Tetrahydropalmatine alleviates cancer induced bone pain by inhibiting TRPV1-SP-mediated macrophage recruitment and promoting M2 polarization

Abstract

Background

Cancer-induced bone pain (CIBP) remains a debilitating clinical challenge due to its complex pathogenesis and limited therapeutic options. Tetrahydropalmatine (THP), an active alkaloid from Corydalis tuber, has shown analgesic potential, but its specific mechanisms in mitigating CIBP- especially its interactions with neural factors and immune cells-remain incompletely understood. This study aimed to investigate the efficacy of THP in alleviating CIBP and clarify its underlying mechanisms, with a focus on the roles of transient receptor potential vanilloid 1 (TRPV1), substance P (SP), and macrophage dynamics in a mouse model of CIBP.

Methods

Using a multidisciplinary approach, we established a CIBP model in male C57BL/6 mice (and TRPV1-knockout mice) via intramedullary injection of lung cancer cells. Behavioral assessments were performed to evaluate mechanical, thermal, and cold allodynia, as well as spontaneous pain, following daily oral administration of THP (80 mg/kg) from day 7 post-modeling. Molecular and cellular analyses included immunofluorescence staining, real-time PCR, ELISA (to quantify SP, cytokines, and Tac1 expression), calcium imaging (to measure TRPV1-mediated calcium influx in DRG neurons), scratch assays (to assess macrophage migration), and flow cytometry (to analyze macrophage polarization in RAW 264.7 cells).

Results

THP significantly alleviated CIBP-related allodynia and spontaneous pain in mice. Mechanistically, THP directly inhibited TRPV1 function in the primary phase (≤ 14 days post-modeling) (with an IC₅₀ of 77.9 µM), reducing SP release from DRG neurons and suppressing macrophage recruitment to DRG and sciatic nerve via the TRPV1-SP pathway. Importantly, THP directly promoted the polarization of recruited macrophages toward the anti-inflammatory M2 phenotype, as evidenced by downregulated iNOS, TNF-α, IL-1β and upregulated CD206, IL-4, IL-10 in vitro (RAW264.7 cells) and in vivo. These effects were abrogated in TRPV1-knockout mice, confirming TRPV1 as a critical mediator in the primary phase.

Conclusion

In conclusion, THP mitigates CIBP through a dual mechanism: regulating macrophage recruitment via the TRPV1-SP pathway in the early stage to inhibit CIBP initiation and directly modulating the migrated macrophage polarization. This study provides novel insights into THP’s analgesic mechanisms and supports its potential as a preclinical candidate for CIBP treatment.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s13020-026-01359-3.

Introduction

Cancer-induced bone pain (CIBP) is a complex and highly debilitating condition that imposes a severe burden on the quality of life of cancer patients. The intricate and poorly understood web of mechanisms underlying CIBP has proven to be a significant stumbling block in the quest for optimal treatment modalities, leaving patients with a dearth of effective options to contend with this agonizing symptom [1].

Traditional Chinese medicine has a long history of treating pain, and Corydalis tuber is a well-recognized herb for this purpose [2, 3]. Among its bioactive constituents, tetrahydropalmatine (THP), an active alkaloid in Corydalis tuber, has shown analgesic potential [4]. Nevertheless, the exact molecular and cellular mechanisms by which THP alleviates CIBP remain incompletely defined. In light of this, the present study was designed with the aim of investigating the role of THP in CIBP and exploring its relationship with macrophages and associated neural factors.

CIBP arises from the intricate crosstalk between tumor cells, the bone microenvironment, and the nervous system [5]. Unraveling the mechanisms that underpin CIBP and pinpointing efficacious therapeutic agents are of paramount significance in the field of pain management. Macrophages are known to occupy a central position in the pathophysiology of pain [6]. Their infiltration into the dorsal root ganglia (DRG) and sciatic nerve has been implicated in the genesis and perpetuation of pain [7]. While one research has reported macrophage infiltration in the sciatic nerve within a cancer pain model [8], the specific role of macrophages infiltrating both the DRGs and sciatic nerve in CIBP mice has not been fully elucidated. Additionally, the release of mediators such as substance P (SP) from DRG neurons is recognized to modulate macrophage differentiation [9]. We recently proposed a two-phase of CIBP, with SP-induced macrophage infiltration in the primary phase and chemokine-mediated macrophage recruitment in the advanced phase [10]. However, the mechanisms by which SP induces macrophage infiltration remain nebulous. Transient receptor potential vanilloid 1 (TRPV1) is a crucial ion channel that is intricately involved in pain perception and modulation [11–13]. It has been implicated in a gamut of pain conditions, including CIBP [14, 15]. TRPV1 was reported to facilitate the release of SP in a corneal model [16]. However, their mediation in CIBP is still unstudied.

Furthermore, the polarization of macrophages into diverse phenotypes, such as the anti-inflammatory M2 macrophages, represents a promising target for pain relief strategies [17]. We postulated that THP might exert an influence on infiltrated macrophage polarization in CIBP. The role of THP in regulating macrophage polarization across different phases of CIBP warrants further investigation.

This study was therefore designed to systematically investigate the role of THP in CIBP. By meticulously exploring its effects on the macrophage recruitment and polarization, we sought to clarify the underlying mechanisms and provide a foundation for developing more effective, targeted therapies for CIBP.

Results

Tetrahydropalmatine alleviates cancer-induced bone pain

In order to evaluate the analgesic efficacy of THP, a mouse model of cancer induced bone pain (CIBP) was established, following the methodology described previously [18]. The Von-Frey test was employed to determine the onset time of the analgesic effect of THP. Specifically, on the 14th day subsequent to the CIBP surgery, it was ascertained that the analgesic effect of THP manifested between 60 and 90 min post-medication (Fig. 1 a). To determine the optimal dose, mice were administered different concentrations of THP. Efficacy increased with dose escalation (Fig. 1 b). Based on mouse-to-human dosage conversion, doses exceeding 80 mg/kg in mice were deemed clinically irrelevant. Hence, a dosage of 80 mg/Kg of THP was selected for the subsequent experiments.

Fig. 1.

Tetrahydropalmatine mitigates CIBP related pain behaviors. a Time course of THP’s analgesic onset (80 mg/kg, oral) in CIBP mice (day 14, von-Frey test). n = 6 mice/group. b Dose-dependent analgesic effect of THP on mechanical allodynia (60–90 min post-administration, day 14). n = 6 mice/group. c–e THP (80 mg/kg, daily from day 7) attenuated mechanical (c), cold (d), and thermal (e) allodynia over 21 days. n = 7 mice/group. f, g THP reduced spontaneous pain (flinching, guarding) in CIBP mice (day 14). n = 8 mice/group. Data were analyzed using two-way ANOVA (c, d, e) and one-way ANOVA (a, b, f, g) with Bonferroni’s post hoc test (> 2 groups); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; error bar, SD

Thereafter, the mechanical, thermal, and cold allodynia were monitored, and an oral gavage of THP (80 mg/kg) was administered daily commencing from the 7th day after the CIBP surgery, as this was the stage when the CIBP mice exhibited pronounced pain. As anticipated, the group of mice treated with THP demonstrated a significant attenuation in mechanical, cold, and heat allodynia (Fig. 1 c–e). Additionally, spontaneous pain in mice represents a crucial observational parameter. Upon observing the spontaneous pain in mice at 14th days after the CIBP modeling, THP also mitigated the spontaneous pain in CIBP mice (Fig. 1 f, g). Collectively, the above findings strongly suggest that Tetrahydropalmatine mitigates mechanical, heat, cold allodynia and spontaneous pain induced by CIBP.

To assess the impact of THP on tumor growth, we conducted in vivo micro-computed tomography (micro-CT) analyses. Quantitative evaluation indicated no significant differences in bone mineral density (BMD) between the THP-treated and vehicle-treated CIBP groups (Supplementary Fig. 1 a, b) on 14th day and tumor weight on 21st day (Supplementary Fig. 1 c). These findings underscore the primary analgesic effect of THP observed in our study.

Tetrahydropalmatine mitigates macrophage infiltration in dorsal root ganglia and sciatic nerve

The accumulation of macrophages is of crucial significance in the advancement of pain [10]. Subsequently, the infiltration of THP decreased iNOS and enhanced CD206 level in DRG macrophages was examined in the dorsal root ganglion (DRG) and sciatic nerve through immunostaining for F4/80 (Fig. 2 a, b). The administration of THP led to a notable reduction in the aggregation of macrophages in the DRGs (Fig. 2 c). Moreover, the mRNA level of F4/80 was also decreased following the application of THP (Fig. 2 d). A similar phenomenon was observed in the sciatic nerve as well (Fig. 2 e, f).

Fig. 2.

THP reduces macrophage infiltration and modulates cytokines in DRG and sciatic nerve. a, b Representative immunofluorescence images of F4/80⁺ macrophages (red) co-stained with NeuN (DRG, a) or NF-200 (sciatic nerve, b) (green) in sham, CIBP, and CIBP-THP (80 mg/kg) mice (day 14). Scale bar = 20 µm. c–f Quantification of F4/80⁺ cell numbers (c, e; n = 5 mice/group, 3 microscopic fields/section) and mRNA levels (d, f; n = 6 mice/group) showing THP-mediated reduction of macrophage infiltration. g–j THP decreased M1-specific surface markers (iNOS; g-h) and enhanced M2-associated markers (CD206; i-j) in DRG (Realtime-PCR/ELISA, n = 6 mice/group). k–r THP decreased pro-inflammatory cytokines (IL-1β, TNF-α; k–n) and increased anti-inflammatory cytokines (IL-4, IL-10; o–r) in DRG (Realtime-PCR/ELISA, n = 6 mice/group). Data were analyzed using one-way ANOVA (c-r) with Bonferroni’s post hoc test (> 2 groups); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; error bar, SD

To elucidate the effect of the drug on macrophage subtypes, M1-specific surface markers (iNOS, inducible Nitric Oxide Synthase) and M2-associated markers (CD206, Mannose Receptor C Type 1) were detected in DRGs by ELISA. THP decreased iNOS and enhanced CD206 levels in DRG in CIBP mice (Fig. 2 g–j). We also investigated the impact of the drug on the expression of pro-inflammatory cytokines primarily secreted by M1 macrophages, namely IL-1β (Interleukin-1β) and TNF-α (Tumor Necrosis Factor-α), in the DRGs. Both IL-1β and TNF-α were elevated in CIBP mice, and THP attenuated this elevation as determined by Realtime-PCR and ELISA techniques (Fig. 2 k-n). Conversely, IL-4 (Interleukin-4) and IL-10 (Interleukin-10) (anti-inflammatory cytokines associated with M2 macrophages) were upregulated after the administration of THP (Fig. 2 o–r).

These findings indicate that macrophage infiltration in the DRG and sciatic nerve is critical in CIBP and we demonstrated that THP mitigated the infiltration of M1 macrophages and augmented the presence of M2 macrophages in the DRGs and sciatic nerve, thereby potentially modulating the macrophage-mediated inflammatory response.

Tetrahydropalmatine suppresses the release of SP from DRG neurons and inhibits macrophage migration

In order to explore the underlying mechanism of macrophage migration, substance P (SP), a neuropeptide with the potential to chemoattract macrophages, was quantified using immunofluorescence staining (Fig. 3 a). As anticipated, the expression of SP was elevated on the 14th day in CIBP mice, whereas the administration of THP led to a reduction in SP release (Fig. 3 b). To further validate this finding, the mRNA level of Tac1, the precursor of SP, was also examined, and a similar outcome was obtained (Fig. 3 c). The release of SP was additionally assessed by ELISA to provide more conclusive evidence (Fig. 3 d). It was discovered that the occurrence of pain associated with SP increased in parallel with the release from DRGs. The level of SP in DRG neurons peaked on the 11th and 14th days and then gradually declined. However, treatment with THP effectively diminished the content of SP (Fig. 3 e). Then the period before the 14th day of CIBP could be defined as the primary phase, while the days following it could be considered the advanced phase, which further confirms our previously proposed two-phase model of CIBP progression [10].

Fig. 3.

THP suppresses SP release and inhibits macrophage migration. a Representative immunofluorescence images of SP⁺ DRG neurons (red) co-stained with NeuN (green) in sham, CIBP, and CIBP-THP mice (day 14). Scale bar = 20 µm. b–d THP reduced SP⁺ neuron counts (b; n = 6 mice/group, 3 microscopic fields/section), Tac1 mRNA (c; n = 6 mice/group), and SP protein (d; n = 6 mice/group) in DRG (day 14). e Time course of SP levels in CIBP mice with/without THP (ELISA; n = 3 independent experiments). f THP inhibited SL-induced SP release from DRG neurons (100 µM THP, ELISA; n = 4 independent cell culture replicates). g Representative images show the migration of RAW 264.7 cells treated with SP (100 nM, 200 nM) combined with SL after 8 h and 16 h of incubation. Scale bar: 20 µm. h, i SP-mediated RAW 264.7 cells migration (scratch assay, 8/16 h incubation with 100/200 nM SP + SL; n = 8 independent cell culture wells/group). Data were analyzed using one-way (b-d, f–h) and two-way (e) ANOVA with Bonferroni’s post hoc test (> 2 groups); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; error bar, SD

To mimic the impact of the tumor microenvironment on SP release from DRG neurons, DRG neurons were incubated with the supernatant of Lewis lung cancer cells (SL). It was observed that SL augmented the release of SP in DRG neurons, while THP counteracted this effect and reduced SP release (Fig. 3 f). To investigate the influence of SP on macrophage migration, trans-well experiments were conducted at 8 and 16 h of cell incubation to test our hypothesis. Interestingly, it was observed that SP alone was capable of initiating macrophage migration. Nevertheless, within the tumor microenvironment, SP exhibited a substantially enhanced effect on macrophage migration (Fig. 3 g-h, Supplementary Fig. 2).

In summary, our results demonstrate that THP suppresses SP release from DRG neurons and concomitantly inhibits macrophage migration in the primary phase of CIBP.

TRPV1 facilitates the efficacy of THP in diminishing macrophage recruitment and alleviating CIBP

In order to precisely define the role of TRPV1 in the process of THP-mediated reduction of macrophage infiltration and relief of CIBP, TRPV1-KO (knockout) mice were employed to establish the CIBP model and subsequently treated with THP. Given that SP levels peaked on the 14th day post CIBP induction in the WT (wild type) mice, the infiltration of macrophages was evaluated on this specific day following the surgery. The presence of macrophages was examined in the DRGs and sciatic nerve of both WT and TRPV1-KO mice after the administration of THP (Fig. 4 a-b). Notably, THP was effective in reducing the infiltration of macrophages in the WT mice. However, this reduction was absent in the TRPV1-KO mice, both in the DRGs and the sciatic nerve (Fig. 4 c, d), suggesting a crucial role for TRPV1 in this process.

Fig. 4.

TRPV1 is required for THP’s effects on macrophage recruitment and SP release. a, b Representative immunofluorescence images of F4/80⁺ macrophages (red) in DRG (a) and sciatic nerve (b) of WT and TRPV1-KO CIBP mice (vehicle or THP 80 mg/kg, day 14). Scale bar = 20 µm. c, d THP reduced F4/80⁺ cells in WT but not TRPV1-KO mice (n = 5 mice/group, 3 microscopic fields/section). e, f THP decreased SP levels in WT (day 14, e) but not TRPV1-KO mice (days 14/21, e–f; ELISA; n = 6 mice/group). g THP inhibited capsaicin (500 nM)-induced SP release (100 µM THP, ELISA; n = 4 independent cell culture replicates). Data were analyzed using one-way (c-g) ANOVA with Bonferroni’s post hoc test (> 2 groups); *p < 0.05, **p < 0.01, ***p < 0.001; error bar, SD

The release of SP was also quantified in the aforementioned mice on the 14th and 21st days. It was observed that TRPV1 played a significant role in modulating SP level in the DRGs on the 14th day, but this effect was no longer evident on the 21st day (Fig. 4 e–f). Finally, to further investigate the relationship, we assessed the SP release following the stimulation of capsaicin (Cap) after a 12-h incubation period. Capsaicin was found to enhance the release of SP from the DRGs, whereas THP directly counteracted this increase (Fig. 4 g).

It has been reported that TRPV1 promotes the release of SP in response to cold stimuli in the eye [16]. Subsequently, we delved into the role of TRPV1 in SP release within the context CIBP in mice (Fig. 5 a). In CIBP mice, there was a marked elevation in the count of SP-positive DRG neurons. However, this increase was notably mitigated in TRPV1-KO mice (Fig. 5 b). To further validate these observations, we examined the mRNA expression levels of Tac1 in both WT and TRPV1-KO mice. In line with our initial hypothesis, within the CIBP model, the expression of Tac1 mRNA was found to be lower in TRPV1-KO mice as compared to their WT counterparts (Fig. 5 c). Analogously, SP release was also reduced following TRPV1 knockout (Fig. 5 d). Taken together, these findings offer compelling evidence suggesting that TRPV1 plays a facilitative role in SP release during cancer-induced bone pain.

Fig. 5.

TRPV1 facilitates SP release in CIBP. a Representative immunofluorescence images of SP⁺ DRG neurons in WT and TRPV1-KO mice (control/CIBP, day 14). Scale bar = 20 µm. b–d TRPV1-KO reduced SP⁺ neuron counts (b; n = 6 mice/group, 3 tissue sections/mice), Tac1 mRNA (c; n = 6 mice/group), and SP protein (d; n = 5 mice/group) in CIBP mice. * p < 0. 05, **p < 0. 01, ***p < 0. 001. One-way ANOVA (b-d) followed by Bonferroni’s post hoc test; error bar, SD

The above results demonstrate that TRPV1 facilitates the action of THP in reducing macrophage recruitment by promoting SP levels and effectively alleviating CIBP.

Tetrahydropalmatine directly suppresses the function of TRPV1, leading to the alleviation of CIBP

To gain a more comprehensive understanding of the role TRPV1 plays in the relief of CIBP mediated by THP, the manifestation of mechanical allodynia was examined in both WT and TRPV1-KO mice following THP treatment. The baseline data indicated that there were no differences between the WT and TRPV1-KO mice (Fig. 6 a). However, a significant increase in mechanical allodynia was observed in the TRPV1-KO mice on the 14th and 21st days post-THP administration (Fig. 6 b, c). This finding further accentuates the crucial role TRPV1 serves in the analgesic effect of THP.

Fig. 6.

THP directly inhibits TRPV1 function to alleviate CIBP. a–c Mechanical allodynia in WT and TRPV1-KO CIBP mice (vehicle/THP 80 mg/kg) at baseline (a), day 14 (b), and day 21 (c). n = 7 mice/group. d–f THP (100 µM) attenuated capsaicin (500 nM)-induced calcium influx in DRG neurons (representative images, d; traces, e; dot plots, f; n = 3 mice/group, 20–30 neurons/mice). g Concentration–response curve of THP inhibiting TRPV1 (IC50 = 77.9 µM; n = 3 independent calcium imaging experiments). h Overall 3D predictive model of THP targeting the TRPV1 channel (molecular docking). i Detailed 3D predictive model of the interaction between THP and the TRPV1 channel. j 2D diagram of the predicted interaction between THP and the TRPV1 channel. k, l Representative trace showing the effect of THP (100 µM) on Capsaicin (Cap, 100 nM)-induced Ca²⁺ influx in HEK293 cells transfected with hTRPV1(n = 3 independent calcium imaging experiments). Data were analyzed using one-way (a-c, f, l) ANOVA with Bonferroni’s post hoc test (> 2 groups); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; error bar, SD

To validate the impact of THP on TRPV1 function within DRG neurons, calcium imaging was employed to monitor its influence on the calcium influx triggered by capsaicin. As expected, THP was found to mitigate the calcium influx induced by capsaicin (Fig. 6 d, e). The enhancement in fluorescence intensity typically caused by capsaicin was notably reduced upon incubation with THP (Fig. 6 f). Finally, our data revealed that THP exhibits an IC₅₀ of 77.9 µM for TRPV1 inhibition (Fig. 6 g).

Molecular docking assays conducted in HEK293 cells overexpressing human TRPV1 (hTRPV1) predicted that THP may target the TRPV1 channel to inhibit its functional activity (Fig. 6 h–j), contributing to its analgesic properties. The docking score of THP with TRPV1 was −7.699 kcal/mol which is comparable to that of the known TRPV1 antagonist capsazepine (docking score: −7.812 kcal/mol) indicating a strong binding affinity. Additionally, we transfected HEK293 cells with hTRPV1 plasmids to evaluate the effect of THP on capsaicin-induced calcium influx, ensuring that interference from endogenous upstream signaling pathways (such as those in primary DRG neurons) was excluded. Calcium imaging results showed that THP completely inhibited the capsaicin-induced calcium influx in the transfected HEK293 cells (Fig. 6 k-l). This evidence demonstrates that THP directly inhibits TRPV1 function.

Tetrahydropalmatine directly promotes the transformation of macrophages into M2 macrophages during the advanced phase

The preceding results illustrated that THP mitigated CIBP in the primary phase by modulating macrophages within the TRPV1-SP pathway. As the CIBP progresses, the level of SP was observed to decline after the 14th day post-surgery, signifying the entry into the advanced phase. Remarkably, THP maintained its efficacy in reducing macrophage recruitment and relieving CIBP during this advanced phase. This led us to postulate that THP might exert a direct effect on the recruited macrophages.

To test this hypothesis, we conducted CCK8 experiments to assess the cytotoxicity of THP at diverse concentrations on RAW 264.7 cells. Our findings indicated that THP concentrations surpassing 200 µM led to a reduction in the cell viability of RAW 264.7 cells (Fig. 7 a). Interestingly, we discovered that THP (100 µM) decreased the release of iNOS and augmented the release of CD206 subsequent to incubation with SL (Fig. 7 b, c). When RAW 264.7 cells were exposed to 50% supernatant of Lewis lung cancer cells (SL), there was an upregulation in the release of TNF-α. However, the addition of 100 µM THP effectively attenuated this TNF-α release (Fig. 7 d). A similar trend was noted for IL-1β, where SL enhanced its secretion, and THP treatment ameliorated the situation by reducing the elevated levels (Fig. 7 e). Additionally, THP reversed the release patterns of IL-4 and IL-10 after incubation with SL (Fig. 7 f, g).

Fig. 7.

THP promotes M2 macrophage polarization in the advanced phase. a Cytotoxicity of THP on RAW 264.7 cells (CCK-8 assay; n = 6 technical replicates/condition). b–g THP (100 µM) reduced SL-induced iNOS/TNF-α/IL-1β, and upregulated CD206/IL-4/IL-10 in RAW 264.7 cells (ELISA; n = 5 independent cell culture replicates). h–k Flow cytometry showing THP increased CD206⁺ cell number (g–i) and fluorescence intensity (j) in SL-stimulated RAW 264.7 cells (n = 3 independent cell culture replicates). Flow cytometry gating strategy: Forward scatter (FSC-A) vs Side scatter (SSC-A): Gate on viable RAW 264.7 cell population based on morphological characteristics to exclude debris. FSC-A vs FSC-H: Gate on single cells to exclude doublets. Isotype control: Set negative staining threshold using an isotype-matched control antibody (PE-conjugated IgG) to define CD206⁻ cells. PE-CD206 staining: Gate on CD206⁺ cells within the viable single-cell population (above the isotype control threshold) to quantify the percentage and mean fluorescence intensity (MFI) of M2-polarized macrophages. Data were analyzed using one-way (a-g, j-k) ANOVA with Bonferroni’s post hoc test (> 2 groups); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; error bar, SD

To further elucidate the impact of THP on macrophage differentiation towards the type 2 phenotype, we employed flow cytometry to analyze its effect on CD206-expressing macrophages. The results demonstrated that incubation with THP significantly augmented both the quantity and proportion of CD206-positive cells (Fig. 7 h-j). Moreover, the utilization of THP led to an elevation in the fluorescence intensity of CD206 cells (Fig. 7 k).

These results indicate that THP also directly promotes the polarization of macrophages toward the M2 phenotype following infiltration.

Discussion

The present study undertook a comprehensive exploration of the role of tetrahydropalmatine (THP) in mitigating cancer-induced bone pain (CIBP) and deciphered its underlying mechanisms. Our results demonstrate that THP exerts significant analgesic efficacy in a mouse model of CIBP. This was evinced by the attenuation of mechanical, thermal, and cold allodynia, as well as the diminution of spontaneous pain. These findings are consistent with the traditional application of Corydalis tuber, from which THP is sourced, in pain management in traditional Chinese medicine.

Clinical management of CIBP remains challenging: current treatments are limited by tolerance, addiction, or insufficient efficacy in advanced stages, leaving a critical gap for safer, mechanism-based therapies [19]. While THP is not a new compound, its favorable safety profile and long-standing use in traditional Chinese medicine for pain make it a clinically relevant candidate worth re-evaluating-especially for CIBP, where its specific role and mechanisms remained underexplored. Notably, while clinicians may have employed THP on an empirical basis, systematic preclinical evidence supporting its efficacy in CIBP and clarifying its target pathways has been lacking. Unlike general cancer pain, CIBP involves a unique interplay between tumor-bone microenvironment, dorsal root ganglion (DRG), and immune cells (macrophages), which is distinct from other pain types. This study fills this gap by focusing on CIBP-specific pathophysiology. Recent studies have identified novel small-molecule CIBP therapeutics targeting spinal dorsal horn neuroglial/neuronal signaling, such as esketamine (suppresses MAPK signaling and glial activation [20]), and cycloastragenol (targets Sirt1 to inhibit neuronal ferroptosis and promote M2 microglial polarization [21]). These highlight the value of modulating neuro-immune crosstalk for CIBP, and our work expands this paradigm by identifying a peripheral TRPV1-SP-macrophage axis in DRG and sciatic nerve targeted by THP.

A key finding is that THP’s analgesic effect occurs independently of anti-tumor activity as confirmed by in vivo micro-CT. This aligns with previous findings that it neither diminishes the antitumor efficacy of cisplatin nor reduces the platinum concentration in the tumor tissues of tumor-bearing nude mice [22]. Two key factors likely underpin the apparent discrepancy between our results and the reported anti-tumor activity of Corydalis extracts. First, in vitro anti-proliferative effects typically require higher concentrations than those needed to elicit neuroactivity. Second, and more critically, the well-documented tumor-suppressive activity of the parent Corydalis herb is likely attributable to the synergistic effects of its multiple bioactive components rather than to THP acting alone.

The primary mechanism underlying THP’s analgesic effect involves the regulation of macrophage infiltration. Macrophages are widely acknowledged to play a pivotal role in the pathophysiology of pain [23, 24], and numerous studies have documented their accumulation in tumor tissues [25]. Significantly, our investigation revealed that macrophages infiltrated in the DRGs and sciatic nerve, and THP substantially reduced this accumulation. This was concomitant with a decline in the expression of iNOS (M1 macrophages) and an augmentation in CD206 (M2 macrophages). This was also accompanied by a decline in the expression of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α), which are pro-inflammatory cytokines primarily secreted by M1 macrophages, and an augmentation in anti-inflammatory cytokines associated with M2 macrophages like interleukin-4 (IL-4) and interleukin-10 (IL-10)[26, 27]. The transition from a pro-inflammatory (M 1) to an anti-inflammatory (M 2) macrophage phenotype is likely to contribute to pain alleviation, given that M2 macrophages have been demonstrated to possess beneficial effects in dampening inflammation and pain [17]. In our study, we included TNF-α, IL-1β, IL-4, and IL-10 due to their functional relevance: in CIBP, M1 macrophage-derived pro-inflammatory cytokines (TNF-α, IL-1β) directly sensitize DRG neurons and exacerbate pain [28, 29], whereas M2-derived anti-inflammatory cytokines (IL-4, IL-10) mitigate neuroinflammation and alleviate pain [30, 31]. Therefore, these cytokines serve not merely as "indirect indicators" but as functional mediators of pain.

We further identified substance P (SP) as a critical mediator. SP, a neuropeptide, is known to chemoattract macrophages and regulate pain signaling [10, 32]. THP was found to diminish the release of SP from DRG neurons, both in the context of the CIBP model and when DRG neurons were incubated with the supernatant of Lewis lung cancer cells in this study. Moreover, THP attenuated macrophage migration induced by SP in the tumor microenvironment. These results imply that THP may disrupt the SP-mediated crosstalk between neurons and macrophages, thus reducing pain. Researchers have reported that Schwann cell-derived CXCL2 contributes to cancer pain by modulating macrophage infiltration in the sciatic nerve in a mouse breast cancer model [8]. They unearthed a distinct mechanism in a cancer pain model, signifying that other factors can also instigate macrophage recruitment. We recently reported that SP release to migrate macrophages mainly in the primary phase of CIBP [10]. Going further than before, in this study, we discovered THP mitigates SP release and reduced the migration of macrophages. Notably, the analgesic efficacy of THP is comparable to that of GBPT, underscoring its potential as a promising therapeutic candidate for clinical application.

We observed that the release of SP was elevated on the 7th day concomitant with the onset of pain, reaching its peak on the 14th day, and the temporal progression of pain was consistent with SP fluctuations. In the subsequent model, the release of SP declined, yet the pain persisted. Accordingly, we categorized CIBP into an initial primary phase spanning the first 14 days and a subsequent advanced phase. SP played a crucial role in macrophage infiltration during the primary phase, whereas its functional activity persisted in the advanced phase, consistent with its previously observed role [10]. However, during the advanced phase of CIBP, when SP levels subsided, THP continued to exert robust efficacy in reducing macrophage recruitment and alleviating pain. We further confirmed that THP directly promotes the polarization of macrophages toward the M2 anti-inflammatory phenotype, a mechanism that underlies its sustained analgesic efficacy. Collectively, these findings demonstrate that THP exerts a dual mechanism of action across different phases of CIBP.

The transient receptor potential vanilloid 1 (TRPV1) emerged as an essential upstream target. TRPV1, a well-characterized cation ion channel, is centrally involved in nociceptive perception and signaling modulation [11–13, 33]. Cumulative studies have established that TRPV1 gating activity tightly modulates SP secretion in an eye model [16]. In TRPV1-KO mice, the inhibitory effects of THP on macrophage infiltration and SP release were completely abrogated, demonstrating that TRPV1 is an indispensable mediator of THP’s analgesic actions. Moreover, THP exerts a direct suppressive effect on TRPV1 function, which is corroborated by the marked attenuation of capsaicin-evoked calcium influx in primary DRG neurons and hTRPV1-overexpressing HEK 293 cells. Collectively, these findings clearly demonstrate that THP targets the TRPV1-SP axis to modulate macrophage infiltration and downstream nociceptive signaling cascades. Notably, our observation that TRPV1 knockout attenuates mechanical allodynia in CIBP mice but not in naive mice (consistent with our previous work [13]) highlights a context-dependent role of TRPV1 in pain signaling. Under physiological conditions, basal mechanical nociception relies on canonical mechanotransducers such as Piezo2 [34, 35], TRPA1 [36, 37], and NaV1.8[38]-expressing nociceptors and TRPV1 is dispensable for this process-explaining the lack of mechanical pain differences between WT and TRPV1-KO naive mice. In contrast, CIBP triggers pathological remodeling that endows TRPV1 with a critical role in mechanical sensitization via three interconnected mechanisms: first, pro-inflammatory cues in the tumor-bone microenvironment induce aberrant activation and upregulation of TRPV1 in DRG neurons, driving the release of SP and other pro-inflammatory neuropeptides; second, the TRPV1-SP axis recruits M1 macrophages to the DRG and sciatic nerve, whose secreted cytokines (TNF-α, IL-1β) directly sensitize mechanical nociceptors by enhancing Piezo2 and NaV1.8 function; third, TRPV1 activation promotes calcium influx that fosters functional synergy with mechanical transducers (Piezo2, NaV1.8) [39, 40], amplifying mechanical pain signals. These pathological adaptations-absent in naive mice-explain why TRPV1 deletion mitigates mechanical allodynia specifically in the CIBP model, underscoring the TRPV1-SP-macrophage axis as a key mediator of CIBP-related mechanical sensitization.

Our in vitro studies using RAW264.7 macrophages provided preliminary validation that THP directly promotes M2 polarization. The RAW264.7 cell line, a well-established murine macrophage model, offers key advantages for exploring macrophage polarization: stable genetics, facile cultivation/manipulation, and highly reproducible outcomes [10, 41]. Leveraging these strengths, we preliminarily validated THP’s direct modulatory effects on macrophage polarization under controlled in vitro conditions, laying a foundation for subsequent mechanistic studies. Our in vitro assays confirmed that THP directly promotes macrophage polarization toward the anti-inflammatory M2 phenotype. This was corroborated by downregulated M1 marker iNOS, upregulated M2 surface marker CD206 [42, 43] and M2-associated anti-inflammatory cytokines (IL-4, IL-10), as well as reduced M1-related pro-inflammatory cytokines (TNF-α, IL-1β). Notwithstanding these findings, a key limitation of the present study merits acknowledgment: RAW264.7 cells are an immortalized macrophage cell line, which may alter their inherent phenotypic and functional properties. By contrast, primary macrophages isolated from bone tissue, DRG, or sciatic nerve reside within a complex signaling microenvironment shaped by tumor cells, stromal cells, and neural mediators-factors that may modulate their polarization response to THP in a manner distinct from that of cultured RAW264.7 cells. Accordingly, results derived from RAW264.7 cells cannot be directly extrapolated to primary macrophages within the in vivo CIBP milieu. Notably, while M1/M2 represents a simplified framework for the continuous spectrum of macrophage activation, we quantified iNOS (M1-specific) and CD206 (canonical M2 marker) [31, 42, 44] to define polarization trends. Future work will incorporate functional assays (e.g., phagocytosis, neuron-macrophage co-culture) for comprehensive characterization, and primary macrophages will be used to validate the relevance of these in vitro findings to the in vivo CIBP microenvironment. Collectively, these data provide critical preliminary evidence that THP directly modulates macrophage polarization. It is important to acknowledge that the M1/M2 classification employed in this study represents a well-established but simplified framework for describing macrophage activation states, which exist along a dynamic and plastic continuum in vivo rather than as discrete, mutually exclusive phenotypes. Our quantification of canonical M1 (iNOS, TNF-α, IL-1β) and M2 (CD206, IL-4, IL-10) markers provides a phenotypic readout of polarization trends induced by THP, but this approach does not capture the full functional complexity of macrophage activation in CIBP.

CIBP is increasingly acknowledged as a multifactorial disorder characterized by complex interactions among neuronal plasticity, immune cell dynamics, and epigenetic remodeling [5, 19]. In addition to the neuro-immune interactions we have identified, recent research has elucidated critical neuronal mechanisms that intersect with the TRPV1-SP-macrophage axis. Notably, TRPV1 functions not only as a direct pain sensor but also engages with other transient receptor potential (TRP) channels, such as TRPA1 and TRPM8, as well as neurotrophic factors like nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF), to exacerbate neuronal hyperexcitability in dorsal root ganglia (DRG)[13, 15, 45, 46]. NGF, produced by tumor and stromal cells within the bone microenvironment, enhances TRPV1 expression in DRG neurons via the TrkA-PI3K pathway, increasing SP release and promoting macrophage recruitment [14]. Our discovery that THP directly inhibits TRPV1 function and reduces SP release complements these findings by targeting a central node in the neuronal-immune network. Furthermore, THP's capacity to promote the polarization of macrophages towards the anti-inflammatory M2 phenotype, characterized by increased IL-4 and IL-10 production, may indirectly mitigate neuronal hyperexcitability. This further connects our proposed mechanism to the broader context of neuronal plasticity in CIBP.

Epigenetic regulation has emerged as a significant contributor to the persistence of CIBP, with recent research emphasizing the roles of DNA methylation, histone modifications, and non-coding RNA networks in modulating pain-related gene expression [47, 48]. For instance, in DRG neurons of mice with CIBP, there is a reduction in DNA methylation at the TRPV1 promoter, resulting in increased TRPV1 transcription and neuronal hyperexcitability [48]. These epigenetic mechanisms complement the previously identified TRPV1-SP-macrophage axis. Specifically, DNA hypomethylation of the TRPV1 promoter enhances TRPV1 expression, facilitating SP release from DRG neurons. Additionally, downregulation of miR-146a leads to increased infiltration of M1 macrophages, a process that is reversed by THP through M2 macrophage polarization, indicating that THP may function as an epigenetic modulator by restoring miR-146a expression. Moreover, the TRPV1-SP-macrophage axis interacts with other emerging immune cell networks involved in CIBP, including T cells, neutrophils, and dendritic cells [10, 27]. The inhibition of TRPV1 by THP may thus exert indirect effects on T cell function, broadening its immunomodulatory impact beyond macrophages. Integrating these findings, our study highlights the complex interplay between epigenetic regulation and immune cell networks in CIBP, particularly focusing on the TRPV1-SP-macrophage axis.

Moreover, growing evidence indicates that CIBP is orchestrated by a complex interplay of ion channel activities. Research has demonstrated that histone modifications, along with the transcription factor Sp1, collaboratively enhance GPR160 expression, modulating CIBP in rodent models. This underscores the crucial role of chromatin remodeling and transcription factor-mediated gene regulation in this pathological condition [49]. In light of our findings on TRPV1-SP signaling, it is conceivable that this pathway is similarly influenced by such transcriptional regulatory mechanisms. For example, histone acetylation at the promoters of the TRPV1 or Tac1 genes (encoding substance P) may dynamically regulate their transcription in sensory neurons during CIBP, consequently affecting TRPV1 expression and substance P synthesis and secretion. Furthermore, transcription factors such as Sp1 might directly bind to the regulatory regions of TRPV1 or Tac1, modulating their expression and establishing a functional connection between the transcriptional machinery and TRPV1-SP signaling. Future research is necessary to identify the transcription factors targeting the Trpv1/Tac1 axis, which could confirm this regulatory crosstalk and potentially inform therapeutic strategies for CIBP.

CIBP comprises both inflammatory and neuropathic elements, with current research concentrating on the neuron-induced inflammatory component. Previous studies [50] have demonstrated that the activation of Toll-like receptor 4 (TLR4) by lysozyme can trigger pain via the TRIF-GOT2 pathway, independent of inflammation. This mechanism is particularly pertinent to the persistent neuropathic pain observed in advanced stages of CIBP. Future investigations will aim to further validate the regulation of the neuronal TLR4-TRIF pathway by THP, specifically assessing its capacity to inhibit GOT2 expression and glutamate release, elucidating its role in inflammation-independent CIBP. Moreover, phase-specific experiments and TLR4-knockout models will be employed to delineate THP's differential effects on the inflammatory and neuropathic components throughout the various stages of CIBP. This approach will provide a more comprehensive theoretical foundation for its potential clinical application in the management of complex cancer pain.

The translational potential of THP is supported by its established clinical profile. THP has a longstanding history of clinical application within both Traditional Chinese Medicine and contemporary pharmacotherapy, predominantly for the management of pain and anxiety [4, 51, 52]. This historical usage underscores its potential translational value in addressing CIBP. In China, THP is approved as a prescription medication, marketed under names such as "Levo-Tetrahydropalmatine Tablets," for the treatment of chronic pain conditions, including headaches, neuralgia, and visceral pain, as well as serving as an adjunct in opioid withdrawal therapy [4, 51, 53]. The analgesic properties of THP are attributed to its multifaceted mechanisms of action, notably including dopamine D2 receptor antagonism [54], as demonstrated in our study, modulation of the TRPV1-SP-macrophage axis. Importantly, THP has been employed off-label for the treatment of refractory pain conditions where conventional therapies, such as opioids and gabapentin, are either ineffective or poorly tolerated [3, 4]. This positions THP as a clinically relevant candidate for the management of CIBP.

Pharmacokinetic investigations have revealed that THP achieves peak plasma concentrations (Cmax) of approximately 1–5 μM in rodent models following oral administration at analgesic doses (e.g., 50–100 mg/kg) [3, 4], which is lower than the concentrations utilized in vitro in this study. THP is a lipophilic alkaloid characterized by its high tissue penetration capabilities, particularly within nervous and immune tissues pertinent to CIBP. In vivo studies indicate that THP may preferentially accumulate in the DRG, sciatic nerve, and tumor-bone microenvironment-areas associated with macrophage infiltration and TRPV1 expression. This accumulation results in local concentrations that surpass plasma levels [51, 55], suggesting that THP concentrations in the DRG or infiltrated macrophages may reach the levels used in our in vitro assays.

Clinically, THP demonstrates a favorable safety profile, with a minimal risk of addiction or tolerance, addressing a significant limitation of opioid therapies for CIBP [3, 4]. The most frequently reported adverse effects are mild and transient, such as dizziness, drowsiness, nausea, and constipation, which generally resolve with dose adjustments [4, 51]. Severe toxicity is uncommon but may occur at supra-therapeutic doses (exceeding 1000 mg/day), presenting as hypotension, bradycardia, or central nervous system depression [51]. Notably, THP does not exhibit known drug-drug interactions with commonly used chemotherapeutic agents or analgesics, such as gabapentin and non-steroidal anti-inflammatory drugs, supporting its potential application as an adjunctive therapy [4, 51]. In our preclinical study, we administered a THP dose of 80 mg/kg orally per day to mice. According to FDA conversion guidelines, this corresponds to a human equivalent dose of approximately 6.5 mg/kg/day, or roughly 455 mg/day for a 70 kg adult. This dosage falls within the established clinical dosing range of 200–600 mg/day. The concordance between the preclinical and clinical dosing underscores the pharmacological relevance of our preclinical findings to human applications, enhancing the translational potential of THP for the treatment of CIBP.

This study has several limitations. First, it was conducted exclusively in male mice, leaving potential sex-based differences unexplored. Second, the use of a single lung cancer cell line limits generalizability to other bone-metastasizing cancers. Third, while the chosen dose was effective and clinically relevant, a full dose–response relationship was not established. Fourth, some in vitro concentrations exceeded typical plasma levels, necessitating further pharmacokinetic studies to clarify tissue exposure. Fifth, our characterization of macrophage polarization relies on canonical surface markers and cytokine profiles without functional validation of macrophage activity; future work will integrate functional assays and scRNA-seq to capture the full complexity of macrophage activation in the CIBP microenvironment. Finally, the use of the RAW264.7 cell line, while informative, may not fully mirror primary macrophage behavior in the complex CIBP microenvironment. Despite these limitations, this work provides the first evidence for a dual-phase mechanism of THP in CIBP.

In conclusion, our study provides valuable insights into a novel mechanism by which THP alleviates CIBP. In the primary phase, it reduced macrophages migration via the TRPV1-SP pathway, while it directly impacts the infiltrated macrophage polarization in the both stages (Fig. 8). These findings not only enhance our understanding of the analgesic properties of THP but also suggest potential therapeutic strategies for the treatment of CIBP. Future studies could focus on further exploring the molecular details of THP's interactions with TRPV1-SP-macrophages, as well as evaluating the potential of THP in combination with other analgesic agents or cancer therapies. Additionally, translational studies are needed to determine the clinical applicability of THP in the management of CIBP.

Fig. 8.

The Mechanism of Tetrahydropalmatine in Mitigating Cancer-Induced Bone Pain. i. Primary phase (≤ 14 days): THP inhibits TRPV1 to reduce SP release from DRG neurons, suppressing macrophage recruitment to DRG and sciatic nerve. ii. Primary and advanced phases (> 14 days): THP directly promotes recruited macrophages to polarize toward the anti-inflammatory M2 phenotype, sustaining analgesic efficacy

Materials and methods

Animals

Our study was approved by the Animal Care and Use Committee at Nanjing University of Chinese Medicine (Approval No.: ACU230801 and 202501A033), Nanjing, China. All experimental procedures strictly adhered to the ethical guidelines for animal research established by the International Association for the Study of Pain.

Male C57BL/6 mice (8–9 weeks old, 20–25 g) were purchased from the Hangzhou Qizhen Experimental Animal Technology Co., Ltd (Hangzhou, Zhejiang, China; Certificate No.: SCXK [Zhe] 2022–0005). TRPV1-knockout (TRPV1-KO) mice (same age and weight range) were generously provided by Professor Qin Liu from the Department of Anesthesiology, Washington University School of Medicine (St. Louis, MO, USA), and were bred and maintained in the Specific Pathogen-Free (SPF) Animal Center of Nanjing University of Chinese Medicine.

Mice were housed in standard polycarbonate cages (4 mice per cage) in the SPF Animal Center of Nanjing University of Chinese Medicine. Housing conditions were strictly controlled: temperature maintained at 22 ± 2 °C, relative humidity at 50 ± 10%, and a 12-h light/dark cycle (lights on from 06:00 to 18:00). Mice had ad libitum access to sterile standard chow and filtered water. Only mice with normal physiological status (regular food/water intake, no abnormal behavior or lesions) were selected for experiments.

Personnel conducting behavioral assays were blinded to experimental groups. Prior to CIBP modeling, all mice were acclimated to the behavioral testing room for 2 days, during which baseline pain thresholds were measured to ensure consistency across groups.

The surgery of cancer induced bone pain

Mice were anesthetized with 1% pentobarbital sodium (50 mg/kg, intraperitoneal) as we did previously [18, 56]. Vet ointment was applied to their eyes, then they were placed supine on a fixation plate with the right limb free. The knee area was cleaned with 75% ethanol and shaved. A 0.5 cm longitudinal incision was made over the knee joint, and the patellar ligament was either cut or left intact. The intercondylar fossa was exposed, and a hole was drilled along the femur axis. 10 µl of lung cancer cells (1 × 10⁶ cells/10 µl media, Cell bank of the Chinese Academy of Sciences, TCM7) were injected into the medullary cavity. The needle hole was sealed with bone wax and monitored for 2 min. The wound was stitched, sterilized, and treated with roxithromycin ointment. Animals were monitored until anesthesia recovery and then placed supine in a clean cage.

Investigation of drug dosage and duration of analgesic effect

Seven days following the establishment of the model, the mice in the dosage groups were given THP (Macklin, T818625) treatment. Subsequently, their mechanical pain thresholds were evaluated 1 h post-administration. In the case of the time group, the mechanical pain thresholds of the mice were measured at specific time intervals, namely 0.5 h, 1 h, 1.5 h, 2 h, and 2.5 h, after the administration of THP at a dosage of 80 mg/kg.

Behavioral tests

All behavioral tests were conducted under strictly consistent environmental conditions to eliminate potential confounding factors from lighting, noise, and circadian rhythm. Specifically, the behavioral testing room was maintained at a constant temperature (22 ± 2 °C) and humidity (50 ± 10%). Lighting was set to a fixed intensity of 300 lx using full-spectrum LED lights to avoid light-induced behavioral bias. Noise levels were controlled below 40 dB by prohibiting unnecessary personnel movement during the tests. All behavioral assessments were performed between 9:00 AM and 12:00 PM daily to minimize the impact of circadian fluctuations on animal/participant activity.

Assessment of analgesic effect

Seven days subsequent to the establishment of the model, the mice within the model group were orally administered with an equal volume of solvent, while those in the drug-administered group received THP at a dosage of 80 mg/kg, and the mice in the positive drug group were given GBPT (Gabapentin, Aladdin, G122413) at a dose of 200 mg/kg, respectively. The administration process was carried out at a consistent and predetermined time each day, continuing until the culmination of the 21-day model period. Prior to the initiation of the modeling procedure, the baseline pain thresholds for all groups were precisely measured. Subsequently, comprehensive behavioral evaluations were systematically conducted on the 1st, 4th, 7th, 10th, 13th, 16th, and 19th days following the establishment of the model.

Von-frey

Prior to behavioral tests, animals were placed on a 100 cm × 50 cm elevated metal grid for 30 min to acclimate. To measure mechanical allodynia, the paw withdrawal threshold was determined using 0.04–2 g Aesthesio von Frey filaments (Ugo Basile) as we did previously [13, 37]. Filaments were applied vertically on the paw's plantar surface, pressed upwards until bent 90◦ for up to 3 s. If no withdrawal, a larger filament was used. The 50% withdrawal threshold was calculated via the established up-down method for quantifying mechanical allodynia.

Hargreaves test

Thermal hyperalgesia was measured by the paw withdrawal latency to radiant heat as did before [37, 56]. Mice were placed in a 4.5 cm × 3 cm × 10 cm transparent box on a glass platform (Plantar Test 37370, Ugo Basile). After a 30-min acclimation, the heat source was aimed at the hind paw's plantar center. With at least 3-min intervals between applications, the timer started with the heat and stopped when the paw was withdrawn. A foot lift was a positive response. Each mouse was measured 3 times, and the average latency was recorded as the thermal withdrawal latency for better accuracy.

Cold pain test

Cold pain test was conducted as shown previously [57, 58]. In short, before cold plate tests, mice acclimated for 30 min. When the device cooled to 4 °C, a mouse was placed on it. The device has a lid, 405 mm × 122 mm testing chamber, and 250 mm × 280 mm × 150 mm cube box. Foot lifts within 5 min counted as the cold pain response index.

CT scanning

Bone destruction in mice after CIBP surgery was assessed via X-ray micro-CT scanning of the hindlimbs using a SkyScan1176 scanner (Bruker, Germany) as before [18]; mice were anesthetized during scanning to ensure imaging stability, and all scan data were recorded for subsequent analysis.

Immunofluorescence staining

Frozen tissue slices were fixed using paraformaldehyde as we did before [58, 59]. Subsequently, the slices underwent permeabilization and blocking procedures. They were then incubated overnight with anti-F4/80 antibody (1:200; catalog number 41–4801-82, Invitrogen), anti-NeuN (1:200; catalog number AB236870, Abcam), or anti-NEFH (1:200; catalog number 13–1300, Invitrogen). Next, the slices were incubated with fluorescent secondary antibodies (1:200, A0423, A0428, Beyotime) for 1 h at 37 °C. Following this, the slices were labeled with DAPI. Finally, the immunofluorescence signals were visualized under a fluorescence microscope.

Realtime-PCR

RNA was extracted from DRG tissue, tumor tissue, sciatic nerve, or cultured RAW 264.7 cells using Trizol reagent (Vazyme, Nanjing, China) following the manufacturer’s instructions. Subsequently, cDNA was synthesized by means of the HiScript II Q RT SuperMix kit (also from Vazyme, Nanjing, China). To quantify the relative gene expressions, the SYBR Green Mix (produced by Yeasen) was employed. The specific qPCR primers utilized in this study are presented as follows (Table 1).

Table 1.

Primers

Gene	Primers
GAPDH	Primier-F AGGTCGGTGTGAACGGATTTG
	Primier-R TGTAGACCATGTAGTTGAGGTCA
F4/80	Primier-F CTTTGGCTATGGGCTTCCAGTC
	Primier-R GCAAGGAGGACAGAGTTTATCGTG
IL-1β	Primier-F TGGACCTTCCAGGATGAGGACAAG
	Primier-R GGAGGCAGGATGAGGTTTCA
TNF-α	Primier-F CCCAGGGACCTCTCTCTAATC
	Primier-R ATGGCTACAGGCTTGTCACT
CD206	Primier-F GGAATCAAGGGCACAGAGTTA
	Primier-R ATTGTGGAGCAGATGGAA
IL-4	Primier-F GGTCTCAACCCCCAGCTAGT
	Primier-R GCCGATGATCTCTCTCAAGTGAT
IL-10	Primier-F GCAACAGAACATCAATAGTCCTT
	Primier-R CACCCTTTTCCTTCATCTTTTCA
Tac1	Primier-F TGCTCCCACTCCATTCTCAGACC Primier-R ACCAGGTCGAACACTTCTCCAAAC

ELISA

Tissue Sample Processing: DRGs and tumor tissues were snap-frozen in liquid nitrogen and homogenized in ice-cold phosphate-buffered saline (PBS, pH 7.4) using a mechanical homogenizer. Homogenates were centrifuged at 2500 g for 20 min at 4 °C, and supernatants were collected for analysis. ELISA measurements from tissue lysates reflect total content within the samples. Cell Culture Experiments: For conditioned medium analysis, cells were stimulated as described (e.g., with THP, capsaicin, or vehicle), and the medium was collected after incubation (24 h at 37 °C). Cellular debris was removed by centrifugation (1000 g, 10 min), and supernatants were assayed via ELISA to quantify released neuropeptides/chemokines. The assays were carried out using specific ELISA kits, including the Mouse IL-1β ELISA Kit (Elabscience, catalog number E-EL-H0149c), the Mouse TNF-α ELISA Kit (Elabscience, E-EL-M3063), the Mouse IL-4 ELISA Kit (Elabscience, E-EL-M0043c), the Mouse IL-10 ELISA Kit (Elabscience, E-EL-M0046c), and the Mouse SP ELISA Kit (mlbio, YJ001885). All ELISA experiments were performed according to the manufacturer’s instructions. Each sample was analyzed in triplicate, and experiments were repeated at least three times to ensure accuracy and reproducibility.

Primary DRG neurons preparation and culture

DRG neurons were prepared as before [37]. DRGs were collected and incubated for 30 min at 37 °C in a digestion solution containing 5 mg/ml dispase (Gibco, 17,105,041) and 1 mg/ml collagenase I (BioFroxx, 1904GR01). The resulting suspension was filtered, centrifuged, and the neurons were resuspended in DH10 medium (DMEM/F-12 from Invitrogen, 10% FBS from Gibco, and 1% penicillin–streptomycin-glutamine from Yeasen). Finally, the neurons were cultured in DH10 medium with 50 ng/ml nerve growth factor (Sigma) in an incubator for calcium imaging within 24 h.

RAW264.7 cells culture

RAW264.7 macrophage cells were cultured in complete DMEM-H medium (10% FBS, 1% penicillin–streptomycin) in a humidified incubator at 37 °C with 5% CO₂.

Trans-well experiment

Raw 264.7 cells were cultured in complete medium until 80–90% confluence was achieved. The cells were rinsed gently, detached with trypsin–EDTA, centrifuged at 300 × g for 5 min, and resuspended in serum-free medium to a density of 1 × 10⁶ cells/mL. Transwell inserts (Cat. No. 14341-D, LABSELECT) were placed into a 24-well plate. Subsequently, 600 μL of medium containing substance P (SP, 100 nM or 200 nM, CAS No. 33507–63-0, Merck) was added to the lower chamber, and 200 μL of the prepared cell suspension (corresponding to 2 × 10⁵ cells) was seeded into the upper chamber. The plate was incubated at 37 °C with 5% CO₂ for 24 h. After incubation, the inserts were removed; non-migrated cells on the upper surface of the membrane were wiped off gently. The migrated cells were stained with 0.1% crystal violet solution for 20 min, rinsed thoroughly with PBS, imaged under an inverted microscope (10 random non-overlapping fields per insert), and the number of migrated cells was quantified using ImageJ software.

Calcium imaging

The cultured DRG neurons were incubated with Fura-2AM (Sigma, 47,989) for a period of 17 min to allow for the loading of the calcium indicator. Subsequently, calcium influx image acquisition and detailed analysis were carried out using an Olympus microscope, which is renowned for its high-resolution imaging capabilities and precise optical performance. The cells were then stimulated with capsaicin (500 nM, 211275, Sigma) to specifically induce TRPV1-dependent Ca²⁺ influx signals. During the imaging process, the ratio of fluorescence intensities at 340 nm and 380 nm was recorded. Ratio images were analyzed to quantify changes in Ca²⁺ responses as previously described [58].

Cell coculture and drug administration

LLC cells cultured for 24 h, supernatant of LLC cells (SL) collected and filtered (0.22 μm), stored at −20 °C. RAW 264.7 cells in 6-well plate, 3 groups (blank, stim with 0%, 10%, 50% SL; drug with 10 μM, 50 μM, 100 μM THP). Incubated 24 h to select optimal stim & drug conc. RAW 264.7 cells in 6-well plate, 4 groups (Control, THP, SL, SL + THP), 3 wells/group. Overnight culture, then replaced with respective media (Control: complete; THP: 100 μM THP; SL: 50%; SL + THP: 100 μM THP + 50% SL). Incubated 24 h for indicator measurement.

CCK8 test

RAW264.7 cells were seeded at 1 × 10⁴/well in 100 μL into a 96-well plate. Set control and drug-treated groups, 6 wells each (30 wells total). Incubate at 37 °C with 5% CO₂ for 24 h. Replace medium with blank or 25–200 μM THP-containing media. Incubate again for 24 h. Add 10 μL CCK-8, incubate 1–4 h. Measure absorbance at 450 nm to assess cell viability and THP effect.

Cell flow cytometry

To detect M2 macrophages, RAW 264.7 cells were digested with 0.02% EDTA and collected, then washed with cell staining buffer. A Mouse CD16/32 Fc blocker (Invitrogen, 14–9161-73, 1:100) was added and incubated on ice for 10 min. Next, PE anti-mouse CD206 antibody (BioLegend, 141706, 1:100) was added and incubated for 30 min. After washing, cells were passed through a 300-mesh screen into a flow cytometry tube. Finally, fluorescence intensity was detected by flow cytometry to quantify the M2 macrophage proportion and assess macrophage polarization.

Statistical analysis

Data are presented as mean ± SD. Statistical comparisons are performed using unpaired t test or ANOVA (SPSS version 16.0) followed by post hoc analysis (All the data presented conformed to a normal distribution). The difference is considered statistically significant at p < 0.05.

Abbreviations

Cap

Capsaicin

CIBP

Cancer-induced bone pain

THP

Tetrahydropalmatine

DRG

Dorsal root ganglia

SP

Substance P

TRPV1

Transient receptor potential vanilloid 1

WT

Wild type

TRPV1-KO

TRPV1 knockout

IL-1β

Interleukin-1β

TNF-α

Tumor necrosis factor-α

IL-4

Interleukin-4

IL-10

Interleukin-10

SL

Supernatant of LLC cells

TNF-α

Tumor necrosis factor-α

BDNF

Brain-Derived Neurotrophic Factor

CD206

Mannose Receptor C Type 1

iNOS

Inducible Nitric Oxide Synthase

NGF

Nerve Growth Factor

Tac1

Tachykinin Precursor 1

GBPT

Gabapentin

Author contributions

Zhang Qing, Chen Ziyun and Qingyong Yu: methodology. Wang Hanwen, Yucui Jiang, Lan Zhou, Yu Guang: supervision. Zongxiang Tang: conceptualization. Changming wang: conceptualization, Writing-review & editing, Visualization, Supervision, Resources, Project administration, Investigation, Funding acquisition, Formal analysis. All authors have read and approved the article, and agree to be accountable for all aspects of this work.

Funding

This work was supported by the National Natural Science Foundation of China C-MW (82474211), the Development Plan of Traditional Chinese Medicine Science and Technology in Jiangsu Province C-MW (MS2024002) and a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (Integrated Traditional Chinese and Western), the Open Project of Chinese Materia Medica First-Class Discipline of Nanjing University of Chinese Medicine (026062024001), the Innovation Projects of State Key Laboratory on Technologies for Chinese Medicine Pharmaceutical Process Control and Intelligent Manufacture (NZYSKL240105).

Data availability

The data produced or assessed in the present study are included in the published article and the associated supplementary data. The data are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Our study was approved by the Animal Care and Use Committee at Nanjing University of Chinese Medicine, Nanjing, China (ACU230801 and 202501A033). All experimental procedures were carried out in strict accordance with the animal research ethical guidelines established by the International Association for the Study of Pain. Our study was initially approved by the Animal Care and Use Committee at Nanjing University of Chinese Medicine (Approval No.: ACU230801) in 2023. Upon expiration of this approval in 2025, a renewal application was approved (Approval No.: 202501A033) to cover the final experimental phases. All procedures strictly followed the ethical guidelines for animal research established by the International Association for the Study of Pain.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.