Skip to main content
Cellular Oncology logoLink to Cellular Oncology
. 2022 Apr 11;45(2):293–307. doi: 10.1007/s13402-022-00669-6

FBXO32 targets PHPT1 for ubiquitination to regulate the growth of EGFR mutant lung cancer

Ning Zhang 1,#, Yifeng Liao 2,#, Weize Lv 2,#, Shunda Zhu 3, Yeqing Qiu 2, Nan Chen 2, Mei Xiao 2,, Hongyu Zhang 2,
PMCID: PMC12978113  PMID: 35411430

Abstract

Background

Phosphohistidine phosphatase 1 (PHPT1) is an oncogene that has been reported to participate in multiple tumorigenic processes. As yet, however, the role of PHPT1 in lung cancer development remains uncharacterized.

Methods

RNA sequencing assay and 18 pairs of tumor and normal tissues from patients were analyzed to reveal the upregulation of PHPT1 in lung cancer, followed by confirming the biological function in vitro and in vivo. Next, Gene Set Enrichment Analysis, lung cancer samples, apoptosis assay, mass spectrometry experiments and western blotting were used to investigate the molecular mechanism underlying PHPT1 driven progression in epidermal growth factor receptor (EGFR)-mutant lung cancer. Finally, we performed cellular and animal experiments to explore the tumor suppressive function of F-box protein 32 (FBXO32).

Results

We found that PHPT1 is overexpressed in lung cancer patients and correlates with a poor overall survival. In addition, we found that the expression of PHPT1 is elevated in EGFR-mutant lung cancer cells and primary patient samples. Inhibition of PHPT1 expression in EGFR mutant lung cancer cells significantly decreased their proliferation and clonogenicity, and suppressed their in vitro tumor growth. Mechanistic studies revealed that activation of the ERK/MAPK pathway is driven by PHPT1. PHPT1 is required for maintaining drug resistance to erlotinib in EGFR mutant lung cancer cells. We found that FBXO32 acts as an E3 ubiquitin ligase for PHPT1, and that knockdown of FBXO32 leads to PHPT1 accumulation, activation of the ERK/MAPK pathway and promotion of the proliferation, clonogenicity and growth of lung cancer cells.

Conclusions

Our findings indicate that PHPT1 may serve as a biomarker and therapeutic target for acquired erlotinib resistance in lung cancer patients carrying EGFR mutations.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13402-022-00669-6.

Keywords: Lung cancer, EGFR, PHPT1, FBXO32, E3 ubiquitin ligase, Drug resistance, ERK/MAPK pathway

Introduction

Lung cancer remains the leading cause of cancer-related mortality worldwide, with 2.1 million newly diagnosed cases (11.6% of total cases) and 1.8 million deaths (18.4% of total cancer deaths) annually [1, 2]. The pathogenesis of lung cancer involves the deregulation of one or more genes related to cell growth, apoptosis, invasion and metastasis [3]. Autoantibodies (AAbs) have been found to be present in all histological types and disease stages of lung cancer. Therefore, AAb panels may serve as specific, but not sensitive biomarkers [4, 5]. As yet, three proteins (CEA, CA-125 and CYFRA 21–1) and one AAb (NY-ESO-1) have been identified as biomarkers for the early detection of lung cancer [6]. More recently, DNA methylation (i.e., SOX2 and PTGER4), circulating tumor DNA (ctDNA) and circulating microRNAs (miRNAs) have emerged as potential biomarkers for cancer diagnosis, tumor staging and prognosis [712]. In addition, multiple epigenetic alterations have been reported to play key roles in the multistep process of lung cancer development [3]. Although ample efforts have been made to decrease the lethality of lung cancer, its recurrence is still unsatisfactory with a 5-year rate of up to 70% [13]. In order to develop more effective treatments it is, therefore, imperative to identify novel genes and pathways that are closely related to the progression of lung cancer.

Phosphohistidine phosphatase 1 (PHPT1), also known as PHP14 and identified by Ek et al., was the first histidine phosphatase protein discovered in vertebrates and shows similarity to the Janus proteins of Drosophila [14, 15]. A previous study reported that PHPT1 is part of a specific phosphatase family whose members exhibit phosphatase activity against proteins and peptides containing phosphohistidine [16]. Among all phosphorylation modifications, only 7% comprises histidine phosphorylations, and they play a role in signal transduction in cancer. A recent report has shown that PHPT1 functions as a negative regulator of CD4+ T lymphocytes by dephosphorylating and inhibiting KCa3.1 [17]. PHPT1 has been identified as an oncogene in lung cancer cells partly through actin cytoskeleton rearrangement modulation [18]. Moreover, PHP14 has been identified as a mediator of TGF-β1 signal transduction through the PI3Kγ/AKT/Rac1 pathway in liver fibrosis [19]. In this study, we report that elevated PHPT1 expression indicates a poor prognosis in lung cancer and results in MAPK signaling pathway activation.

The extracellular signal-regulated/mitogen-activated protein kinase (ERK/MAPK) pathway is a conserved pathway that regulates proliferation, apoptosis, differentiation, invasion and migration by converting stimuli from the cell surface to the intracellular compartment [20, 21]. The ERK/MAPK pathway may be activated by upstream genomic events or multiple signaling cascades, such as the protein kinase B/mammalian target of rapamycin (AKT/mTOR) cascade [22]. It has been reported that the ERK/MAPK pathway may function as a tumor suppressor by inducing senescence, ubiquitination and the degradation of proteins necessary for cell survival and activity [21]. Overactivation of the ERK/MAPK pathway leads to tumorigenesis, making it a promising target for anticancer therapeutics.

In this study, we show that PHPT1 is upregulated in lung cancer, and that a high expression of PHPT1 is correlated with a poor survival. PHPT1 is particularly highly expressed in EGFR mutant lung cancer cells (NCI-H1975-EGFR/T790M and NCI-H3255-EGFR/L857R) compared to wild-type human bronchial epithelial cells (Beads-2b). Consistently, we found by immunohistochemistry that PHPT1 expression in EGFR mutant lung cancer tissues is significantly higher than that in EGFR wild type lung cancer tissues. PHPT1 silencing inhibited the proliferation, clonal growth and tumorigenicity of EGFR mutant lung cancer cells. Our results also indicate that PHPT1 may regulate the progression of lung cancer by activating the ERK/MAPK pathway and that PHPT1 is required for maintaining drug resistance to erlotinib in EGFR mutant lung cancer cells. Furthermore, we found that FBXO32 acts as an E3 ligase for PHPT1. Knockdown of FBXO32 expression led to PHPT1 accumulation and activation of the ERK/MAPK pathway, thereby accelerating lung cancer cell proliferation and tumor growth. Our data indicate that PHPT1 may be critical for lung cancer progression and may serve as a therapeutic target.

Material and methods

Lung cancer samples

The study was approved by the Medical Research Ethics Committee of the Fifth Affiliated Hospital of Sun Yat-sen University, and informed written consent was obtained from all participants. Tissue samples were collected from primary tumors and adjacent lung tissues of patients who underwent surgical resection at the Fifth Affiliated Hospital of Sun Yat-sen University between 2018 and 2020. The tissues were reviewed by a pathologist and immediately frozen and stored at − 80 °C until use. The lung cancer patients were diagnosed at the Fifth Affiliated Hospital of Sun Yat-sen University and did not receive chemotherapy and/or radiotherapy prior to surgery.

RNA sequencing and gene set enrichment analysis (GSEA)

Three paired lung cancer samples and normal lung samples (adjacent to the tumor) were collected and stored in liquid nitrogen. RNA degradation and contamination was monitored on 1% agarose gels, and RNA purity was checked using a NanoPhotometer® spectrophotometer (IMPLEN, CA, USA). RNA integrity was assessed using a RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input for sample preparations. Sequencing libraries were generated using a NEBNext® UltraTM RNA Library Prep Kit from Illumina® (NEB, USA) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. Clustering of the index-coded samples was performed on a cBot Cluster Generation System using a TruSeq PE Cluster Kit v3-cBot-HS (Illumia) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina Novaseq platform after which 150 bp paired-end reads were generated, followed by quality control, read mapping to the reference genome, quantification of gene expression levels and differential expression analysis. Differential expression analysis (two biological replicates per condition) was performed using the DESeq2 R package (1.24.0). The resulting p-values were adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate (FDR). Genes with an adjusted p-value < 0.05 as determined by DESeq2 were assigned as differentially expressed. KEGG is a database resource for understanding high-level functions and utilities of biological systems using molecular-level information, especially large-scale molecular datasets generated by genome sequencing and other high-throughput technologies (http://www.genome.jp/kegg/). We used the clusterProfiler R package (3.12.0) to test statistical enrichment of differentially expressed genes in KEGG pathways. For transcriptome sequencing, FPKM (fragments per kilobase of exon per million mapped fragments) was used.

Cell lines and culture conditions

The cell lines we used were purchased from the American Type Culture Collection (ATCC) and Xuanwei Technology company. The cells were cultured according to ATCC guidelines and identity confirmed by short tandem repeat (STR) profiling by the China Type Culture Collection Center (Wuhan University). No mycoplasma infection was detected. All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (Gibco) at 37 ℃ and 5% CO2.

Cell counting kit-8 viability assay

A cell counting kit-8 assay was used to determine the viability of lung cancer cells. Briefly, NCI-H1975 and NCI-H3255 cells were seeded in 96-well plates at a density of 3000 cells per well. The cells were incubated with a mixture of CCK-8 (10 µl, Tokyo, Japan) and 100 µl serum-free DMEM for 3 h, after which the optical density value (OD value) was measured at an absorbance of 450 nm using a spectrophotometric reader from Thermo Fisher Scientific (Waltham, MA, USA) once per day for 4 days. The experiments were performed three independent times, and the results are presented as the mean ± SD.

Colony formation assay

Lung cancer cells were seeded into 6-well plates precoated with 0.6% agarose in DMEM with 10% FBS. The cells were subsequently incubated at 37 °C and 5% CO2 for 10 days after which colonies were stained with 0.05% crystal violet in PBS for 30 min and photographs of the colonies were captured. The experiments were performed in duplicate.

Flow cytometric apoptosis assay

Stable cells were trypsinized with 0.25% trypsin (ethylenediaminetetraacetic acid free, Thermo, USA) at 4 °C and centrifuged at 600 r/min for 5 min, after which the supernatants were discarded. Next, the cells were gently washed and resuspended in cold PBS three times. Annexin-V-fluorescein isothiocyanate (FITC)/PI dye was added to annexin-V-FITC, PI and HEPES buffer solution at 1:2:50 based on the instructions of the annexin-V-FITC apoptosis detection kit (K101–100, Biovision, CA, USA). Then, 100 µl dye was resuspended with 1 × 106 cells, mixed gently and incubated for 20 min. Finally, 1 ml HEPES buffer solution was added and the samples were mixed again. FITC and PI fluorescence were separately analyzed by bandpass filters at 515 nm and 620 nm after excitation at 488 nm, and apoptosis was evaluated by flow cytometry (Beckman Coulter, CA, USA).

shRNA-mediated PHPT1 and FBXO32 knockdown

We used two short hairpin RNAs targeting human PHPT1 that reduced its mRNA level by > 70%. NCI-H3255, NCI-H1975, NCI-H292 and A549 cells were infected with culture medium containing 2 ml lentivirus, 200 μl FBS and 5 mg/ml polybrene (Thermo) for 48 h at 37 °C. Next, the infected cells were subjected to several days of puromycin selection. The targeting sequences were: shPTPT1#1: CGTCTTCAAGTATGTGCTGAT; shPHPT1#2: CATGCGGACATCTACGACAAA; shFBXO32#1: GATACCCTTCAGCTCTGAAA; shFBXO32#2: CTGCCATTCTGGATTCCAGAA.

Protein mass spectrometry (MS)

Briefly, NCI-H1975 cells were transfected to express Flag-tagged PHPT1. Next, the cells were lysed in NETN buffer containing 15 mmol/L NaF, 60 mmol/L β-glycerophosphate and 1 mg/ml each of pepstatin A and aprotinin. After removal of the debris the lysates were incubated with Flag-conjugated beads at 4 °C for 4 h. Then, the beads were washed with NETN buffer 5 times, after which the bound proteins were analyzed by SDS-PAGE, and protein mass spectrometry was performed by PTM BioLabs. The immunocomplexes were washed four times with NETN buffer and analyzed using SDS-PAGE and Western blotting.

Immunoprecipitation assay

Cells containing the indicated constructs were lysed in lysis buffer with protease inhibitor cocktails (Thermo). After removal of the debris by centrifugation, the lysates were immunoprecipitated with the corresponding beads at 4 °C for 3 h with constant mixing. Next, the precipitates were subjected to SDS-PAGE and the proteins detected by immunoblotting using the indicated antibodies.

Western blot assay

After collection, the cells were washed with prechilled PBS and placed on ice. Next, RIPA buffer containing 1% protease inhibitors was added to lyse the cells for 30 min. After centrifugation at 12,000 rpm for 30 min, the supernatants were carefully aspirated, and the protein concentrations determined using the BCA method. The protein concentrations were adjusted to the same concentration with RIPA buffer, after which 5 × loading buffer was added. The mixtures were placed in a metal bath at 100 ℃ for 10 min, after which 20 μg total protein was loaded and separated on a 10% sodium dodecyl sulfate–polyacrylamide gradient gel. Next, the proteins was transferred onto PVDF membranes and blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature. Finally, the membranes were incubated with primary and secondary antibodies and assessed using an ECL chemiluminescence system (Bio–Rad).

Xenograft lung cancer model

Four- to five-week-old male BALB/c nude mice were used for the xenograft experiments. NCI-H1975 cells (5 × 106) subjected to different treatments were suspended in PBS and inoculated subcutaneously into the flank of the nude mice (six mice per group). After 21 days the mice were euthanized and the tumors were excised and measured.

Statistics analysis

SPSS software version 21.0 (IBM Corp. Armonk, NY, USA) was used to perform all statistical analyses. Student’s t test was used to analyze comparisons between two groups. The data are presented as mean ± standard deviation. A p value < 0.05 was considered statistically significant. * represents p ≤ 0.05, ** represents p ≤ 0.01, *** represents p ≤ 0.001, **** represents p ≤ 0.0001, ns: no significant differences.

Results

PHPT1 is upregulated in lung cancer and correlates with a poor prognosis

To genetically dissect the contribution of PHPT1 to lung cancer development, we performed RNA sequencing and found that there was a significant difference in gene expression between lung cancer tissues and paired normal lung tissues. Specifically, we found that lung tumors had high expression of PHPT1 (Fig. 1a-b). To further verify PHPT1 expression, we next assessed its expression directly in lung tumor tissues and normal lung tissues. Western blot analysis of 18 paired lung cancer-normal samples revealed that the expression of PHPT1 was significantly higher in lung cancer tissues than in normal control tissues (Fig. 1c-e). We next used Kaplan–Meier plotter databases [23] to analyze the impact of PHPT1 expression on the overall survival of lung cancer patients. We found that upregulation of PHPT1 correlated with a poor overall survival (Fig. 1f). Together, these data indicate that PHPT1 expression is increased in lung cancer patients and correlates with a poor prognosis, suggesting that PHPT1 may serve as a potential prognostic marker for lung cancer.

Fig. 1.

Fig. 1

Identification of PHPT1 as a marker of poor prognosis in lung cancer. (a) Heatmap displaying positive fold changes (FC) in the expression of genes of interest in lung cancer tissues versus normal lung tissues. (b) Volcano plot displaying the genes that were significantly regulated (p < 0.05) in lung cancer tissues. (c-e) 18 pairs of lung cancer tissues and normal lung tissues analyzed by Western blotting; the groupings of bands are from three gel slices. (f) Relationship of PHPT1 expression with survival and prognosis of lung cancer patients

PHPT1 knockdown in EGFR mutant lung cancer cells inhibits their proliferation and tumorigenicity

To further assess PHPT1 regulation in lung cancer cell lines (including EGFR-WT and EGFR mutant cells), we performed Western blot analysis and found that PHPT1 was overexpressed in EGFR mutant cells (especially in NCI-H1975 and NCI-H3255) (Fig. 2a). The EGFR status of 18 paired lung cancer samples shown in Fig. 1c-e is provided in supplementary information (Table 1). Overall, we found that the expression of PHPT1 in EGFR mutant samples was higher than that in EGFR-WT samples. Further analysis of 17 EGFR-WT lung cancer samples, 8 EGFR-19Del lung cancer samples, 8 EGFR-L857R lung cancer samples and 7 EGFR-19Del and EGFR-L857R lung cancer samples underscored the notion that EGFR mutant lung cancer tissues exhibit high PHPT1 expression levels (Fig. 2b-c). To assess the contribution of PHPT1 to tumorigenicity, we used two short hairpin PHPT1 targeting RNAs (shRNAs) to knock down its expression in NCI-H1975 and NCI-H3255 cells. We found that PHPT1 knockdown significantly inhibited the proliferation of both cell lines (Fig. 2d-e). Next, we performed Transwell experiments using NCI-H1975 and NCI-H3255 cells and found that PHPT1 knockdown decreased their clonogenicity (Fig. 2f-i). To assess the in vivo functional contribution of PHPT1 to tumorigenesis, we performed lung cancer xenograft mouse model experiments (n = 6 biologically independent mice). To this end, PHPT1 knockdown NCI-H1975 cells were implanted subcutaneously into nude mice. We found that three weeks after implantation the average weight of the tumors was significantly decreased in mice bearing PHPT1 knockdown cells compared to those of the control group (p < 0.001, Fig. 2j-k). Overall, these results suggest that PHPT1 may play an important role in the progression of EGFR mutation-positive lung cancer.

Fig. 2.

Fig. 2

PHPT1 suppresses viability and tumorigenicity of EGFR mutant lung cancer cells. (a) Western blot analysis of lung cancer cell lines using anti-PHPT1 and anti-EGFR antibodies. (b-c) Representative images of PHPT1 IHC staining of EGFR-WT and EGFR-mutant lung cancer tissues. Scale bars, 50 μm. H scores were obtained using Image Pro Plus 5.0. (d-e) Cell counting kit-8 analysis of PHPT1 knockdown in NCI-H1975 and NCI-H3255 cells using two pairs of shRNAs in three independent experiments. (f–h) Clone formation analysis using the indicated PHPT1 knockdown cells. (g-i) Quantification of clones. (j-k) Weights of NCI-H1975 lung cancer tumors of shRNA targeted and control groups. The indicated cells were subcutaneously injected into BALB/C mice (n = 6). Data are shown as the mean ± SD and the experiments were repeated 3 times. ** p < 0.01, *** p < 0.001 using a two-sided Student’s t test. NS, no significance

Activation of the ERK/MAPK signaling pathway is driven by PHPT1 expression in EGFR mutant lung cancer

To further assess the mechanism by which PHPT1 promotes the progression of lung cancer, we performed GSEA of data from the TCGA database, and found that the MAPK signaling pathway was significantly activated (Fig. 3a). The ERK/MAPK pathway is known to be one of the most important oncogenic pathways affecting various cellular processes, including growth, proliferation, migration, differentiation, survival, apoptosis and transformation [24, 25]. Since the ERK/MAPK pathway is also known to be involved in the progression of malignant cancer [26], we sought to investigate the functional effect of PHPT1 on lung cancer cells with involvement of the ERK/MAPK signaling pathway. We found that activation of the ERK/MAPK pathway induced the phosphorylation of ERK (p44/42) and MEK [27]. PHPT1 knockdown in EGFR mutant lung cancer cell lines increased the phosphorylation levels of ERK and MEK, while no significant differences in total ERK and MEK expression levels were observed (Fig. 3b-c). Next, we performed Western blotting to assess the expression of downstream factors in EGFR mutant lung cancer samples. We found that the expression of PHPT1 was positively correlated with the phosphorylation levels of ERK and MEK (Fig. 3d-e). We also found that upregulation of PHPT1 in primary lung cancer tissues increased the phosphorylation of ERK and MEK, and that the phosphorylation levels of ERK and MEK were positively correlated (Fig. 3f-h). We further investigated how PHPT1 affects cell survival, and found that lung cancer cells were more likely to undergo apoptosis in the PHPT1 knockdown group than in the control group (Fig. 3i-k). Taken together, our data indicate that PHPT1 functions as an oncogene by activating the ERK/MAPK pathway in EGFR mutant lung cancer.

Fig. 3.

Fig. 3

PHPT1 activates the ERK/MAPK pathway in lung cancer cells. (a) Diagram of the upregulated MAPK pathway in lung cancer samples. p < 0.01. (b-c) Western blot analysis of the indicated PHPT1 knockdown cells using anti-PHPT1, anti-p-ERK, anti-t-ERK, anti-p-MEK and anti-t-MEK antibodies. (d-e) Seventeen lung tumor samples were subjected to Western blot analysis using anti-PHPT1, anti-p-MEK and anti-p-ERK antibodies. (f–h) Quantification of Western blot bands using ImageJ. (f) Relationship between p-MEK and p-ERK expression examined using Pearson chi-squared tests, Pearson r = 0.89, p < 0.0001. (g) Relationship between p-ERK and PHPT1 expression examined using Pearson chi-squared test, Pearson r = 0.81, p < 0.0001. (h) Relationship between p-ERK and PHPT1 expression examined using Pearson chi-squared test, Pearson r = 0.62, p = 0.073. (i-k) Death of the indicated lung cancer cells (NCI-H1975 and NCI-H3255) measured by flow cytometry. Data analysis was performed using SPSS 20.0. Data are shown as the mean ± SD and the studies were repeated in three independent experiments

PHPT1 is required for maintaining resistance to erlotinib in EGFR mutant lung cancer cells

Acquired drug resistance is the foremost challenge for patients with advanced stage malignancies [28]. Ample evidence from both experimental and clinical studies indicates that in a large proportion of EGFR-mutant NSCLC cases an EGF T790M mutation can cause drug resistance. The presence of this mutation has been found to be correlated with sensitivity to EGFR tyrosine kinase inhibitors (TKIs) and to alter drug binding and enzymatic activity of mutant EGF receptors after treatment with first-generation EGFR TKIs (such as erlotinib and gefitinib) [29, 30]. To investigate whether PHPT1 is involved in the development of drug resistance, we treated the EGFR-WT lung cancer cell lines HCI-H292 and A549 with 100 ng/ml EGF. We found that the phosphorylation of ERK and MEK was increased by EGF, while no such phosphorylation was observed in PHPT1 knockdown cells. An additional proliferation assay indicated that EGF promoted the growth of lung cancer cells, but had no such effect in PHPT1 knockdown cells (Fig. 4a-d). Next, we established an erlotinib-resistant EGFR/19Del PC9 cell line, together with an erlotinib-resistant wild-type NCI-H1975 cell line (EGFR/T790M mutant), and treated the cells with 1 μM erlotinib. We found that erlotinib decreased the phosphorylation levels of ERK and MEK in the PHPT1 knockdown cells, whereas no such effect was observed in the PHPT1 expressing cells when treated with specific doses of erlotinib. Consistently, we found that erlotinib inhibited the proliferation of PHPT1 knockdown cells and had no such effect in PHPT1 expressing cells compared with control cells. Interestingly, we found that the drug resistance effect of PHPT1 was more obvious in acquired drug-resistant cell lines (Fig. 4e-h). However, additional studies are needed to determine how PHPT1 regulates drug resistance-related genes and pathways. From the data above, we conclude that PHPT1 may be pivotal in maintaining erlotinib-resistance in EGFR mutant cells.

Fig. 4.

Fig. 4

PHPT1 knockdown reduces resistance to erlotinib in EGFR mutant lung cancer cells. (a) and (c) Western blot analysis of the indicated cells treated with 100 ng/ml EGF using anti-PHPT1, anti-p-ERK and anti-p-MEK antibodies. (b) and (d) Cell counting kit 8 analysis of the indicated cells treated with 100 ng/ml EGF. (e) Western blot analysis of the indicated NCI-H1975 cells treated with 1 μM erlotinib using anti-PHPT1, anti-p-ERK and anti-p-MEK antibodies. (g) PC9 cells were treated with 1 μM erlotinib for 30 days to establish an erlotinib-resistant cell line, after which the cells were used for Western blot analysis. (fh) Proliferation assay of the indicated cells treated with 1 μM erlotinib

FBXO32 is an E3 ligase for PHPT1

To elucidate the mechanism by which PHPT1 is overexpressed in lung cancer, we used mass spectrometry to identify a potential E3 ubiquitin ligase that interacts with PHPT1. A vast number of proteins was identified specifically binding to PHPT1 but not to the control. One of the identified proteins was the F-box protein FBXO32, which belongs to the SKP-CUL1-F-box protein (SCF) family of E3 ubiquitin ligases, members of which target proteins such as PHPT1 (Fig. 5a). FBXO32 is also known to function as a tumor suppressor and to be mutated in melanoma [31]. Since FBXO32 is not a transcription factor, it remains to be established how it modulates gene expression. To this end, we performed an immunoprecipitation assay in order to clarify the mechanism by which they cooperate to regulate the progression of lung cancer. Indeed, we found that FBXO32 knockdown increased PHPT1 expression in both NCI-H3255 and NCI-H1975 cells, and that FBXO32 overexpression decreased the expression level of PHPT1 (Fig. 5b-e). Subsequent reciprocal co-immunoprecipitation experiments confirmed the endogenous interaction between FBXO38 and PHPT1 in NCI-H3255 cells (Fig. 5f). Immunoprecipitation experiments further verified the interaction between ectopically expressed PHPT1-V5 and FBXO38-Flag in HEK-293 T cells (Fig. 5g). We also found that immunoprecipitation of FBXO38-Flag using an anti-Flag antibody led to pulldown of endogenous PHPT1 (Fig. 5g). Moreover, FBXO32 overexpression increased the poly-ubiquitination level of PHPT1 in NCI-H1975 and NCI-H3255 cells (Fig. 5h-i). In the presence of the protein synthesis inhibitor cycloheximide (CHX), the protein half-life of PHPT1 in FBXO32 knockdown cells was significantly longer than that in control cells, and FBXO32 knockdown abolished FBXO32-mediated degradation of PHPT1 in NCI-H1975 cells (Fig. 5j-l).

Fig. 5.

Fig. 5

FBXO32 is an E3 ligase for PHPT1. (a) Mass spectrometry analysis of PHPT1 binding partner candidates in the indicated cells. (b-c) PHPT1 knockdown NCI-H3255 and NCI-H1975 cells analyzed by Western blotting using anti-FBXO32 and anti-PHPT1 antibodies. (d-e) FBXO32 overexpressing lung cancer cells were subjected to Western blotting using anti-FBXO32 and anti-PHPT1 antibodies, repeated three times. (f) Lysates of NCI-H1975 cells were subjected to co-immunoprecipitation using anti-FBXO32 or control IgG antibodies. (g) In HEK-293 T cells transfected with tagged constructs encoding UB-HA, FBXO-V5 and PHPT1-FLAG immunoprecipitation (IP) of PHPT1 led to co-IP of FBXO32. (h-i) Western blot analysis of poly-ubiquitinated PHPT1 in NCI-H1975 and NCI-H3255 cells transfected with the indicated constructs. (j-k) Western blot analysis of the indicated cells treated with CHX (40 ng/ml). (l) Western blot analyses using ImageJ

FBXO32 knockdown aggravates lung tumor growth in vitro and in vivo

To explore the biological functions of FBXO32 in lung cancer, we studied the molecular mechanism by which FBXO32 regulates PHPT1 expression and affects its biological characteristics. We found that inhibition of FBXO32 expression led to increased phosphorylation of ERK and MEK in two lung cancer cell lines, NCI-H1975 and NCI-H3255 (Fig. 6a-b). In addition, using a cell counting kit-8 assay, we found that FBXO32 knockdown increased the viability of both cell lines (Fig. 6c-d) and significantly increased their forming capacities (Fig. 6e-h). Mice bearing FBXO32 knockdown cells showed significantly reduced tumor weights compared to those bearing control cells (Fig. 6i-j). Notably, FBXO32 overexpression in HCC827 and WT PC9 cells and subsequent treatment with 1 μM erlotinib led to significantly downregulated ERK and MEK phosphorylation levels. The viabilities of the indicated cells were decreased as well. These data suggest that FBXO32 increases the sensitivity to erlotinib in lung cancer cells (Fig. 6k-n). Taken together, we conclude that FBXO32 may serve as an E3 ligase of PHPT1 and act as a key regulatory factor inhibiting the malignant progression of lung cancer, suggesting that FBXO32 may be a potential therapeutic target.

Fig. 6.

Fig. 6

FBXO32 knockdown promotes tumor growth in vitro and in vivo. (a-b) Western blot analysis of the indicated cells using anti-p-ERK, anti-t-ERK, anti-p-MEK and anti-t-MEK antibodies. (c-d) Cell counting kit 8 analysis of FBXO32 knockdown in NCI-H3255 and NCI-H1975 cells using two pairs of shRNAs in three independent experiments. (e–f) Clone formation assay using the indicated FBXO32 knockdown cells. (g-h) Quantification of clones. (i-j) Weight of NCI-H1975 lung tumors of FBXO32 shRNA targeted and control groups. Cells were subcutaneously injected into BALB/C mice (n = 6). (k-m) Western blot analysis of the indicated HCC827 and PC9 cells treated with 1 μM erlotinib using anti-PHPT1, anti-p-ERK and anti-p-MEK antibodies. (l-n) Proliferation assay of the indicated cells treated with 1 μM erlotinib. Data are presented as the mean ± SD, p values are shown, two-tailed Student’s t test. * p < 0.05, ** p < 0.01, *** p < 0.001

Discussion

Lung cancer is a devastating disease with ~ 80% of patients presenting with advanced or metastatic cancer at the time of diagnosis [32]. In recent decades, significant progress in standard therapy, including surgery, radiotherapy, chemotherapy and targeted therapy, alone or in combination, has not changed its high fatality rate and/or poor clinical prognosis [33, 34]. Here, we found that PHPT1 is upregulated in lung cancer, and showed that a high PHPT1 expression in lung cancer is correlated with a poor prognosis, with a median survival time of 63.4 months, compared to a median survival time of 89 months for cases with a low PHPT1 expression [23]. Using Western blotting, we found that PHPT1 was notably upregulated in EGFR mutant lung cancer cells and patient samples. We also found that PHPT1 knockdown inhibited the proliferative and clone forming abilities of lung cancer cells and increased their apoptotic rate. Moreover, we found that PHPT1 knockdown significantly inhibited the growth of lung cancer cells in vitro. These results prompted us to conclude that PHPT1 might serve as a potential therapeutic target for lung cancer.

Mitogen-activated protein kinases (MAPKs) are well-conserved serine and threonine protein kinases that can transform extracellular stimuli into a wide range of intracellular responses [35]. MAPKs comprise 4 independent MAPK signaling pathways, including the ERK/MAPK or classical pathway, the c-Jun- N-terminal kinase (JNK) pathway, the p38 signaling pathway and the big MAP kinase-1 (BMK-1) pathway. Phosphorylation of the extracellular signal-regulated kinase 1/2 (ERK1/2)/MAPK signaling pathway results in activation of multiple substrates that regulate various cellular processes, including proliferation, apoptosis, transformation and differentiation [3640]. Here, we show that the ERK/MAPK signaling pathway is activated and driven by PHPT1 in EGFR mutant lung cancer cells and patient samples. EGFR tyrosine kinase inhibitors (TKIs) have amply been used as front-line therapy for EGFR mutation-positive non-small cell lung cancer (NSCLC), but has been found to lead to the development of resistance and a lack of response to the TKI erlotinib [41]. From the perspective of continuous treatment, this barrier for patients with EGFR-mutant NSCLC remains to be overcome. In recent decades, great strides have been made in understanding the molecular mechanisms underlying acquired resistance to EGFR TKIs. Here, we found that PHPT1 is required for maintaining erlotinib resistance in EGFR-mutant cells. PHPT1 knockdown sensitized erlotinib-resistant cells to this drug inhibited their growth. Interestingly, PHPT1 knockdown resulted in a better response in EGFR/19Del cells than in EGFR/T790M cells treated with erlotinib. These results suggest that PHPT1 expression may serve as a biomarker for continued TKI treatment.

FBXO32 belongs to the F-box protein superfamily that functions as a phosphorylation-dependent substrate recognition component in the SCF E3 ligase complex [42, 43]. FBXO32 was initially identified as being specifically expressed in muscle and to play a pivotal role in muscle atrophy [44, 45]. Recent studies have shown that FBXO32 is also involved in the process of tumorigenesis [31, 46]. Zhou et al. reported that FBXO32 is linked to breast cancer tumorigenesis by targeting KLF4 for proteasomal degradation [47]. Another recent study showed that FBXO32 can target the classic oncogenic protein c-Myc for ubiquitination and degradation through the proteasome pathway [48], suggesting that FBXO32 may act as a tumor suppressor. As yet, however, the exact role of FBXO32 in tumorigenesis remains to be elucidated. We found that FBXO32 may act as an E3 ubiquitin ligase for PHPT1. FBXO32 knockdown subsequently led to aberrant PHPT1 accumulation, thereby activating the MAPK pathway and aggravating lung cancer tumor growth. This finding shows that FBXO32 is pivotal in the regulation of PHPT1 expression and that it may serve as a target for lung cancer treatment. Considering these results in combination with previous data, we hypothesize that promoting FBXO32 expression may be a strategy to reverse first-generation TKI resistance in EGFR-mutant NSCLC patients.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Fig. 1 (776.3KB, png)

(PNG 776 KB)

Supplementary Fig. 1 (1.1MB, png)

(PNG 1095 KB)

Supplementary Fig. 1 (498.7KB, png)

(PNG 499 KB)

Acknowledgements

We thank the National Natural Science Foundation of China for support.

Abbreviations

PHPT1

Phosphohistidine phosphatase 1

EGFR

Epidermal growth factor receptor

FBXO32

Epidermal growth factor receptor

AAb

Autoantibody

AKT/mTOR pathway

Protein kinase B/mammalian target of rapamycin pathway

ERK/MAPK pathway

Extracellular signal-regulated/mitogen-activated protein kinase pathway

JNK

C-Jun N-terminal kinase

BMK-1

Big MAP kinase-1

MAPK

Mitogen-activated protein kinase

OD value

Optical density value

BSA

Bovine serum albumin

TKI

Tyrosine kinase inhibitor

NSCLC

Non-small cell lung cancer

Author’s contributions

N.Z., Y.F.L. and W.Z.L. performed the experiments. Y.Q.Q. and N.C. analyzed and interpreted data. S.D.Z. polished the manuscript. M.X. and H.Y.Z. provided ideas and critical comments. M.X. and H.Y.Z. conceived and designed the study and co-wrote the paper with feedback from all authors. All authors approved the final manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (81972740 to H.Y.Z.) and the Zhuhai Science and Technology Project (20181117E030079 to Y.F.L. and 20171009E030079 to M.X.).

Availability of data and material

The RNA-sequencing data generated in this research are deposited in Sequence Read Archive (SRA) database. (reviewerlink:https://dataview.ncbi.nlm.nih.gov/object/PRJNA797898?reviewer=sl2j9hkl157fjs3l0avukv9h8q). Survival data supporting this article are from the Kaplan–Meier plotter website and GEO and TCGA datasets, which have been cited.

Code availability

Not applicable.

Declarations

Ethics approval and consent to participate

The study was performed in accordance with the Declaration of Helsinki. All human specimen and cell studies were reviewed and approved by the Ethics Committee of The Fifth Affiliated Hospital of Sun Yat-sen University, and informed written consent was obtained from all donors.

Animal experiments

This study is compliant with all relevant ethical regulations regarding animal research. Animal experiments were approved by the Animal Ethical and Welfare Research Committee of the Fifth Affiliated Hospital of Sun Yat-sen University and performed in accordance with established ARRIVE guidelines.

Consent for publication

Not applicable.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ning Zhang, Yifeng Liao and Weize Lv contributed equally.

Contributor Information

Mei Xiao, Email: xiaomei@mail.sysu.edu.cn.

Hongyu Zhang, Email: zhhyu@mail.sysu.edu.cn.

References

  • 1.R.A. Smith, K.S. Andrews, D. Brooks, S.A. Fedewa, D. Manassaram-Baptiste, D. Saslow, O.W. Brawley, R.C. Wender, Cancer screening in the United States, 2018: A review of current American Cancer Society guidelines and current issues in cancer screening. CA Cancer J Clin 68, 297–316 (2018) [DOI] [PubMed] [Google Scholar]
  • 2.H. Sung, J. Ferlay, R.L. Siegel, M. Laversanne, I. Soerjomataram, A. Jemal, F. Bray, Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71, 209–249 (2021) [DOI] [PubMed] [Google Scholar]
  • 3.M. Duruisseaux, M. Esteller, Lung cancer epigenetics: From knowledge to applications. Semin Cancer Biol 51, 116–128 (2018) [DOI] [PubMed] [Google Scholar]
  • 4.L.M. Seijo, N. Peled, D. Ajona, M. Boeri, J.K. Field, G. Sozzi, R. Pio, J.J. Zulueta, A. Spira, P.P. Massion, P.J. Mazzone, L.M. Montuenga, Biomarkers in Lung Cancer Screening: Achievements. Promises, and Challenges, J Thorac Oncol 14, 343–357 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.P.P. Massion, G.F. Healey, L.J. Peek, L. Fredericks, H.F. Sewell, A. Murray, J.F. Robertson, Autoantibody Signature Enhances the Positive Predictive Power of Computed Tomography and Nodule-Based Risk Models for Detection of Lung Cancer. J Thorac Oncol 12, 578–584 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.V. Doseeva, T. Colpitts, G. Gao, J. Woodcock, V. Knezevic, Performance of a multiplexed dual analyte immunoassay for the early detection of non-small cell lung cancer. J Transl Med 13, 55 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.E. Giroux Leprieur, G. Herbretau, C. Dumenil, C. Julie, V. Giraud, S. Labrune, J. Dumoulin, J. Tisserand, J.F. Emile, H. Blons, T. Chinet, Circulating tumor DNA evaluated by Next-Generation Sequencing is predictive of tumor response and prolonged clinical benefit with nivolumab in advanced non-small cell lung cancer. Oncoimmunology 7, e1424675 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.J.D. Merker, G.R. Oxnard, C. Compton, M. Diehn, P. Hurley, A.J. Lazar, N. Lindeman, C.M. Lockwood, A.J. Rai, R.L. Schilsky, A.M. Tsimberidou, P. Vasalos, B.L. Billman, T.K. Oliver, S.S. Bruinooge, D.F. Hayes, N.C. Turner, Circulating Tumor DNA Analysis in Patients With Cancer: American Society of Clinical Oncology and College of American Pathologists Joint Review. J Clin Oncol 36, 1631–1641 (2018) [DOI] [PubMed] [Google Scholar]
  • 9.M. Ehrlich, DNA hypomethylation in cancer cells. Epigenomics 1, 239–259 (2009) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.G. Weiss, A. Schlegel, D. Kottwitz, T. Konig, R. Tetzner, Validation of the SHOX2/PTGER4 DNA Methylation Marker Panel for Plasma-Based Discrimination between Patients with Malignant and Nonmalignant Lung Disease. J Thorac Oncol 12, 77–84 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.A.M. Aravanis, M. Lee, R.D. Klausner, Next-Generation Sequencing of Circulating Tumor DNA for Early Cancer Detection. Cell 168, 571–574 (2017) [DOI] [PubMed] [Google Scholar]
  • 12.A.M. Newman, S.V. Bratman, J. To, J.F. Wynne, N.C. Eclov, L.A. Modlin, C.L. Liu, J.W. Neal, H.A. Wakelee, R.E. Merritt, J.B. Shrager, B.W. Loo Jr., A.A. Alizadeh, M. Diehn, An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage. Nat Med 20, 548–554 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.D. Consonni, M. Pierobon, M.H. Gail, M. Rubagotti, M. Rotunno, A. Goldstein, L. Goldin, J. Lubin, S. Wacholder, N.E. Caporaso, P.A. Bertazzi, M.A. Tucker, A.C. Pesatori, M.T. Landi, Lung cancer prognosis before and after recurrence in a population-based setting. J Natl Cancer Inst 107, djv059 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.S. Klumpp, J. Hermesmeier, D. Selke, R. Baumeister, R. Kellner, J. Krieglstein, Protein histidine phosphatase: a novel enzyme with potency for neuronal signaling. J Cereb Blood Flow Metab 22, 1420–1424 (2002) [DOI] [PubMed] [Google Scholar]
  • 15.P. Ek, G. Pettersson, B. Ek, F. Gong, J.P. Li, O. Zetterqvist, Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase. Eur J Biochem 269, 5016–5023 (2002) [DOI] [PubMed] [Google Scholar]
  • 16.S.X. Han, L.J. Wang, J. Zhao, Y. Zhang, M. Li, X. Zhou, J. Wang, Q. Zhu, 14-kDa Phosphohistidine phosphatase plays an important role in hepatocellular carcinoma cell proliferation. Oncol Lett 4, 658–664 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.S. Srivastava, O. Zhdanova, L. Di, Z. Li, M. Albaqumi, H. Wulff, E.Y. Skolnik, Protein histidine phosphatase 1 negatively regulates CD4 T cells by inhibiting the K+ channel KCa3.1. Proc Natl Acad Sci U S A 105, 14442–14446 (2008) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.A. Xu, J. Hao, Z. Zhang, T. Tian, S. Jiang, J. Hao, C. Liu, L. Huang, X. Xiao, D. He, 14-kDa phosphohistidine phosphatase and its role in human lung cancer cell migration and invasion. Lung Cancer 67, 48–56 (2010) [DOI] [PubMed] [Google Scholar]
  • 19.A. Xu, Y. Li, W. Zhao, F. Hou, X. Li, L. Sun, W. Chen, A. Yang, S. Wu, B. Zhang, J. Yao, H. Wang, J. Huang, PHP14 regulates hepatic stellate cells migration in liver fibrosis via mediating TGF-beta1 signaling to PI3Kgamma/AKT/Rac1 pathway. J Mol Med (Berl) 96, 119–133 (2018) [DOI] [PubMed] [Google Scholar]
  • 20.W. Kolch, Coordinating ERK/MAPK signalling through scaffolds and inhibitors. Nat Rev Mol Cell Biol 6, 827–837 (2005) [DOI] [PubMed] [Google Scholar]
  • 21.J.M. Buonato, M.J. Lazzara, ERK1/2 blockade prevents epithelial-mesenchymal transition in lung cancer cells and promotes their sensitivity to EGFR inhibition. Cancer Res 74, 309–319 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.A. Bahrami, M. Khazaei, M. Hasanzadeh, S. ShahidSales, M. Joudi Mashhad, M. Farazestanian, H.R. Sadeghnia, M. Rezayi, M. Maftouh, S.M. Hassanian, A. Avan, Therapeutic Potential of Targeting PI3K/AKT Pathway in Treatment of Colorectal Cancer: Rational and Progress. J Cell Biochem 119, 2460–2469 (2018) [DOI] [PubMed] [Google Scholar]
  • 23.B. Gyorffy, P. Surowiak, J. Budczies, A. Lanczky, Online survival analysis software to assess the prognostic value of biomarkers using transcriptomic data in non-small-cell lung cancer. PLoS One 8, e82241 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.U. Degirmenci, M. Wang and J. Hu, Targeting Aberrant RAS/RAF/MEK/ERK Signaling for Cancer Therapy, Cells 9, (2020) [DOI] [PMC free article] [PubMed]
  • 25.F. Liu, X. Yang, M. Geng, M. Huang, Targeting ERK, an Achilles’ Heel of the MAPK pathway, in cancer therapy. Acta Pharm Sin B 8, 552–562 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.E.K. Kim, E.J. Choi, Pathological roles of MAPK signaling pathways in human diseases. Biochim Biophys Acta 1802, 396–405 (2010) [DOI] [PubMed] [Google Scholar]
  • 27.Y.J. Guo, W.W. Pan, S.B. Liu, Z.F. Shen, Y. Xu, L.L. Hu, ERK/MAPK signalling pathway and tumorigenesis. Exp Ther Med 19, 1997–2007 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.D. Westover, J. Zugazagoitia, B.C. Cho, C.M. Lovly, L. Paz-Ares, Mechanisms of acquired resistance to first- and second-generation EGFR tyrosine kinase inhibitors. Ann Oncol 29, i10–i19 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.H. Yasuda, E. Park, C.H. Yun, N.J. Sng, A.R. Lucena-Araujo, W.L. Yeo, M.S. Huberman, D.W. Cohen, S. Nakayama, K. Ishioka, N. Yamaguchi, M. Hanna, G.R. Oxnard, C.S. Lathan, T. Moran, L.V. Sequist, J.E. Chaft, G.J. Riely, M.E. Arcila, R.A. Soo, M. Meyerson, M.J. Eck, S.S. Kobayashi, D.B. Costa, Structural, biochemical, and clinical characterization of epidermal growth factor receptor (EGFR) exon 20 insertion mutations in lung cancer. Sci Transl Med 5, 216ra177 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.A.X. Zhu, O. Rosmorduc, T.R. Evans, P.J. Ross, A. Santoro, F.J. Carrilho, J. Bruix, S. Qin, P.J. Thuluvath, J.M. Llovet, M.A. Leberre, M. Jensen, G. Meinhardt, Y.K. Kang, SEARCH: a phase III, randomized, double-blind, placebo-controlled trial of sorafenib plus erlotinib in patients with advanced hepatocellular carcinoma. J Clin Oncol 33, 559–566 (2015) [DOI] [PubMed] [Google Scholar]
  • 31.N. Habel, N. El-Hachem, F. Soysouvanh, H. Hadhiri-Bzioueche, S. Giuliano, S. Nguyen, P. Horak, A.S. Gay, D. Debayle, N. Nottet, G. Beranger, B.B. Paillerets, C. Bertolotto, R. Ballotti, FBXO32 links ubiquitination to epigenetic reprograming of melanoma cells. Cell Death Differ 28, 1837–1848 (2021) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Erratum: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J Clin 70, 313 (2020) [DOI] [PubMed]
  • 33.Q.Y. Hong, G.M. Wu, G.S. Qian, C.P. Hu, J.Y. Zhou, L.A. Chen, W.M. Li, S.Y. Li, K. Wang, Q. Wang, X.J. Zhang, J. Li, X. Gong, C.X. Bai, S. Lung Cancer Group of Chinese Thoracic and C. Chinese Alliance Against Lung, Prevention and management of lung cancer in China, Cancer 121 Suppl 17, 3080–3088 (2015) [DOI] [PubMed]
  • 34.R.S. Herbst, D. Morgensztern, C. Boshoff, The biology and management of non-small cell lung cancer. Nature 553, 446–454 (2018) [DOI] [PubMed] [Google Scholar]
  • 35.M. Burotto, V.L. Chiou, J.M. Lee, E.C. Kohn, The MAPK pathway across different malignancies: a new perspective. Cancer 120, 3446–3456 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.N. Bluthgen, S. Legewie, Systems analysis of MAPK signal transduction. Essays Biochem 45, 95–107 (2008) [DOI] [PubMed] [Google Scholar]
  • 37.H.Y. Yong, M.S. Koh, A. Moon, The p38 MAPK inhibitors for the treatment of inflammatory diseases and cancer. Expert Opin Investig Drugs 18, 1893–1905 (2009) [DOI] [PubMed] [Google Scholar]
  • 38.T. Ahmed, A. Zulfiqar, S. Arguelles, M. Rasekhian, S.F. Nabavi, A.S. Silva, S.M. Nabavi, Map kinase signaling as therapeutic target for neurodegeneration. Pharmacol Res 160, 105090 (2020) [DOI] [PubMed] [Google Scholar]
  • 39.B. Kaminska, A. Gozdz, M. Zawadzka, A. Ellert-Miklaszewska, M. Lipko, MAPK signal transduction underlying brain inflammation and gliosis as therapeutic target. Anat Rec (Hoboken) 292, 1902–1913 (2009) [DOI] [PubMed] [Google Scholar]
  • 40.Y.T. Yeung, F. Aziz, A. Guerrero-Castilla, S. Arguelles, Signaling Pathways in Inflammation and Anti-inflammatory Therapies. Curr Pharm Des 24, 1449–1484 (2018) [DOI] [PubMed] [Google Scholar]
  • 41.R. Rosell, E. Carcereny, R. Gervais, A. Vergnenegre, B. Massuti, E. Felip, R. Palmero, R. Garcia-Gomez, C. Pallares, J.M. Sanchez, R. Porta, M. Cobo, P. Garrido, F. Longo, T. Moran, A. Insa, F. De Marinis, R. Corre, I. Bover, A. Illiano, E. Dansin, J. de Castro, M. Milella, N. Reguart, G. Altavilla, U. Jimenez, M. Provencio, M.A. Moreno, J. Terrasa, J. Muñoz-Langa, J. Valdivia, D. Isla, M. Domine, O. Molinier, J. Mazieres, N. Baize, R. Garcia-Campelo, G. Robinet, D. Rodriguez-Abreu, G. Lopez-Vivanco, V. Gebbia, L. Ferrera-Delgado, P. Bombaron, R. Bernabe, A. Bearz, A. Artal, E. Cortesi, C. Rolfo, M. Sanchez-Ronco, A. Drozdowskyj, C. Queralt, I. de Aguirre, J.L. Ramirez, J.J. Sanchez, M.A. Molina, M. Taron, L. Paz-Ares, Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3 trial. Lancet Oncol. 13, 239–246 (2012) [DOI] [PubMed] [Google Scholar]
  • 42.J.R. Skaar, J.K. Pagan and M. Pagano, SnapShot: F box proteins I, Cell 137, 1160–1160.e1161 (2009) [DOI] [PubMed]
  • 43.E.T. Kipreos and M. Pagano, The F-box protein family, Genome Biol 1, REVIEWS3002 (2000) [DOI] [PMC free article] [PubMed]
  • 44.M.D. Gomes, S.H. Lecker, R.T. Jagoe, A. Navon, A.L. Goldberg, Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl Acad Sci U S A 98, 14440–14445 (2001) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.S.C. Bodine, E. Latres, S. Baumhueter, V.K. Lai, L. Nunez, B.A. Clarke, W.T. Poueymirou, F.J. Panaro, E. Na, K. Dharmarajan, Z.Q. Pan, D.M. Valenzuela, T.M. DeChiara, T.N. Stitt, G.D. Yancopoulos, D.J. Glass, Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 294, 1704–1708 (2001) [DOI] [PubMed] [Google Scholar]
  • 46.J.L. Chou, H.Y. Su, L.Y. Chen, Y.P. Liao, C. Hartman-Frey, Y.H. Lai, H.W. Yang, D.E. Deatherage, C.T. Kuo, Y.W. Huang, P.S. Yan, S.H. Hsiao, C.K. Tai, H.J. Lin, R.V. Davuluri, T.K. Chao, K.P. Nephew, T.H. Huang, H.C. Lai, M.W. Chan, Promoter hypermethylation of FBXO32, a novel TGF-beta/SMAD4 target gene and tumor suppressor, is associated with poor prognosis in human ovarian cancer. Lab Invest 90, 414–425 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.H. Zhou, Y. Liu, R. Zhu, F. Ding, Y. Wan, Y. Li, Z. Liu, FBXO32 suppresses breast cancer tumorigenesis through targeting KLF4 to proteasomal degradation. Oncogene 36, 3312–3321 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Z. Mei, D. Zhang, B. Hu, J. Wang, X. Shen, W. Xiao, FBXO32 Targets c-Myc for Proteasomal Degradation and Inhibits c-Myc Activity. J Biol Chem 290, 16202–16214 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Fig. 1 (776.3KB, png)

(PNG 776 KB)

Supplementary Fig. 1 (1.1MB, png)

(PNG 1095 KB)

Supplementary Fig. 1 (498.7KB, png)

(PNG 499 KB)

Data Availability Statement

The RNA-sequencing data generated in this research are deposited in Sequence Read Archive (SRA) database. (reviewerlink:https://dataview.ncbi.nlm.nih.gov/object/PRJNA797898?reviewer=sl2j9hkl157fjs3l0avukv9h8q). Survival data supporting this article are from the Kaplan–Meier plotter website and GEO and TCGA datasets, which have been cited.

Not applicable.


Articles from Cellular Oncology are provided here courtesy of Springer

RESOURCES