. Additionally, the M. tuberculosis ATCC 25,177 strain, preparedat the Pasteur Institute of Iran, served as a positive control, and Escherichia coli ATCC 25,922 was used as a negative control. Each experiment was repeated three times for reliability. Table 2 shows the primers used in real-time PCR to amplify and sequence genes associated with drug resistance.
Table 2.
Primers used in real time PCR to amplify and sequence genes associated with drug resistance
| Target | primer | Sequence |
|---|---|---|
| Rv0191 | Forwardreverse | F: GCTCTAGACAGATCAGCGCCGTCACR: CCCAAGCTTTTAGCCGTCGCCGGG |
| Rv3008 |
Forward reverse |
F: GCTCTAGAGCCTGGGTTGTCACCAC R: CCCAAGCTTTTAGTTGCCGTCCGCGG |
| polA |
Forward reverse |
TCCGATGACGTAGCCGCAAACTAG GTCGTGGTTGGACCTTGGAGGG |
Statistical analysis
Gene expression levels were calculated using the ΔΔCt method. A standard curve was generated for each using five serial dilutions of cDNA(100,10,1,0.1,0.01) to ensure similar amplification efficiency between target and reference genes. Fold changes (FC) values were classified as :
FC ≤ 1: no overexpression.
FC 1–3.99: moderate expression.
FC ≥ 4: overexpression.
SPSS version 22 (SPSS Inc., Chicago, IL, USA) was used, anddifferences were considered statistically significant when P < 0.05. The relative gene expression levels (Fold Change) of Rv0191 and Rv3008 between three groups of M. tuberculosis isolates (MDR, mono-resistant, and sensitive) were compared using the Kruskal–Wallis test, as the data were not normally distributed. Correlations between the expression levels of Rv0191 and Rv3008 were evaluated using both the Pearson correlation coefficient (for parametric data) and Spearman’s rank correlation (for non-parametric data). A P-value < 0.05 was considered statistically significant.
Results
Collection of clinical isolates of MDR M. tuberculosis
A total of 40 M. tuberculosis isolates were analyzed. Twenty-five (62.5%) of the M. tuberculosis isolates were associated with the Ahvaz Tuberculosis Reference Laboratory, while 15 (37.5were linked to the Mashhad Tuberculosis Reference Laboratory. To ensure accurate identification, all 40 M. tuberculosis isolates underwent IS6110 gene sequencing. IS6110 gene sequences indicated that all isolates exhibited > 99% homology with their corresponding species. Table 3 shows the demographic Profiles of Patients.
Table 3.
Displays the demographic profiles of patients
| N* | ||
|---|---|---|
| Age groups in years | 18–25 | 4 |
| 25–35 | 5 | |
| 35–45 | 15 | |
| 45–55 | 5 | |
| 55–65 | 11 | |
| Sex | Female | 23 |
| Male | 17 | |
| Infection cases | ||
| Smoking | 19 | |
| Diabetes Miletus | 13 | |
| HIV* | 3 | |
| Autoimmune disease | 25 | |
| COVID 19 | 15 | |
| Hospitalization | ||
| Yes | 40 | |
| No | - |
Abbreviations: N, number of cases; %, percentage; HIV, Human Immunodeficiency Virus
INH/RIF MICs in M. tuberculosis clinical isolates
The MIC results for test INH/RIF were determined to identify resistant isolates. Among 40 isolates, some samples were resistant to the antibiotics isoniazid and rifampin. Among 40 M. tuberculosis isolates, 7 (17.5%)M. tuberculosis isolates were resistant to both drugs (classified as MDR). Ten isolates (25%) were resistant to only one drug (rifampin). Table 4 shows the results of isoniazid and rifampicin resistance.
Table 4.
Results of MIC Isoniazid and rifampicin resistance and the mutations in the PZN
| ID | PZA MIC | INH MIC | RIF MIC | MDR | Mono-resistance | pcnA mutation | City |
|---|---|---|---|---|---|---|---|
| 1 | 200 | 0.05 | 256 | - | + | mutation | Ahvaz |
| 2 | 150 | 0.05 | 256 | - | + | mutation | Ahvaz |
| 3 | 180 | 0.05 | 64 | - | + | mutation | Ahvaz |
| 4 | 220 | 0.05 | 64 | - | + | mutation | Ahvaz |
| 5 | 160 | 0.05 | 64 | - | + | mutation | Ahvaz |
| 6 | 190 | 0.05 | 64 | - | + | mutation | Ahvaz |
| 7 | 50 | 0.05 | 64 | - | + | Non-mutation | Ahvaz |
| 8 | 200 | 0.05 | 64 | - | + | mutation | Mashhad |
| 9 | 180 | 0.05 | 64 | - | + | mutation | Mashhad |
| 10 | 210 | 0.05 | 64 | - | + | mutation | Mashhad |
| 11 | 250 | 16 | 256 | + | + | mutation | Ahvaz |
| 12 | 230 | 16 | 256 | + | + | mutation | Ahvaz |
| 13 | 260 | 16 | 64 | + | + | mutation | Ahvaz |
| 14 | 240 | 16 | 64 | + | + | mutation | Ahvaz |
| 15 | 90 | 2 | 64 | + | + | Non-mutation | Ahvaz |
| 16 | 80 | 4 | 64 | + | + | Non-mutation | Mashhad |
| 17 | 100 | 0.5 | 2 | + | + | Non-mutation | Mashhad |
PZA MICs in MDR of M. tuberculosis clinical isolates
The antibiotic sensitivity to PZA was determined using the proportion method on Middlebrook plates with an acidic pH for both resistant and sensitive strains.MDR-TB and single-drug-resistant isolates, confirmed by molecular and phenotypic methods, were selected to assess PZA sensitivity. Thus, 5 M. tuberculosis isolates sensitive to all three antibiotics were selected randomly. Of the 40 M. tuberculosis isolates tested, 17 (42%) were resistant to PZA. The pncA gene was sequenced to identify mutations and resistance in M. tuberculosis isolates. Among 17 PZA-resistant M. tuberculosis isolates, 13/17 (76.47%) had mutations in PZA. Table 5 presents the characteristics of the mutations in the PZA. Sequencing results for the pncA gene using BLAST showed that 13 (76.47%) M. tuberculosis isolates had mutations, while 4 (23.52%) had none. Table 5 shows the distribution of mutations found in Ahvaz and Mashhad. The common mutation was a non-synonymous mutation in which phenylalanine (Phe) replaced valine (Val).
Table 5.
Mutations show the characteristics of the mutations in the 17-PZN-resistant resistant of M.tuberculosis
| Isolates number | Base position | Codon change | Amino acid Change | Mutation type |
|---|---|---|---|---|
| 1 | G19 > T | GTC/TTC | VAL7 PHE | Nonsynonymous |
| 2 | T20 > G | GTC/GGC | VAL7 GLY | Non synonymous |
| 3 | T20 > G | GTC/GGC | VAL7GLY | Non synonymous |
| 4 | T20 > G | GTC/GGC | VAL7 GLY | Non synonymous |
| 5 | A424 > G | ACG/GCG | THR 142 ALA | Non synonymous |
| 6 | A424 > G | ACG/GCG | THR 142 ALA | Non synonymous |
| 26 | A424 > G | ACG/GCG | THR 142 ALA | Nonsynonymous |
| 18 | G338 > T | GTC/TTC | VAL 180 PHE | Nonsynonymous |
| 19 | G338 > T | GTC/TTC | VAL 180 PHE | Nonsynonymous |
| 20 | G338 > T | GTC/TTC | VAL 180 PHE | Nonsynonymous |
| 21 | G338 > T | GTC/TTC | VAL 180 PHE | Nonsynonymous |
| 27 | C151 > T | CAC/TA | HIS 51 TYR | Nonsynonymous |
| 28 | C151 > T | CAC/TAC | HIS 51 TYR | Nonsynonymous |
Standard curve construction for amplification efficiency calculation
The amplification efficiency of the polA gene, used as an internal control, and the target genes. Rv0191 and Rv3008 were evaluated. To validate the fold-change calculation, the amplification efficiencies of the target and control genes must be approximately equal. For this purpose, cDNA was synthesized from the samples, and serial dilutions were prepared. The diluted samples were then loaded into a Real-Time PCR device. After completion of the qPCR steps, a standard curve was constructed by plotting the logarithm of the input concentration (log input) against the corresponding Ct values. The calculated efficiencies were 99% for Rv3008,95% for Rv0191, and 96% for polA. Lower Ct values correspond to higher gene expression, while higher Ct values correspond to lower expression (Figs. 1, 2 and 3).
Fig. 1.
Standard curve of the internal control gene polA
Fig. 2.
Standard curve of the Rv0191 gene
Fig. 3.
Standard curve of Rv3008 gene
Efflux Inhibition decreased PZA resistance in strains overexpressing Rv0191 and Rv3008
To evaluate the expression of Rv0191 and Rv3008 efflux pump genes, Real-time PCR was performed on nine M. tuberculosis isolates, including three MDR isolates, three mono-resistant isolates (resistant to either INH or RIF), and three fully-sensitive isolates. The reference strain H37Rv (ATCC25618) was used for normalization. Standard curves for the polA, Rv3008, and Rv0191 genes were generated, and melt curve analysis confirmed the specificity of amplification. Gene expression values were calculated using the ΔΔCt method and subsequently grouped into three categories:
Fold-change ≤ 1 (no overexpression).
Fold-change 1–3.99, and.
Fold-change ≥ 4 (overexpression).
Based on this criterion, one MDR isolate showed marked overexpression of both genes (Rv0191:6.8-fold, Rv3008:8.8-fold). Overexpression of Rv3008 alone (≥ 4-fold) was also detected in isolates 15 (4-fold) and, to a lesser extent, isolate 14(2.1) and 16 (3.0).MDR isolates 2 and 3, despite harboring pncA mutations, showed only modest upregulation (Rv0191:0.8-fold, Rv3008:2.5). All three drug-sensitive isolates demonstrated very low expression levels of both genes (Rv0191:0.17-0.87-fold, Rv3008:0.72–0.91). Comparison of fold change across MDR, mono-resistant, and sensitive groups was performed using the Kruskal–Wallis test (non-parametric, as data were not normally distributed Comparison of expression levels across MDR, mono-resistant, and sensitive groups revealed no statistically significant differences for Rv0191 (P = 0.295) or Rv3008 (P = 0.065). However, Spearman’s correlation analysis indicated a strong positive correlation between the expression levels of Rv0191 and Rv3008 across all isolates (r = 0.985, P < 0.0001), suggesting coordinated regulation and potential co-expression of these efflux pump genes. Overall, the highest expression levels were detected in MDR isolates, particularly isolates 1, which also exhibit phenotypic resistance to PZA. These findings support a possible role for Rv0191 and Rv3008 overexpression, especially when ≥ 4-fold, in contributing to efflux-mediated PZA resistance (Table 6; Figs. 4 and 5). Table 7 shows the correlation between the expression of the Rv3008 and Rv0191 genes, determined using the Pearson correlation coefficientThe value of 0.948 indicates a perfect correlation between Rv3008 and Rv0191. Also, the number 0.000 indicates that the correlation is statistically significant (p < 0.01). The asterisks next to the correlation coefficient indicate that the correlation is significant at the 0.01 two-sided level. Overall, Table 7 shows that there is a very strong correlation between the Rv3008 and Rv0191 genes (p < 0.01). This means that an increase in the expression of one gene is accompanied by an increase in the expression of the other gene.
Table 6.
The expression changes of efflux pump genes
| Isolates Number |
Resistance type | Resistance to PZA |
Mutation in pncA gene |
Fold Change Rv3008gene |
Fold Change Rv0191gene |
|---|---|---|---|---|---|
| 1 | MDR | R | Non-mutation | 8.8 | 6.8 |
| 14 | Mono resistance (RIF) | R | Non-mutation | 2.1 | 0.7 |
| 15 |
Mono resistance (RIF) |
R | Non-mutation | 4 | 0.9 |
| 16 |
Mono resistance (INZ) |
R | Non-mutation | 3 | 0.9 |
| 2 | MDR | R | Mutation | 2.5 | 0.8 |
| 3 | MDR | R | Mutation | 2.5 | 0.8 |
| Ⅰ | Sensitive | S | - | 0.82 | 0.175 |
| Ⅱ | Sensitive | S | - | 0.91 | 0.548 |
| Ⅲ | Sensitive | S | - | 0.72 | 0.87 |
| P value | - | - | - | P = 0.065 | P = 0.295 |
Fig. 4.
Melting curve of the Rv3008gene
Fig. 5.
Melting curve of the Rv0191gene
Table 7.
Correlation evaluation of Rv3008 and Rv0191 gene expression
| p3008 | p0191 | ||
|---|---|---|---|
| Rv3008 | Pearson Correlation | 1 | 0.948 ** |
| Sig. (2-tailed) | - | 0.000 | |
| N | 9 | 9 | |
| Rv0191 | Pearson Correlation | 0.948 ** | 1 |
| Sig. (2-tailed) | 0.000 | ||
| N | 9 | 9 | |
**. Correlation is significant at the 0.01 level (2-tailed)
Discussion
Tuberculosis is an infectious disease caused by M. tuberculosis complex. Tuberculosis was divided into two groups: the first group consisted of active tuberculosis, specifically the pulmonary form, which could be transmitted from person to person. The second type of tuberculosis was latent TB. It’s an infection that shows no symptoms and cannot be transmitted from person to person. In this type of infection, the immune system eliminates the bacteria, which then remain dormant in the body [20]. PZA can kill both actively replicating and dormant M.tuberculosis within the acidic environment of the macrophage phagosome [21]. Therefore, PZA destroys latent and persistent M. tuberculosis bacteria [22]. This study aimed to investigate pyrazinamide-resistant antibiotics in M. tuberculosis isolates that are either MDR or single-drug-resistant. In addition, it sought to compare the overexpression of the Rv0191 and Rv3008 efflux pump genes between PZA-sensitive and PZA-resistant isolates. Many PZA-resistant M.tuberculosis isolates carry mutations in the pcnA gene [23–25]. However, reports of PZA-resistant M. tuberculosis isolates without pncA mutations have been described [17]. Moadab et al. conducted a study to determine the sensitivity of M. tuberculosis isolates to PZA in Iranian patients. In 100 M. tuberculosis isolates, 21(21%) were found to be MDR, with 11(57%) showing resistance to PZA [2]. We tested 40 M. tuberculosis isolates and found 17 (42%) were resistant to PZA. These results were comparable to those of Fonseca et al., who reported that among 110 M. tuberculosis isolates tested for one of the four main drugs, and 34.5% % exhibited resistance to PZA. In our study, in contrast, 25% of the single resistant were resistant to PZA. These findings suggest that PZA resistance may have become more prevalent over time [26]. Based on Emane et al., M. tuberculosis isolates developed resistance to PZA following the acquisition of resistance to rifampin and possibly fluoroquinolones [27]. According to a study conducted by Nasr-Esfahani et al. in Iran, among 47 culture positive M.tuberclousis, 19.1% were classified as MDR-TB, 26 (55.3%) showed resistance to isoniazid, 12 (25.5%) to rifampin, and 19 (40%) to PZA. Compared with the study by Nasr-Esfahani et al., the study indicates a notable increase in antibiotic resistance among M. tuberculosis isolates, which may be attributed to improper antibiotic use [28]. In the USA, Kurbatova et al. reported that 2–7% of M. tuberculosis isolates exhibit resistance to PZA. Their study also indicated that PZA resistance is more common among MDR M. tuberculosis isolates (38%) [29]. In the present study, the prevalence of PZA resistance among MDR M. tuberculosis isolates was 25%. A study by Liu et al. in China reported 60% M. tuberculosis isolates were resistant to PZA overall, whereas MDR-TB isolates exhibited a higher resistance rate of 42%. These findings are consistent with our results, highlighting a lower prevalence of PZA resistance among MDR-TB isolates [30].
In a recent large-scale study in India, whole-genome sequencing of 2,207 M. tuberculosis isolates showed that pcnA mutations accounted for approximately 94% of phenotypic PZA resistance, with resistance observed in about 31% of MDR-TB isolates [31]. Our study yielded similar results mutationsat codon 7 result in the substitution of valine for phenylalanine and glycine, and a mutation at codon 51 converts histidine to tyrosine. In line with these findings, Pang et al. in China reported that 62.4% of (88/133) MDR-TB isolates were resistant to PZA. We found that 42% of cases were resistant to PZA, whereas in Pang study, 62% of isolates were PZA-resistant. This discrepancy may be attributed to geographical variations between the study population [32]. A major contributing factor to resistance could be the activity of the efflux pumps, which can enhance resistance even in strains harboring mutations [8]. Supporting this, Rodrigues et al. reported that overexpression of efflux pumps, including Rv3008, can significantly reduce intracellular antibiotic concentration, thereby promoting the development of high-level drug resistance. Overactive efflux systems diminish the efficacy of antibiotics, enabling the bacterial population to survive and acquire additional resistance mechanisms [9]. Similarly, our study revealed overexpression of the Rv3008 and Rv0191 efflux pumps in a single drug-resistant isolate without any detected mutation. Efflux pumps, therefore, represent a promising target for novel anti-tuberculosis therapies [9]. Although efflux pump inhibitors were not used in this study, numerous studies have employed efflux pump inhibitors, such as piperine and verapamil, which can reduce efflux activity and restore the susceptibility of M.tuberculosis to antimicrobial agents [19]. Although a statistically significant correlation between the expression of Rv3008 and Rv0191 efflux pump genes was observed, the biological significance of their co-expression remains to be fully elucidated. Both genes have been implicated in the extrusion of antimicrobial agents, suggesting that coordinated upregulation may enhance the bacterium’s resistance to multiple drugs. Mechanically, simultaneous overexpression could indicate a shared regulatory pathway for synergistic effect in promoting resistance to PZA and potentially other antibacterial agents.
Conclusion
The study found that PZA resistance is common among MDR-TB isolates and is often associated with mutations in the pncA gene. Sequencing was the most effective method for confirmingPZA resistance compared to conventional approaches. The results also showed that drug resistance in clinical M. tuberculosis isolates is often associated with increased expression of efflux pump genes and mutations in target genes. In isolates without pncA mutations, resistance may result from overexpression of other efflux pumps.
Limitation
Our study has several limitations, including a small sample size and limited use of whole-genome sequencing due to resource constraints. Due to limited financial resources and high sequencing costs in Iran, the strains evaluated in the mutation test were not sequenced; instead, mutations were identified using the NCBI website. Each experiment was repeated three times, and the results were utterly reliable and accurate. This study involved PCR and qPCR analyses of previously published and well-characterized genes.
Acknowledgements
This work is part of the MSc. thesis of Sadegh Hamid, which was approved by the Infectious and Tropical Diseases Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. We are grateful to the research affairs of the university for financial support of the study (Grant No. OG-0005).
Abbreviations
- PZA
Pyrazinamide
- M. tuberculosis
Mycobacterium tuberculosis
- MDR
Multidrug-resistant
- ABC
ATP-binding cassette
- MFS
Major facilitator superfamily
- SMR
Small multidrug resistance
- MATE
Multi-antimicrobial extrusion
- RND
The resistance-nodulation-cell division
- POA
Pyruvic acid
- LJ
Lowenstein-Jensen
- CLSI
Clinical and Laboratory Standards Institute
- OADC
Oleic Albumin Dextrose Catalase
- SPSS
Statistical package for social sciences
- XDR
Extended detection and response
Author contributions
The concept and the design of the study were developed by Azar Dokht Khosravi. The methodology was designed by Sadegh Hamid. Saman Soleimanpour edited, formatted, and updated the manuscript’s final draft and also interpreted the data. Mohammad Savari carried out data collection and experimental work. The formal analyses and interpretation of data were carried out by Mohammad Hashemzadeh. The original draft was prepared by Mohammad Hashemzadeh and Mohammad Savari.
Funding
OG-0005.
Data availability
All data generated or analysed during this study are included in this published article.
Declarations
Ethics approval and consent to participate
This research was conducted in accordance with the Helsinki Declaration. Following the submission of the preliminary proposal, the study received approval from the Institutional Ethics and Review Board of Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, and the necessary permission for sample collection was granted (IR.AJUMS.MEDICINE.REC.1400.001). Written informed consent was obtained from all participants. After the preliminary proposal was submitted, permission to collect the sample was granted. The Tuberculosis Center Data Protection Authority also approved the study. All respondents were provided with an information letter about the study and asked to give written consent to participate. We made it clear that participation was voluntary and that individuals could withdraw from the study at any time. Furthermore, all procedures involving human participants confirmed that written consent had been obtained for the use of their information. In this study, personal information such as names, surnames, ethnicity, and personal identification numbers, as well as any information participants requested remain unpublished, was excluded.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.World Health Organization (WHO). Global Tuberculosis Report 2023 Available at http://www.who.int/tb/en.
- 2.Moaddab SR, Amini K, Haki. K.Determining the drug susceptibility of Mycobacterium tuberculosis strains to the Pyrazinamide. Med J Tabriz Univ Med Sci. 2015;37:56–62. [Google Scholar]
- 3.Alavi SM, Enayatrad M, Cheraghian B, Amoori N. Incidence trend analysis of tuberculosis in Khuzestan Province, Southwest of Iran: 2010–2019. Glob Epidemiol. 2023;6:100118. 10.1016/j.gloepi.2023.100118. [DOI] [PMC free article] [PubMed]
- 4.Kiani B, Raouf Rahmati A, Bergquist R, Hashtarkhani S, Firouraghi N, Bagheri N, Mohammadi A. Spatio-temporal epidemiology of the tuberculosis incidence rate in Iran 2008 to 2018. BMC Public Health. 2021;21:1–20. 10.1186/s12889-021-11157-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Tursun EG, Bozok T, Aslan G. Antimicrobial resistance mechanisms in non-tuberculous mycobacteria. Folia Microbiol. 2025;28:1–0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Laws M, Jin P, Rahman KM. Efflux pumps in Mycobacterium tuberculosis and their Inhibition to tackle antimicrobial resistance. Trends Microbiol. 2022;30(1):57–68. [DOI] [PubMed] [Google Scholar]
- 7.Remm S, Earp JC, Dick T, Dartois V, Seeger MA. Critical discussion on drug efflux in Mycobacterium tuberculosis. FEMS Microbiol Rev. 2022;46(1):fuab050. [DOI] [PMC free article] [PubMed]
- 8.Machado D, Coelho TS, Perdigão J, Pereira C, Couto I, Portugal I, Maschmann RD, Ramos DF, von Groll A, Rossetti ML, Silva PA. Interplay between mutations and efflux in drug resistant clinical isolates of Mycobacterium tuberculosis. Front Microbiol. 2017;8:711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Rodrigues L, Cravo P, Viveiros M. Efflux pump inhibitors as a promising adjunct therapy against drug resistant tuberculosis: a new strategy to revisit mycobacterial targets and repurpose old drugs. Expert Rev Anti Infect Ther. 2020;18:741–57. 10.1080/14787210.2020.1760845. [DOI] [PubMed] [Google Scholar]
- 10.Pitaloka DAE, Arfan A, Ramadhan DSF, Chaidir L. Insights from the molecular mechanism of pyrazinamide to mutated pyrazinamidase linked to the pncA gene in clinical isolates of Mycobacterium tuberculosis. J Biomol Struct Dyn. 2024;42, 759–765. 2023:1–7. 10.1080/07391102.2023.2195002. [DOI] [PubMed]
- 11.Modlin SJ, Mansjö M, Werngren J, Ejike CM, Hoffner SE, Valafar F. Pyrazinamide-resistant tuberculosis is obscured from common targeted molecular diagnostics. Drug Resist Updat. 2023;68:100959. 10.1016/j.drup.2023.100959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ramirez-Busby SM, Valafar F. Systematic review of mutations in Pyrazinamidase associated with Pyrazinamide resistance in Mycobacterium tuberculosis clinical isolates. Antimicrob Agents Chemother. 2015;59(9):5267–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Chimal-Muñoz M, Pérez-Martínez DE, Bermúdez Hernández GA, Mejía-Ponce PM, Licona-Cassani C, Muñiz-Salazar R, Montero H, Zenteno-Cuevas R. Whole-Genome sequence analysis to assess mutations in efflux pumps in Mycobacterium tuberculosis: the influence in drug resistance. Microorganisms. 2025;13(6):1306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jawetz, Melnick & Adelberg’s Medical Microbiology. 24th ed. Vishal; San Francisco: March 2007. Chapter 24.
- 15.Kang JY, Hur J, Kim S. Clinical implications of discrepant results between genotypic MTBDRplus and phenotypic Löwenstein-Jensen method for Isoniazid or rifampicin drug susceptibility tests in tuberculosis patients. J Thorac Dis. 2019;11(2):400–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hashemzadeh M, Asareh Zadegan Dezfuli A, Moinikhah M, Yousefi FI. Phenotypic and genotypic resistance to Pyrazinamide antibiotic in multidrug-resistant (MDR) Mycobacterium tuberculosis isolates in Khuzestan Province from 2017 to 2022 Jundishapur scientific. Med J. 2024;23:44–60. 10.32592/JSMJ.23.1.44. [Google Scholar]
- 17.Zia Sheybani A, Hoseinzadeh S, Habibnia S. Molecular diagnosis of Drug-Resistant Mycobacterium tuberculosis isolates using IS6110 gene in tuberculosis patients. Iran J Med Microbiol. 2024;18(4):265–9. [Google Scholar]
- 18.Zhang Y, Zhang J, Cui P, Zhang Y, Zhang W. Identification of novel efflux proteins Rv0191, Rv3756c, Rv3008, and Rv1667c involved in Pyrazinamide resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2017;61(8):10–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Khosravi AD, Sirous M, Absalan Z, Tabandeh MR, Savari MC. Of DrrA and DrrB efflux pump genes expression in drug-susceptible and-resistant Mycobacterium tuberculosis strains isolated from tuberculosis patients. in Iran. Infect Drug Resist. 2019; 3437–44. [DOI] [PMC free article] [PubMed]
- 20.Mohammadnabi N, Shamseddin J, Emadi M, Bodaghi AB, Varseh M, Shariati A, Rezaei M, Dastranj M, Farahani A. Mycobacterium tuberculosis: the mechanism of pathogenicity, immune responses, and diagnostic challenges. J Clin Lab Anal. 2024;38(23):e25122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Santucci P, Greenwood DJ, Fearns A, Chen K, Jiang H, Gutierrez MG. Intracellular localisation of Mycobacterium tuberculosis affects efficacy of the antibiotic Pyrazinamide. Nat Commun. 2021;12:3816. 10.1038/s41467-021-24127-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yee M, Gopal P, Dick T. Missense mutations in the unfoldase ClpC1 of the caseinolytic protease complex are associated with Pyrazinamide resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2017;61:10–1128. 10.1128/AAC.02342-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Den Hertog AL, Menting S, Pfelt R, Warns M, Siddiqi SH. Anthony R M Pyrazinamide is active against Mycobacterium tuberculosis cultures at neutral H and low temperature. J Antimicrob Chemother. 2016;60:4956–60. 10.1128/AAC.00654-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Pullan ST, Allnutt JC, Devin R, Hatch KA, Jeeves RE, Hendon-Dunn CL. The effect of growth rate on Pyrazinamide activity in Mycobacterium tuberculosis-insights for early bactericidal activity? BMC Infect Dis. 2016;16:1–11. 10.1186/s12879-016-1533-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gonzalo X, Drobniewski F, Hoffner S, Werngren J. Evaluation of a biphasic media assay for pyrazinamide drug susceptibility testing of Mycobacterium tuberculosis. J Antimicrob Chemother. 2014 69, 3001–3005. 10.1093/jac/dku230. [DOI] [PubMed]
- 26.Fonseca LS, Marsico AG, Vieira G B D O, Duarte RDS, Saad MHF, Mello. F D C Q.Correlation between resistance to Pyrazinamide and resistance to other antituberculosis drugs in Mycobacterium tuberculosis strains isolated at a referral hospital. J Bras Pneumol. 2012;38:630–3. 10.1590/s1806-37132012000500013. [DOI] [PubMed] [Google Scholar]
- 27.Alame-Emane AK, Xu P, Pierre-Audigier C, Cadet-Daniel V, Shen X, Sraouia M, Gicquel B. Pyrazinamide resistance in Mycobacterium tuberculosis arises after rifampicin and fluoroquinolone resistance. Int J Tuberc Lung Dis. 2015;19:679–84. 10.5588/ijtld.14.0768. [DOI] [PubMed] [Google Scholar]
- 28.Nasr‑Esfahani B, Moghim S, Salehi M, Keikha M. Evaluating the frequency of resistance to pyrazinamide among drug‑resistant strains of Mycobacterium tuberculosis in Isfahan, Iran. Arch Clin Infect Dis. 2021;16(2):e101092.
- 29.Kurbatova EV, Cavanaugh JS, Dalton T, Click S, Cegielski E. Epidemiology of pyrazinamide-resistant tuberculosis in the united States, 1999–2009. Clin Infect Dis. 2013;57:1081–93. 10.1093/cid/cit452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Liu B, Su P, Hu P, Yan M, Li W, Yi S, Tan YP. Transmission and genetic diversity of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates in Hunan, China. Infect Drug Resist. 2024;403–16. 10.2147/IDR.S436161. [DOI] [PMC free article] [PubMed]
- 31.Tamilzhalagan S, Justin ES, Selvaraj A, Venkateswaran K, Sivakumar AK, Chittibabu S, McLaughlin HP, Moonan PK, Smith JP, Suba S, Sathya Narayanan MK. Phenotypic and genotypic characterization of Mycobacterium tuberculosis pyrazinamide resistance—India, 2018–2020. Front Microbiol. 2025 15:1515627. [DOI] [PMC free article] [PubMed]
- 32.Pang Y, Zhu D, Zheng H, Shen J, Hu Y, Liu J, Zhao Y. Prevalence and molecular characterization of Pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China. BMC Infect Dis. 2017;17:1–8. 10.5530/jyp.2024.16.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analysed during this study are included in this published article.





