In vitro evaluation of antimicrobial activity of andrographolide against mixed biofilms of Candida albicans and Staphylococcus aureus

Abstract

Background

Andrographolide (AG) demonstrates good inhibitory effects against single-species infections and biofilm formation. This study aimed to investigate the inhibitory effects of AG on mixed cultures of Candida albicans and Staphylococcus aureus in both planktonic and biofilm states.

Methods

Standard strains of C. albicans ATCC11006 and S. aureus ATCC25923 were selected, and minimum inhibitory concentrations were determined using the microbroth dilution method. Time-growth curves of the mixed strains under AG treatment were plotted. Furthermore, an in vitro mixed biofilm model was constructed, and biofilm formation was assessed using crystal violet staining and inverted fluorescent microscope. Finally, biofilm-related gene expression was measured using RT-qPCR.

Results

The MIC values of AG against C. albicans, S. aureus and the mixed strains were 256 µg/ml, 512 µg/mL and > 512 µg/mL, respectively. Time-growth curves of the mixed strains under varying AG concentrations demonstrated a concentration-dependent growth inhibition and delayed logarithmic-phase progression in planktonic cultures. Crystal violet staining revealed 512 µg/mL AG reduced biofilm biomass by 90.23% compared to controls. Microscopic analysis revealed that the control formed compact biofilms, whereas 512 µg/mL AG treatment resulted in thin biofilms, with most C. albicans in spore form and few hyphae, and S. aureus was scattered around them. Additionally, 512 µg/mL AG significantly downregulated EFG1, HWP1, icaA and cidA, while lower concentrations markedly downregulate icaA and cidA.

Conclusions

AG may suppress mixed biofilm development by preventing S. aureus adhesion and blocking C. albicans hyphal formation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12906-026-05292-8.

Introduction

Candida albicans and Staphylococcus aureus are microorganisms that asymptomatically colonize normal individuals and share common ecological niches in the human body, including the skin, oral cavity, urinary tract, and reproductive tract. When immunity in the body declines, these microbes can cause superficial skin or even severe systemic infections [1]. Over 25% of nosocomial C. albicans bloodstream infections are polymicrobial, most often co-infected with other pathogens, with S. aureus ranking third [2]. Dense mixed biofilms on mucosal and medical device surfaces enable these pathogens to cause various infections, including periodontitis, denture stomatitis, burn wound infections, urinary tract infections, and catheter-associated infections [3–6]. Biofilm-associated polymicrobial infections are a major cause of hospital-acquired infections.

Biofilms are microbial communities formed by pathogens through the production of polymeric matrices that encase and adhere to biological or non-biological surfaces [7]. Biofilm-associated infections, particularly mixed fungal–bacterial infections, are significantly increasing infection rates and mortality. C. albicans-S. aureus mixed biofilms exhibit unique structural and functional characteristics that distinguish them from monomicrobial biofilms, contributing to their enhanced pathogenicity and treatment resistance. During mixed biofilm development, C. albicans undergoes a yeast-to-hypha transition, forming filamentous structures that serve as physical scaffolds for S. aureus adhesion [8, 9]. This interkingdom interaction is mediated by specific molecular mechanisms: C. albicans hyphal adhesin Als3p directly binds to S. aureus surface proteins, facilitating bacterial colonization on fungal filaments [8]. In return, S. aureus secretes peptidoglycan (PGN) and other signaling molecules that promote C. albicans hyphal formation and extracellular matrix (ECM) secretion, creating a mutually beneficial microenvironment [10]. The ECM of mixed biofilms is a complex mixture of fungal β-glucans, mannans, bacterial polysaccharide intercellular adhesin (PIA), extracellular DNA (eDNA), and proteins, which forms a dense barrier against antimicrobial penetration and host immune cell infiltration [11, 12]. Notably, the metabolic crosstalk between C. albicans and S. aureus within mixed biofilms further enhances their survival and virulence. C. albicans produces lactate and ethanol as metabolic byproducts, which are utilized by S. aureus to support its growth under nutrient-limited conditions [13]. Conversely, S. aureus-derived ammonia neutralizes the acidic microenvironment generated by C. albicans fermentation, promoting fungal survival [14]. This metabolic synergy contributes to the increased biomass and stability of mixed biofilms compared to single-species biofilms. Clinically, mixed C. albicans-S. aureus biofilms are frequently associated with chronic and recurrent infections, such as catheter-related bloodstream infections, burn wound infections, and periodontitis, with mortality rates 2–3 times higher than monomicrobial infections [15, 16]. The enhanced antimicrobial resistance of mixed biofilms is particularly striking: S. aureus within mixed biofilms can tolerate vancomycin concentrations > 1000-fold higher than planktonic cells, while C. albicans exhibits reduced susceptibility to azole antifungals due to ECM protection and upregulated efflux pump expression [9, 17]. These findings underscore that C. albicans hyphae critically promote mixed biofilm formation. Biofilms provide pathogens with a safer and more stable niche, and interactions between C. albicans and S. aureus within biofilms synergistically enhance their virulence, antimicrobial resistance, and immune evasion. Currently, with the widespread use of azole drugs and antibiotics, infections caused by multidrug-resistant strains have become increasingly prevalent. Reduced antibiotic susceptibility perpetuates biofilm persistence, creating a vicious cycle [18]. Conventional antimicrobial agents are ineffective against mixed biofilms, highlighting an urgent need for novel therapeutic strategies to address this challenge.

Andrographolide (AG), a diterpenoid lactone compound extracted from Andrographis paniculata (Acanthaceae), exhibits diverse pharmacological properties, including anti-inflammatory, anti-infective, antiviral, antitumor, and immunomodulatory effects [19]. Emerging research has revealed its significant antifungal potential. A previous study reported that AG could significantly inhibit C. albicans biofilm formation in vitro, preliminarily speculating that the mechanism involves promoting reactive oxygen species (ROS) production to induce apoptosis of C. albicans within biofilms. Further investigation indicates that AG can induce C. albicans biofilm dispersion by upregulating the dispersal-promoting gene HSP90 while downregulating the anti-dispersal gene UME6, which together promote biofilm dissociation [20]. Additionally, AG modulates fungal virulence by reducing farnesol secretion and increasing tyrosol production, thereby downregulating quorum sensing (QS)-related virulence genes CHK1 and PBS2 [21]. Notably, conventional antifungal agents often fail to prevent C. albicans biofilm development and may even induce biofilm formation at subinhibitory concentrations [22]. Kaneko et al. [23] found that AG not only inhibits biofilm formation but also penetrates and eradicates mature C. albicans biofilms. Beyond its antifungal activity, AG exhibits broad-spectrum antibacterial activity against Gram-positive and Gram-negative bacteria [24], though in Staphylococcus, it primarily inhibits biofilm formation rather than exerting direct bactericidal effects [25, 26]. Mechanistic studies revealthat AG disrupts QS systems, effectively suppressing biofilms of Staphylococcus epidermidis and methicillin-resistant S. aureus [18, 27]. Similar efficacy was observed against Pseudomonas aeruginosa, with AG exhibiting superior biofilm inhibition compared to gentamicin; as well as synergistic biofilm eradication was achieved when AG was combined with gentamicin [28]. Taken together, as a natural potential antimicrobial agent with promising therapeutic potential, AG demonstrates good inhibitory effects against both single-species infections (including C. albicans and various bacteria), and biofilm formation. However, its efficacy against polymicrobial infections involving co-infections of C. albicans and S. aureus remains largely unexplored.

Therefore, this study aimed to systematically investigate the inhibitory effects of AG on mixed cultures of C. albicans and S. aureus in both planktonic and biofilm states, with further mechanistic exploration at the gene expression levels. These results will provide novel insights for developing next-generation antimicrobial agents targeting polymicrobial infections.

Materials and methods

Experimental strains and culture conditions

The standard strain of C. albicans ATCC11006 was provided by the Fungal Laboratory of the Second Hospital of Shanxi Medical University (Shanxi, China); as well as the standard strain of S. aureus ATCC25923 was gifted by the Microbiology Teaching and Research Section of Nankai University (Tianjin, China). The C. albicans ATCC11006 and S. aureus ATCC25923 were cultured in yeast extract peptone dextrose (YPD) medium (Sangon, Shanghai, China) and trypticase soy broth (TSB) medium (Sangon, Shanghai, China), respectively, and both cultured in a 37℃ constant-temperature incubator.

Strain activation and preparation of bacterial suspension

Glycerol-preserved C. albicans and S. aureus were respectively picked up with a sterile inoculating loop, and respectively streaked onto YPD agar medium and TSB agar medium. After cultured in a 37℃ constant-temperature incubator for 48 h, fresh single colonies of C. albicans and S. aureus were then picked and transferred to YPD liquid medium and TSB liquid medium, respectively. The cultures were incubated in a thermostatic shaker at 37℃ with 220 rpm/min until the logarithmic growth phase. The turbidity of the two bacterial suspensions was adjusted to 0.5 MCF using a turbidimeter (PowerPac™, Biotechnology Innovation Organization [BIO] Company, USA), and then diluted 100-fold to a concentration of 1 × 10⁶ CFU/mL.

Determination of minimum inhibitory concentration (MIC)

The MIC values of AG against C. albicans, S. aureus, and their mixed strains was determined using the microbroth dilution method [29, 30]. Firstly, AG was serially diluted two-fold starting from 1024 µg/mL. In a 96-well plate, 100 µL of medium was added to each well (YPD medium for C. albicans, and TSB medium for S. aureus and the mixed strains), followed by preparing 10 concentration gradients of AG through serial dilution. After adding an equal volume of inoculum, the final AG concentrations in each well were 512, 256, 128, 64, 32, 16, 8, 4, 2, and 1 µg/mL. Each group had 3 replicate wells. Additionally, a negative control well with only 200 µL of TSB liquid medium and a positive control well with 100 µL of TSB medium plus 100 µL of inoculum were set up. Then, 100 µL of single-strain inoculum and mixed-strain inoculum (with C. albicans and S. aureus mixed at a 1:1 ratio) were added to the 96-well plate, resulting in a final bacterial concentration of 5 × 10⁵ CFU/mL. After thorough mixing, the plate was incubated statically at 37 °C for 24 h. The results were observed by comparing the turbidity of the liquid in each well, and the lowest concentration at which the liquid remained clear (indicating no microbial growth) was determined as the MIC.

The time-growth curve of the mixed strains under AG intervention

The bacterial suspensions of C. albicans and S. aureus at a concentration of 1 × 10⁶ CFU/mL were prepared, and then the two suspensions mixed at a 1:1 ratio (1 mL:1 mL) were added to a 15 mL centrifuge tube. For the experimental groups, 2 mL of AG at different concentrations (512 µg/mL, 256 µg/mL, 128 µg/mL, and 64 µg/ml) were respectively added. A negative control group received only 4 mL of TSB medium, while a positive control group was added with 2 mL of TSB medium supplemented with 2 mL of the mixed bacterial suspension. Each group had 3 replicates. After incubated at 37 °C with 220 rpm/min at 0, 4, 8, 12, 16, 20, and 24 h, 200 µL of the suspension solution was aspirated into a new 96-well plate, and the optical density (OD) values at 630 nm were measured and recorded using a microplate reader. A time-growth curve of the mixed strains was plotted with time as the abscissa and OD value as the ordinate to evaluate the effects of AG on the growth of planktonic mixed strains.

Construction of an in vitro mixed biofilm model

In a 96-well plate, suspensions of C. albicans and S. aureus at the concentration of 1 × 10⁶ CFU/mL were mixed at different ratios of 1:1 (45 µL:45 µL), 2:1 (60 µL:30 µL), 1:2 (30 µL:60 µL), 5:1 (75 µL:15 µL), and 1:5 (15 µL:75 µL), and then an equal volume of RPMI 1640 medium (Sangon) was added. After incubated statically at 37 °C for 12, 24, 36, and 48 h, the plates were taken for further crystal violet staining, as well as the OD values at 540 nm were detected using a microplate reader to screen the optimal ratio for biofilm formation.

Crystal violet staining method

AG solutions (100 µL) at different concentrations were added to a 96-well plate, and mixed with an equal volume of bacterial suspension to make the final AG concentrations to 512 µg/mL, 256 µg/mL, 128 µg/mL, and 64 µg/mL for each group (n = 3 per group). A positive control group is prepared by mixing 100 µL of mixed suspension with 100 µL of RPMI 1640 medium [31, 32]. After incubated at 37 °C for 48 h, the medium was aspirated without disrupting the biofilm at the bottom, and gently washed for 3 times with sterile PBS to remove planktonic bacteria. Then, 100 µL of 10% methanol was added to each well, and the plates were incubated for 15 min to fix the biofilm cells. After washing and air-dry, 100 µL of 0.1% crystal violet staining solution was added to each well for 15 min, and after washing, the biofilm morphology was observed under an inverted microscope. Afterwards, 200 µL of 33% glacial acetic acid was added to each well. After incubated for 30 min, 100 µL of the solution was transferred to a new 96-well plate, and the OD values at 540 nm were measured using a microplate reader. The biofilm inhibition percentage was calculated using the following formula: Biofilm inhibition percentage = [(A_control - A_experiment)/A_control] × 100% [33, 34].

Real-time quantitative PCR (RT-qPCR)

In a 6-well plate, suspensions of C. albicans and S. aureus at a concentration of 1 × 10⁶ CFU/mL were mixed at the optimal biofilm-forming ratio of 5:1 (total volume 900 µL). The positive control group was added with 900 µL of RPMI 1640 medium, while the experimental group was added with 900 µLof AG at a final concentration of 512, 256, and 128 µg/mL. After mixing, the plate was incubated statically at 37 °C for 48 h. Subsequently, the total RNA was extracted from the groups with different treatments using MiniBEST Universal RNA Extraction Kit (Takara, Japan) following the manufacturer’s instructions. Thereafter, the extracted total RNA was subjected to reverse transcription, and the reaction system contained 8 µL RNA and 2 µL 5×PrimeScript RT Master Mix (Perfect Real Time, Sangon Biotech). The thermal cycling program was set up under the following conditions: incubation at 37 °C for 15 min, followed by incubation at 85 °C for 5 s. Upon completion of the reaction, the resulting cDNA was retrieved and used for subsequent RT-qPCR analysis by employing 2×SGExcel FastSYBR Mixture. The sequences of all primers were shown in Table 1. The RT-qPCR reaction was initiated at 95 °C for 3 min and 95 °C for 5 s, followed by 40 cycles of 60 °C for 20 s and 95 °C for 15 s, as well as melting curves of 60 °C for 60 s, 95 °C for 15 s, and 60 °C for 15 s. The transcription levels of EFG1 and HWP1 (C. albicans) as well as icaA and cidA (S. aureus) were calculated using 2^−ΔΔCt method [35, 36], with ACT1 (C. albicans) and 16 S rRNA (S. aureus) as the reference genes.

Table 1.

The sequences of all primers

Primers	Forward (5’-3’)	Reverse (5’-3’)
Candida albicans
ACT1	GCCAACAGGATGCGAGGTTA	TCAGCGACTAAGGTGATGCC
EFG1	ATCCTGCCGCAACATCTCAA	GCACCACTAGGAGCACTTGT
HWP1	TGAACCTTCCCCAGTTGCTC	ATAGCACCACTTGAGCCAGC
Staphylococcus aureus
16s rRNA	CCATAAAGTTGTTCTCAGTT	CATGTCGATCTACGATTACT
cidA	ATCTTCCCTTAGCCGGCAGT	TGCACCGTCTTCTACCCAAG
icaA	AGTGCAGTTGTCGATGTTGGCTAC	CAACACATGGCAAGCGGTTCATAC

Statistical analysis

Each experiment was repeated three times, and data were reported mean ± standard deviation (SD). All data were analyzed using SPSS 26.0 software (SPSS, Inc., Chicago, IL, USA), and GraphPad Prism 9 (GraphPad Software, Inc., USA) was used to draw the figures. For comparison between two groups, unpaired t-test was employed; while for comparison among more than two groups, one-way analysis of variance (ANOVA) with Tukey’s post_test was applied. P < 0.05 was considered as statistical significance.

Results

Determination of mics of AG against C. albicans, S. aureus single strains and mixed strains

The MIC values of AG against C. albicans and S. aureus single strains were 256 µg/ml and 512 µg/mL, respectively, using the microbroth dilution method. Furthermore, the MIC value against the mixed strains was greater than 512 µg/mL, as shown in Table 2.

Table 2.

The minimum inhibitory concentration (MIC) values of Andrographolide (AG) against C. albicans, S. aureus, and their mixed strains determined using the microbroth Dilution method

Strain	MIC (µg/mL)
ATCC11006	256
ATCC25923	512
Mixed strains	>512

Effects of AG on the growth of the planktonic mixed strains with the culture time

From 0 h to 12 h, C. albicans and S. aureus in the mixed strain suspensions of each group grew slowly, with no obvious increase in cell count (P > 0.05, Fig. 1). From 12 h to 16 h, the mixed strains entered the logarithmic growth phase, and their growth was inhibited in a concentration-dependent manner under different concentrations of AG intervention (Fig. 1). During this period, 512 µg/mL of AG showed significant inhibitory effect on the growth of mixed strains (P < 0.05). From 16 h to 24 h, the inhibitory effect of AG gradually weakened with the increasing time, and 512 µg/mL AG failed to completely suppress the growth of mixed strains (Fig. 1).

Fig. 1.

The time-growth curves of the mixed strains (C. albicans and S. aureus) under andrographolide (AG) intervention. * P < 0.05, vs. control

Selection of the optimal ratio of C. albicans and S. aureus in biofilm formation

When C. albicans and S. aureus were co-cultured at different ratios (1:1, 2:1, 1:2, 5:1, and 1:5), the mixed biofilms all reached maturity at 48 h (Fig. 2). Among them, the optimal mixed C. albicans and S. aureus biofilm was formed when the two strains were cultured at a ratio of 5:1 (Fig. 2), so the ratio of C. albicans and S. aureus 5:1 was chosen for subsequent experiments.

Fig. 2.

In vitro biofilm growth curves of mixed strains at different ratios of 1:1, 2:1, 1:2, 5:1, and 1:5

The inhibitory effect of AG on mixed biofilms of C. albicans and S. aureus

In order to investigate the roles of AGs on the mixed biofilm of C. albicans and S. aureus, different concentrations of AGs (512 µg/mL, 256 µg/mL, 128 µg/mL and 64 µg/mL) were used, and OD540nm was measured. It was found that the OD540nm values after treated with 0, 128, 256, and 512 µg/mL of AG were 1.341 ± 0.117, 0.856 ± 0.101, 0.541 ± 0.117, and 0.129 ± 0.019, respectively (Fig. 3A). Compared with the control group, AG treatments at the concentrations of 128, 256, and 512 µg/mL significantly reduced the values of OD540nm (P < 0.05), with the better effects of 512 µg/mL AG. Then, the crystal violet staining method was employed to calculate the inhibition percentage of mixed biofilms treated with different concentrations of AG compared to the control group. The mixed biofilm formation was reduced by 90.23% with 512 µg/mL AG intervention, 65.90% with 256 µg/mL AG, and 35.43% with 128 µg/mL AG (Fig. 3B).

Fig. 3.

The inhibitory effect of andrographolide (AG) on mixed biofilms of C. albicans and S. aureus. A The formation ability of mixed biofilms under the intervention of different concentrations of AG. B Crystallization violet staining results of mixed biofilms under the intervention of different concentrations of AG. C The morphology of the mixed biofilm under the intervention of different concentrations of AG observed under an inverted microscope

After that, the morphology of the mixed biofilm after 512 µg/mL AG intervention was observed under an inverted microscope. The mixed biofilm in the control group showed a large number of C. albicans hyphae distributed in a dense network, with S. aureus closely adhering to the surrounding hyphae to form a compact mixed biofilm (Fig. 3C). After treated with 512 µg/mL AG, most C. albicans existed in spore form, with only a few hyphae formed, as well as S. aureus was scattered around C. albicans, and the biofilm was thin (Fig. 3C). These indicated that AG could inhibit the formation of mixed biofilms by suppressing hyphal formation of C. albicans, thus preventing S. aureus from adhering to C. albicans hyphae.

Effects of AG on the expression of biofilm-forming genes of C. albicans and S. aureus

The expression levels of C. albicans biofilm-forming genes (EFG1, and HWP1) and S. aureus biofilm-forming genes (icaA and cidA) in the mixed biofilms with different concentrations of AG were determined using RT-qPCR. The amplification and melting curves of EFG1 (Figure S1A), HWP1 (Figure S1B), ACT1 (Figure S1C), icaA (Figure S2A), cidA (Figure S2B) and 16 S rRNA (Figure S2C) in C. albicans or S. aureus showed the amplification curves all showed S-shaped fluorescence quantitative kinetic curves, as well as the melting curves showed a single peak at the melting temperature without any impurity peaks, which indicating both the target gene and the reference gene underwent specific amplification. The expression levels of EFG1 in the control, and treated with 128, 256, and 512 µg/mL of AG were respectively 1.000, 1.006 ± 0.097, 0.816 ± 0.196, and 0.361 ± 0.134; as well as the expression levels of HWP1 in the control, and treated with 128, 256, and 512 µg/mL of AG were 1.000, 0.991 ± 0.105, 0.873 ± 0.138, and 0.141 ± 0.077, respectively. Compared with the control group, 128 and 256 µg/mL of AG had no significant impacts on the EFG1 and HWP1 levels (P > 0.05); but 512 µg/mL of AG evidently down-regulated EFG1 and HWP1 expression (P < 0.05, Fig. 4A, B). For icaA, its expression was significantly reduced after administrated with 128, 256 and 512 µg/mL of AG in comparison with the control group (P < 0.05, Fig. 4C). For cidA, no significant difference was observed among the control and 128 µg/mL of AG (P > 0.05); whereas its expression was markedly declined after treatment of 256 and 512 µg/mL of AG (P < 0.05, Fig. 4D). These results suggested that 512 µg/mL of AG could significantly down-regulated the expression of biofilm-forming genes of C. albicans and S. aureus (EFG1, HWP1, icaA and cidA), thereby suppressing the biofilm formation.

Fig. 4.

Effects of AG on the expression of biofilm-forming genes of C. albicans and S. aureus. The expression levels of EFG1 (A), HWP1 (B), icaA (C) and cidA (D) in the mixed biofilms with different concentrations of AG determined using RT-qPCR. ns: not significance. * P < 0.05, ** P < 0.01, *** P < 0.001

Discussion

C. albicans is an opportunistic pathogenic fungus that colonizes the oral cavity, skin, gastrointestinal tract, and reproductive tract of healthy individuals [37]. Alterations in local microenvironment, host immunity, or microbiota composition can lead to C. albicans proliferation and subsequent infections, which may progress from superficial skin/mucosal infections to life-threatening candidemia. The morphological transition and biofilm formation of C. albicans are critical components of its virulence and pathogenicity [38–40]. S. aureus, another clinically significant pathogen, causes diverse infections ranging from mild skin/soft tissue infections to severe systemic manifestations including bacteremia, endocarditis, and osteomyelitis. Notably, its capacity to form biofilms on medical devices facilitates persistent infections [41, 42]. Epidemiological data highlight C. albicans and S. aureus as two predominant nosocomial pathogens, with their polymicrobial infections exhibiting significantly higher mortality rates compared to monomicrobial infections [43]. The escalating challenge of antimicrobial resistance further complicates clinical management, underscoring an urgent need for novel anti-infective therapeutics.

AG has demonstrated therapeutic efficacy against fever, influenza, and life-threatening conditions including dysentery, malaria, various cancers, and respiratory infections [44, 45]. In addition, emerging evidence indicates that AG exhibits broad-spectrum antimicrobial activity against diverse bacterial and fungal pathogens with a low propensity for resistance development [46]. However, current research has primarily focused on monomicrobial infections, leaving its effects and mechanisms against polymicrobial C. albicans-S. aureus co-infections largely unexplored. Therefore, in this study, we first determined the MIC values of AG against the test strains C. albicans ATCC11006, S. aureus ATCC25923, and mixed strains through in vitro susceptibility tests. It was found that the MIC values of the mixed strains were higher than those of single strains, suggesting mutual growth promotion and enhanced drug resistance during co-culture. Further time-growth curves of mixed strains under varying AG concentrations (0–512 µg/mL) revealed concentration-dependent growth inhibition and delayed logarithmic-phase progression in planktonic mixed cultures. The most significant suppression occurred at 512 µg/mL AG. However, the inhibitory effects diminished over time, with even high AG concentrations failing to achieve complete growth inhibition. These results suggest that AG exerts a predominantly static activity on planktonic mixed cultures, as evidenced by concentration-dependent growth inhibition during the logarithmic phase without complete suppression of viability over time. However, this conclusion is based on OD-based growth curves, and definitive distinction between bacteriostatic and bactericidal effects requires CFU count validation.

Compared to planktonic co-infections, mixed C. albicans-S. aureus biofilms present substantially greater clinical challenges. During early-stage biofilm formation in vitro, S. aureus not only promotes C. albicans adhesion to plastic surfaces but also facilitates hyphal transition through peptidoglycan (PGN) secretion [47]. These fungal hyphae subsequently serve as structural scaffolds for S. aureus attachment, creating a mutually reinforcing cycle that develops into dense, architecturally stable biofilms. In mature biofilms, C. albicans-derived ECM envelop S. aureus cells, forming a protective barrier that facilitates bacterial proliferation, increases biofilm biomass, and dramatically enhances antimicrobial resistance [48, 49]. Harriott et al. [31] documented vancomycin resistance in biofilm-embedded S. aureus at MICs > 1000-fold higher than planktonic counterparts. This multidrug resistance phenotype extends to doxycycline, nafcillin, and oxacillin [50], confirming mixed biofilms as critical virulence determinants. Given these findings, we systematically evaluated the anti-biofilm efficacy of AG against this recalcitrant dual-species system.

Using an established in vitro mixed biofilm model of C. albicans and S. aureus, crystal violet staining showed that 512 µg/mL AG reduced biofilm biomass by 90.23% compared to controls, demonstrating potent inhibition. Further microscopic analysis displayed that the control group exhibited dense C. albicans hyphae, with S. aureus adhering and aggregating around the hyphae to form a compact biofilm. In contrast, under 512 µg/mL AG intervention, most C. albicans existed in spore form with only a few hyphae, and S. aureus was scattered around C. albicans, resulting in a thin biofilm. Combining the inhibitory effects of AG on mixed strains in different states, these findings suggest that AG inhibits mixed strains not by direct bactericidal activity but by suppressing mixed biofilm formation. The mechanism may involve AG inhibiting C. albicans hyphal formation, depriving S. aureus of an adhesion scaffold and preventing dense biofilm formation. However, the precise molecular mechanisms of AG against mixed biofilms require further elucidation.

In C. albicans-S. aureus mixed biofilms, C. albicans hyphae serve as critical structural scaffolds that facilitate initial bacterial adhesion and biofilm establishment. Beyond this architectural framework, the ECM, composed of S. aureus-derived extracellular polymeric substances (EPS) and extracellular DNA (eDNA), constitutes an essential component for developing stable and mature biofilms. EFG1, a member of the APSES family of transcription regulators in fungi [51], was first identified by Joachim et al. in 1997 as a critical regulator in C. albicans, where its overexpression significantly promotes hyphal growth [52], while EFG1-deficient mutants exhibit impaired morphological transitions [53]. Additionally, EGF1 not only an important regulator of hyphal formation but also one of the six core transcription factors essential for C. albicans biofilm formation [54], directly or indirectly modulating key developmental processes such as adhesin production, extracellular matrix biosynthesis, and yeast-to-hypha transition [55]. In addition to EFG1, biofilm formation in C. albicans also requires the participation of adhesins for both surface attachment and intercellular adhesion. Among these, hyphal wall protein 1 (HWP1), one of the most extensively studied adhesins in C. albicans, is a cell surface protein covalently linked to cell wall glucan via the residue of its glycosylphosphatidylinositol (GPI) anchor [56]; as well as is essential for normal biofilm development both in vitro and in vivo. Nobile et al. [57] demonstrated this critical role through a rat venous catheter model, where scanning electron microscopy revealed that after 24 h of in vivo culture, HWP1Δ/Δ mutants formed only sparse microcolonies on catheter surfaces with no apparent hyphae, further confirming the importance of HWP1 in biofilm formation. In our study, RT-qPCR analysis showed that at 512 µg/mL AG, EFG1 and HWP1 were both significantly downregulated compared to the control, but lower AG concentrations (256 µg/mL and 128 µg/mL) showed no significant differences in gene expression. These results indicate that AG may inhibit mixed biofilm formation by suppressing key biofilm-associated genes (EFG1 and HWP1), thereby preventing hyphal development and subsequently depriving S. aureus of its adhesion scaffold.

In addition to C. albicans, our investigation also explored the effects of AG on biofilm-related genes of S. aureus within C. albicans-S. aureus mixed biofilms. While C. albicans hyphae serve as the primary scaffold during initial biofilm formation, EPS become indispensable for constructing the three-dimensional “cement-like” architecture in mature biofilms [58]. EPS primarily contain polysaccharides, nucleic acids, and proteins [59], among which polysaccharide intercellular adhesin (PIA) is the main EPS component of S. aureus biofilms, playing a vital role in colonization, biofilm maturation, immune evasion, and antibiotic resistance [60, 61]. Its biosynthesis is mediated by the ica operon (icaA, icaD, icaB, icaC), where icaA encodes N-acetylglucosaminyltransferase, a transmembrane protein essential for PIA production [62], making icaA critical for biofilm regulation. Beyond EPS, eDNA is also a key component of ECM in biofilm [63, 64], fulfilling multiple biological functions such as adhesion, gene transfer, and DNA damage repair [65, 66]. Due to the negative charge of DNA polymers, eDNA may act as an electrostatic polymer to anchor S. aureus to host surfaces, with early-stage biofilms showing particular sensitivity to DNase treatment, a testament to the adhesive role of eDNA [67]. eDNA release primarily occurs via cell death and lysis triggered by the holin-like protein encoded by cidA in S. aureus, which forms pores in the bacterial membrane to facilitate cytoplasmic content leakage [68], thereby liberating intracellular eDNA to promote biofilm formation in vivo and in vitro [69]. Our results showed that the expression of cidA was significantly downregulated under 256 µg/mL and 512 µg/mL AG intervention, while there was no significant difference under 128 µg/mL AG intervention compared with the control group. For icaA, it was significantly downregulated even under low concentrations of AG intervention, and the expression of icaA decreased in a dose-dependent manner with the increase of drug concentrations. Taken together, we speculate that AG may restrain the formation of mixed biofilms by regulating icaA and cidA to suppress the production of ECM by S. aureus, thereby reducing the structural stability of mixed biofilms.

This study has several limitations that warrant acknowledgment. First, we did not perform colony-forming unit (CFU) count assays, the gold standard for distinguishing bacteriostatic from bactericidal effects, for planktonic cultures or mixed biofilms treated with AG, relying instead on indirect evidence from optical density (OD) measurements and crystal violet staining. Second, our focus on in vitro experiments with standard strains may not fully recapitulate the complexity of clinical polymicrobial infections involving drug-resistant isolates or host microenvironment interactions. In addition, while we explored the expression of key biofilm-related genes (EFG1, HWP1, icaA, cidA), the upstream signaling pathways mediating AG’s regulatory effects on these genes remain unclear. To address these limitations and extend our findings, future research should focus on actionable directions, including performing CFU count assays for planktonic cultures (at 0, 12, 24, 48 h) and disrupted mixed biofilms to quantitatively determine viable cell numbers and clarify AG’s static or cidal activity; validating AG’s anti-biofilm efficacy using clinical isolates (e.g., fluconazole-resistant C. albicans, methicillin-resistant S. aureus) to enhance clinical relevance; investigating upstream signaling pathways such as QS molecule expression (e.g., farnesol, tyrosol for C. albicans; autoinducing peptides for S. aureus) and their interaction with target genes; conducting in vivo studies using animal models of mixed biofilm infections (e.g., catheter-associated bloodstream infection, burn wound infection) to assess therapeutic potential with pharmacokinetic/pharmacodynamic (PK/PD) and histopathological analyses; and exploring synergistic effects of AG with conventional antimicrobials (e.g., azoles, vancomycin) via checkerboard assays and CFU-based viability tests to optimize treatment regimens for mixed infections.

In conclusion, our study demonstrated that AG could inhibit the logarithmic growth phase of C. albicans–S. aureus mixed planktonic cultures, with growth data suggesting a predominantly static activity. AG may block C. albicans yeast-to-hypha transition, depriving S. aureus of adhesion scaffolds and thereby suppressing mixed biofilm development. Additionally, AG-mediated inhibition is closely related to the downregulation of C. albicans biofilm genes EFG1 and HWP1, as well as S. aureus biofilm genes icaA and cidA, which may reduce the virulence and invasiveness of the mixed strains. Our work provides a theoretical basis of AG as a potential candidate for the therapy of C. albicans–S. aureus mixed infections, though definitive confirmation of its bacteriostatic or bactericidal nature requires further CFU-based validation.

Authors’ contributions

JY and WF designed the research. JY, XF, YM and ZX did the experiment and obtained the data. JY, WY and WF analysed and explained the data. JY drafted the manuscript, and JY and WF revised the manuscript. All authors have read and approved the final version.

Funding

This study was supported by the Natural Science Foundation of Shanxi Province (Project number: 202403021221324; 202403021211116). The funding body played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.