Abstract
G protein‐coupled receptors (GPCRs) are the largest superfamily of cell surface receptors. They regulate critical physiological events and serve as potential therapeutic targets. G protein‐coupled receptor 35 (GPR35), a class A rhodopsin‐like GPCR expressed in various tissues, including adipose tissue and the gastrointestinal tract, has roles in diverse functions, including antioxidant, anticarcinogenic, and anti‐inflammatory effects. Although many endogenous and synthetic GPR35 agonists have been identified, the understanding of food‐derived agonists is limited. In this study, we discovered pelargonidin as a newly identified food‐derived GPR35 agonist through a systematic screening approach. We evaluated 28 dietary phytochemicals using a transforming growth factor α (TGFα) shedding assay to evaluate GPR35 activation, and found that cyanidin, a common 3‐hydroxyanthocyanidin present in various red fruits and vegetables, induced GPR35 activation. Among a series of 3‐hydroxyanthocyanidins tested, pelargonidin, characterized by its monohydroxylated B‐ring, exhibited the most potent agonistic activity. Mutational studies demonstrated that the hydrogen bond between the 3‐hydroxy group in the C‐ring of pelargonidin and Asn169, as well as the hydrophobic interaction between the A‐ring of pelargonidin and Phe163, is crucial for GPR35 activation. Furthermore, pelargonidin inhibited the production of interleukin‐8, a pro‐inflammatory cytokine, by activating endogenous GPR35 in Caco‐2 cells. These findings suggest that GPR35 may serve as a potential receptor for dietary anthocyanidins, such as pelargonidin, and provide new insights into the molecular mechanisms underlying the potential chemopreventive effects of anthocyanidins.
Keywords: anthocyanidin, flavonoid, G protein‐coupled receptor (GPCR), GPR35, polyphenol
Pelargonidin, a red‐fruit‐derived anthocyanidin, was newly identified as a dietary agonist of GPR35, a metabolite‐sensing GPCR implicated in anti‐inflammation. Through screening of dietary compounds, pelargonidin emerged as a potent GPR35 agonist, attenuating inflammation in human intestinal cells. These findings highlight the therapeutic potential of anthocyanidins in modulating cellular defense mechanisms via GPR35 activation.

Abbreviations
- AP
alkaline phosphatase
- GPCRs
G protein‐coupled receptors
- GPR35
G protein‐coupled receptor 35
- RIA
relative intrinsic activity
- TGFα
transforming growth factor α
- TMH
transmembrane helix
Introduction
G protein‐coupled receptors (GPCRs) are the largest family of proteins involved in signal transduction across cell membranes and represent promising therapeutic targets for novel drug candidates in various clinical fields. These receptors contain seven transmembrane domains and are activated by diverse ligands, including hormones, neurotransmitters, and growth factors. Classical metabolites derived from nutrients or by the gut microbiota can act as agonists of some GPCRs, such as free fatty acid receptors GPR40/41/43/84/120, succinate receptor GPR91, fatty acid ethanolamide receptor GPR119, and bile acid receptor TGR5 [1, 2, 3, 4, 5]. These GPCRs, known as ‘metabolite‐sensing GPCRs’, have attracted attention as potential therapeutic targets for diseases such as obesity and diabetes [6, 7, 8].
GPR35, a class A rhodopsin‐like GPCR, was initially identified as an orphan GPCR in 1998 [9]. In 2004, an alternatively spliced product of the GPR35 gene, whereby 31 amino acids were added to the N terminus of GPR35 was reported by Okumura et al. [10]. After the discovery, those variants are designated GPR35a (short) and GPR35b (long). Subsequently, kynurenic acid was the first reported agonist by Wang et al. [11], leading to the classification of GPR35 as a metabolite‐sensing GPCR. Until today, other endogenous molecules, such as lysophosphatidic acid [12] and reverse T3 [13], as well as synthetic compounds, such as zaprinast [14] and pamoic acid [15], have also been identified. However, the controversy remains as to whether these endogenous ligands reach sufficient concentrations to activate the receptor in tissues. As a result, GPR35 has been recognized as a semi‐orphan receptor. Since GPR35 is known to be highly expressed in the intestinal tract, particularly in colon epithelial cells [9, 10, 16], exogenous molecules are expected to serve as potential agonists. However, the agonist activity of exogenous compounds, particularly food‐derived dietary components, remains poorly understood. Additionally, GPR35 is known to be involved in modulating immune responses [17] and GWAS study highlighted the significance of GPR35 to the inhibition of inflammatory bowel disease [18]. Therefore, discovering GPR35 agonists from dietary compounds could significantly contribute to understanding the homeostasis of the intestinal tract.
In this study, we employed transforming growth factor α (TGFα) shedding assay, a method to measure GPCR activation [19], and identified pelargonidin, a polyphenol classified as an anthocyanidin, as a novel GPR35 agonist. Furthermore, Asn169 and Phe163 in GPR35 were identified as key residues for GPR35 activation by pelargonidin. Moreover, the inhibitory effects of pelargonidin on pro‐inflammatory cytokine production in Caco‐2 cells were investigated. We believe that our study may provide valuable insights into how the consumption of dietary phytochemicals contributes to disease prevention at the molecular level.
Results
Identification of pelargonidin as a potent agonist for GPR35
To investigate the GPR35 agonist activities of various dietary phytochemicals, we used the TGFα shedding assay, a system that evaluates GPCR activation by monitoring GPCR‐induced ectodomain shedding of membrane‐bound pro‐alkaline phosphatase (AP)‐TGFα, a reporter enzyme [19]. Prior to screening the agonistic activities of phytochemicals, we assessed GPR35 activation by zaprinast, a well‐characterized synthetic agonist. The half‐maximal effective concentration (EC50) of zaprinast was calculated to be 839.1 nm (Fig. 1A). Furthermore, pretreatment with CID2745687, a selective GPR35 antagonist, resulted in a reduction of zaprinast‐induced GPR35 activation (Fig. 1B), thereby validating the assay system for accurate evaluation of GPR35 activation by agonists. Using this assay system, we screened 28 different dietary phytochemicals (flavones, flavonols, flavanones, anthocyanidins, flavans, other phenolic compounds, vitamins, alkaloids, and sulfides). In this screening, some of the key phytochemicals commonly found in edible vegetables and fruits that are regularly consumed by humans were selected. Among the tested phytochemicals, cyanidin, a 3‐hydroxyanthocyanidin, exhibited the highest activity (~11% of AP‐TGFα release) (Fig. 1C,D). Luteolinidin, a 3‐dehydroxy analog of cyanidin, showed minimal activation of GPR35 (less than 2% of AP‐TGFα release). Quercetin, an abundant flavonol, showed moderate activity (~5% of AP‐TGFα release), while the other phytochemicals showed little activity. Based on these results, we directed our focus toward 3‐hydroxyanthocyanidins.
Fig. 1.

Investigation of GPR35 agonist efficacy of various dietary phytochemicals using transforming growth factor α shedding assay. G protein‐coupled receptor 35 (GPR35) activation of HEK293 cells transiently cotransfected with human GPR35, alkaline phosphatase‐transforming growth factor α (AP‐TGFα), and Gαq/i1 vectors was evaluated. (A) Dose‐dependent AP‐TGFα release activities of GPR35‐specific agonist zaprinast. Cells were treated with 10 nm–5 μm of zaprinast for 1 h. The data were expressed as the mean ± SD (n = 3). (B) Effect of GPR35 antagonist CID2745687 on zaprinast‐induced activation of GPR35. Cells were pretreated with 0–5 μm of CID2745687 for 30 min and then were treated with 1 μm of zaprinast for another 1 h. The data were expressed as the mean ± SD (n = 3). (C) GPR35 agonist efficacy of various food components. Cells were treated with 28 phytochemicals (1 μm each) or 0.02% DMSO as vehicle control. The data were expressed as the mean ± SD (n = 3). The blue bar indicates the highest AP‐TGFα release among the 28 dietary phytochemicals tested. (A–C) The receptor‐specific responses are shown (i.e., AP‐TGFα release in receptor‐transfected cells was subtracted from baseline responses in mock‐transfected cells for each compound). (D) Chemical structures of cyanidin, quercetin, luteolinidin, and luteolin.
To define the important substructures of 3‐hydroxyanthocyanidins for GPR35 agonist activity, we tested three derivatives having different numbers of hydroxy groups in the B‐ring: pelargonidin, cyanidin, and delphinidin (Fig. 2A). Treatment of each 3‐hydroxyanthocyanidin at a concentration of 1.0 μm showed that pelargonidin, a 3′‐dehydroxylated analog of cyanidin, significantly released AP‐TGFα. The activity of pelargonidin was higher than that of cyanidin (Fig. 2B). In contrast, delphinidin, a 5′‐hydroxylated analog of cyanidin, showed significant but lower activity compared with cyanidin. Thus, we decided to focus on pelargonidin for further studies because it showed the highest agonist activity.
Fig. 2.

GPR35 agonist efficacy of anthocyanidins. (A) Chemical structures of anthocyanidins used in this study. (B) GPR35 agonist efficacies of dietary 3‐hydroxyanthocyanidins were evaluated by the TGFα shedding assay using indicated anthocyanidins (1 μm). The data were expressed as the mean ± SD (n = 3). Multiple group comparisons were performed using the Compact Letter Display method. Different letters on the bars indicate a significantly different between each group accordingly to one‐way ANOVA followed by Tukey's multiple comparison test (P < 0.05).
Characterization of pelargonidin as a GPR35 agonist
To understand the features of pelargonidin as a GPR35 agonist, we measured its ligand activity against other metabolite‐sensing GPCRs, namely GPR40, GPR43, GPR41, GPR120, GPR84, and GPR119. The TGFα shedding assay system was also used for evaluating these GPCRs, and significant activations were observed when cells were treated with known agonist of each receptor. Specific agonist efficacy of pelargonidin toward GPR35 was confirmed since none of the tested GPCRs, except for GPR35, were activated (Fig. 3).
Fig. 3.

Agonist efficacy of pelargonidin for metabolite‐sensing G protein‐coupled receptors. AP‐TGFα release responses of various G protein‐coupled receptors (GPCRs), GPR40 (panel A), GPR43 (panel B), GPR41 (panel C), GPR120 (panel D), GPR84 (panel E), and GPR119 (panel F), toward the treatment of 1 μm of pelargonidin. As a positive control, TAK875 (GPR40), propionic acid (GPR43 and GPR41), TUG891 (GPR120), lauric acid (GPR84), and oleoylethanolamide (OEA; GPR119) were used. The data were expressed as the mean ± SD (n = 3). Asterisks show a significant difference from vehicle control accordingly to one‐way ANOVA followed by Tukey's multiple comparison test. *** and ** indicate P < 0.001 and P < 0.01, respectively.
To evaluate the GPR35 agonist property of pelargonidin, we performed a dose–response analysis using the TGFα shedding assay. Dose‐dependent activation was observed in human GPR35‐transfected HEK293 cells, while no such response was observed in empty vector‐transfected HEK293 cells (Fig. 4A). A similar effect was also observed in HEK293 cells transfected with mouse GPR35 (Fig. S1). From the dose–response curve (sigmoid curve), the EC50 of pelargonidin was calculated to be 577.1 nm. Additionally, we examined the effect of CID2745687 on pelargonidin‐induced AP‐TGFα release. As shown in Fig. 4B, pelargonidin‐induced AP‐TGFα release was significantly suppressed by pretreatment with CID2745687, indicating that pelargonidin directly activates GPR35.
Fig. 4.

Characterization of pelargonidin as a GPR35 agonist. (A) Dose‐dependent activation of GPR35 by pelargonidin. HEK293 cells were transiently cotransfected with human GPR35 (red) or empty vector control (blue) together with AP‐TGFα and Gαq/i1. Cells were treated with the indicated concentrations of pelargonidin (1 nm–5 μm) for 1 h. The data were expressed as the mean ± SD (n = 3). (B) Effect of GPR35 antagonist CID2745687 on pelargonidin‐induced activation of GPR35. HEK293 cells transiently cotransfected with human GPR35, AP‐TGFα, and Gαq/i1‐expressing vectors were pretreated with CID2745687 (0–10 μm) for 30 min. Cells were treated with 1 μm of pelargonidin for another 1 h. The data were expressed as the mean ± SD (n = 3).
Elucidation of putative key amino acid residues for ligand binding in GPR35
To further analyze the molecular interaction between pelargonidin and GPR35 and to understand the tertiary structure of GPR35, we performed molecular docking simulations using the Molecular Operating Environment (MOE) software ver. 2020.09. We first created 3D models of human GPR35 using established crystal templates (Protein Data Bank codes: 2rh1, 5xsz, and 3eml) and AlphaFold2 (Fig. 5). The homology model built using the template of 5xsz was selected based on its sequence identity (31%) and structure quality, which was assessed by MolProbity (Figs 5 and S2). The GPR35 3D model showed a maximum identity and the lowest Z‐score (0.57 ± 0.48), achieving moderate (sufficient) reliability justified by the Global Model Quality Estimate (GMQE) of 56% and a QMEANDisCo score of 0.6. The local quality of this model was promising, as the per‐residue QMEAN scores in the plot ranged from 0.6 to 0.8. Further validation with MolProbity showed that 97% of the residues in the model occupied the most‐favored regions in the Ramachandran plot, demonstrating that the quality of the model for the docking simulation was satisfactory (Fig. S3).
Fig. 5.

3D structure of human GPR35. Homology models based on the crystal structure of A2A adenosine receptor (Protein Data Bank code 3EML) (blue) and β2‐adrenergic receptor (Protein Data Bank code 2RH1) (light blue). Swiss‐model based on the crystal structure of lysophosphatidic acid receptor (Protein Data Bank code 5XSZ.1) (green). The 3D structure predicted by AlphaFold2 (pink). Among these structures, the 3D model of GPR35 predicted by Swiss‐model showed the highest identity (31.0%). Protein quality (Z‐score) was validated by MolProbity, and the 3D model of GPR35 predicted by Swiss‐model showed the lowest score (0.57 ± 0.48). Molecular Operating Environment (MOE) software was used for generating the structures and molecular modeling.
Next, pelargonidin was docked into the GPR35 model as a ligand using the MOE software. Residues Tyr96, Arg100, Arg151, Arg164, and Arg167 were chosen as the binding pocket, as previous simulation analyses and mutational studies suggested that the residues in the region of transmembrane helix (TMH) 3‐4‐5‐6 are the key amino acids that interact with pamoic acid and zaprinast [20, 21, 22]. Pelargonidin docked specifically to the active site of GPR35 (Tyr96, Arg100, Arg151, Arg164, and Arg167) and penetrated the pocket (Figs 6, 7A,B). In this docked position, pelargonidin was anticipated to form hydrogen bonds with His168 (distance: 3.18 Å and 3.23 Å), Asn169 (2.94 Å), and Val243 (3.18 Å) (Fig. 7C). In addition, Phe163, Thr166, Arg167, Arg240, Gly244, and Trp245 were predicted to contribute the formation of hydrophobic interaction with pelargonidin. Thus, nine amino acid residues were suggested to be critical residues for pelargonidin binding in GPR35.
Fig. 6.

Electrostatic surface view of the GPR35 ligands complex. (A, B) The side and top view of the electrostatic surface of the GPR35‐pelargonidin complex. (C, D) The side and top view of the GPR35‐pelargonidin complex interface. The GPR35 homology model was used for docking simulation with pelargonidin as described in Materials and Methods. MOE software was used for generating the structures and molecular modeling.
Fig. 7.

Molecular docking model of pelargonidin in the GPR35‐binding site. (A) 3D molecular docking model of pelargonidin in the GPR35‐binding site. The structure of GPR35 is represented in 3D ribbon structure (green). (B) Enlarged view of the pelargonidin interacted with the binding site of GPR35. (C) 2D interaction diagram of pelargonidin interacted with residues of GPR35. GPR35‐pelargonidin complex was analyzed by LigPlot software. The hydrogen bonds are shown as green dotted lines, the residues that are involved in hydrophobic interactions are shown as red arc with radiated spokes, green‐labeled residues are shown as the residues that are involved in hydrogen bond formation. MOE software (A, B) and LigPlot software (C) were used.
Identification of critical amino acid residues for receptor activation
We next investigated a key residue(s) involved in GPR35 activation by pelargonidin. Each of the nine residues predicted by the computational simulations was mutated to alanine using PCR, and constructed mutant cDNA plasmids of human GPR35. Immunoblotting analyses confirmed that all nine mutant GPR35s, similar to the wild‐type GPR35, were expressed on the cell membrane of transiently transfected HEK293 cells (Fig. S4). Using these mutant cDNA plasmids, we evaluated pelargonidin‐induced GPR35 activation by the TGFα shedding assay. Among the nine mutants tested, pelargonidin‐induced activation was significantly decreased in N169A and F163A mutants compared with wild‐type GPR35, whereas the other seven mutants exhibited activation levels comparable to the wild‐type. These results indicated that Asn169, which was anticipated to form the hydrogen bond with the 3‐hydroxy group in the C‐ring of pelargonidin, and Phe163, which was engaged in the hydrophobic interaction with the B‐ring of pelargonidin, are critical amino acid residues for GPR35 activation (Fig. 8A,B).
Fig. 8.

Characterization of mutant and wild‐type GPR35. (A, B) TGFα shedding assay of wild‐type (WT) and mutants of GPR35. GPR35 activation by pelargonidin at 1.0 μm was evaluated. To normalize the transfection efficiency between each mutant GPR35s, the activity was described as ‘relative agonistic activity’, meaning maximum AP‐TGFα release set as 100%. The data were expressed as the mean ± SD (n = 3). Multiple group comparisons were performed using the Compact Letter Display method. Different letters on the bars indicate a significantly different between each group accordingly to one‐way ANOVA followed by Tukey's multiple comparison test (P < 0.05). (C, D) Dose‐dependent activation of wild‐type (WT) and N169A (C) or F163A (D) of GPR35 by pelargonidin. HEK293 cells were transfected with human wild‐type GPR35 or N169A GPR35 (C), or GPR35 or F163A GPR35 (D) together with plasmids of AP‐TGFα and Gαq/i1. After harvesting cells for 24 h, cells were treated with indicated concentrations of pelargonidin (10 nm–2.5 μm) for 1 h and receptor activation was evaluated by the amount of AP‐TGFα release. The data were expressed as the mean ± SD (n = 3).
To further understand the importance of Asn169 and Phe163, we performed a dose–response analysis of these two mutants. Although N169A showed dose‐dependent activation by pelargonidin, the E max of N169A was calculated to be 24.4%, while that of wild‐type was 53.2%, which was almost half E max of wild‐type (Fig. 8C). In addition, the sigmoid curve of F163A shifted to the right and a decrease in relative GPR35 activation was observed in F163A‐transfected cells (Fig. 8D). These results suggested that, among the amino acid residues predicted by the computational analysis, Asn169 and Phe163 are essential for the interaction between GPR35 and pelargonidin, leading to receptor activation.
Anti‐inflammatory effect of pelargonidin through GPR35 activation
To evaluate the GPR35‐dependent anti‐inflammatory activity of pelargonidin, the inhibitory effect on IL‐8 production via GPR35 was evaluated using Caco‐2 cells, a colon tissue‐derived cell line that endogenously expresses GPR35. At both mRNA and protein levels, pretreatment with pelargonidin or zaprinast, a synthetic GPR35 agonist, significantly reduced hydrogen peroxide‐induced IL‐8 production (Fig. 9A,B). CID2745687, a GPR35 antagonist, which dose‐dependently inhibited both pelargonidin‐ and zaprinast‐induced GPR35 activation (Figs 1B, 4B), significantly reversed the inhibitory effect of both pelargonidin and zaprinast on IL‐8 production (Fig. 9B). These results indicated that pelargonidin‐induced GPR35 activation leads to anti‐inflammation.
Fig. 9.

GPR35‐dependent inhibition of IL‐8 production by pelargonidin in Caco‐2 cells. (A) mRNA levels of Interleukin‐8 (IL‐8) were evaluated by reverse transcription quantitative polymerase chain reaction. Caco‐2 cells were treated with zaprinast (Zap, 10 μm) or pelargonidin (Pel, 10 μm) for 3 h, followed by the treatment with 2 mm of hydrogen peroxide for 3 h. The data were expressed as the mean ± SD (n = 3). Multiple group comparisons were performed using the Compact Letter Display method. Different letters on the bars indicate a significantly different between each group accordingly to one‐way ANOVA followed by Tukey's multiple comparison test (P < 0.05). Con, control (B) IL‐8 production was evaluated by enzyme‐linked immuno‐sorbent assay. Caco‐2 cells were pretreated with CID2745687 (10 μm) for 30 min prior to the addition of zaprinast (10 μm) or pelargonidin (50 μm). The data were expressed as the mean ± SD (n = 3). Multiple group comparisons were performed using the Compact Letter Display method. Different letters on the bars indicate a significantly different between each group accordingly to one‐way ANOVA followed by Tukey's multiple comparison test (P < 0.05). Con, control.
Discussion
Here, we screened 28 dietary phytochemicals to evaluate their ability to activate human GPR35a, a short splice variant of GPR35. We found that cyanidin, a common 3‐hydroxyanthocyanidin present in various red fruits and vegetables, induced GPR35 activation. Furthermore, among the anthocyanidins tested, pelargonidin exhibited potent agonistic activity.
To investigate the GPR35 agonist activity of dietary compounds, we focused on phytochemicals and identified pelargonidin as the most potent GPR35 agonist. In our initial screening of 28 phytochemicals using the TGFα shedding assay, cyanidin, a 3‐hydroxyanthocyanidin, induced the strongest GPR35 activation, resulting in approximately 11% AP‐TGFα release. Quercetin showed the second strongest GPR35 agonist activity, with approximately 5% AP‐TGFα release (Fig. 1C). Cyanidin and quercetin are flavonoids with structural differences in the C‐ring. Our data suggest that the unique anthocyanidin structure in the C‐ring, which contains a 2‐phenylbenzopyrylium (flavylium) group, plays an important role in human GPR35 activation. Additionally, our analysis revealed that luteolinidin and luteolin, the 3‐dehydroxylated analogs of cyanidin and quercetin, respectively, did not exhibit significant activity (Fig. 1C,D). These results also suggest that the 3‐hydroxy group in the C‐ring is important for the activation of human GPR35. Further analysis comparing three anthocyanidins, pelargonidin, cyanidin, and delphinidin, revealed that pelargonidin, which has a monohydroxylated B‐ring, was a potent GPR35 agonist (Fig. 2). Taken together, our findings demonstrate that pelargonidin is a potent agonist of human GPR35 and suggest that the monohydroxy group on the B‐ring and 3‐hydroxy group on the C‐ring of pelargonidin are important for its human GPR35 agonist activity.
To investigate the interaction between GPR35 and pelargonidin, we generated a model of human GPR35 and performed computational docking simulations with pelargonidin (Figs 6, 7). Our docking simulation predicted the formation of hydrogen bonds between the main and side chain of His168, the side chain of Asn169, and the main chain of Val243 (Fig. 7C). Site‐directed mutagenesis revealed that the mutation of Asn169 significantly affected the pelargonidin‐induced relative GPR35 activation compared to wild‐type GPR35 (Fig. 8A,C). On the other hand, significant effects were not observed in either His168 or Val243 mutation. These results corresponded to the initial screening (Fig. 1C) and structure–activity relationship analysis (Fig. 2), which revealed the importance of 3‐hydroxy group in the C‐ring of anthocyanidins. These findings highlight the importance of Asn169 of GPR35 and 3‐hydroxy group in C‐ring of pelargonidin for the activation of GPR35 by pelargonidin. In addition, a hydrophobic interaction between Phe163 and the A‐ring of pelargonidin was also revealed as a key interaction for GPR35 activation by pelargonidin (Figs 7, 8B,D). This is supported by the previous report that Phe163 is suggested to form hydrophobic interaction and contribute to GPR35 activation by lodoxamide, a synthetic agonist [23]. Although our docking model offers insights into pelargonidin‐GPR35 interactions, its accuracy is limited by the relatively low sequence identity (31%) between template and target, particularly in flexible binding site regions. This uncertainty may affect predicted binding modes and affinities. Therefore, results should be interpreted cautiously and validated experimentally. Future studies using higher‐resolution structures or molecular dynamics simulations may improve model reliability and understanding of ligand‐receptor interactions.
In the initial screening, we found that cyanidin and quercetin induced human GPR35 activation, while the remaining 26 phytochemicals we tested did not show significant agonist activity, even at concentrations of at least 1 μm (Fig. 1C). Although previous reports had suggested that luteolin could act as a partial agonist of rat GPR35 [24], we did not observe any agonistic activity of this phytochemical in our assay. Different receptor‐agonist recognition between GPR35 orthologs has been reported for synthetic agonists as well. For example, zaprinast is more potent for rat GPR35 than for the human ortholog, while pamoic acid exhibits relatively high efficacy agonist activity in human GPR35 but has little agonist activity in rodent GPR35 [16, 25]. Mouse GPR35, which retains both Phe163 and Asn169, was also activated by pelargonidin, exhibiting a similar EC50 value but a lower Emax (Fig. S1). These findings suggest that Phe163 and Asn169 are critical for pelargonidin recognition by GPR35 in both humans and mice; however, species‐specific amino acid differences in other regions of the ligand‐binding pocket may also contribute to ligand recognition and/or activation.
GPR35 plays a potential role in the development of various diseases, including diabetes, hypertension, asthma, and inflammatory bowel disease [26, 27, 28, 29, 30, 31]. In this study, we identified anthocyanidins, particularly pelargonidin, as novel GPR35 agonists and demonstrated that pelargonidin significantly inhibited hydrogen peroxide‐induced IL‐8, a pro‐inflammatory cytokine, production through GPR35 activation in Caco‐2 cells (Fig. 9). GPR35 knockout mice have been reported to worsen colitis symptoms in dextran sulfate sodium and trinitrobenzene sulfonic acid models and these models are known to increase intestinal permeability and higher inflammatory cytokine levels. Previous studies have reported the association between cytokine secretion, such as IL‐8, and the progression of colitis [32]. Furthermore, GPR35 has been suggested as a therapeutic target for colitis, though the mechanistic relationship between GPR35 and the disease remains unclear. Our study suggests that anthocyanidins might contribute to maintaining our health by activating GPR35.
GPR35 is expressed as two distinct isoforms that differ only in the length of their extracellular N terminus by 31 amino acids, yet the functional differences between these variants remain incompletely understood. Owing to the complex expression pattern of the GPR35 gene and the possibility of alternative translation initiation, information on the tissue specificity and activity of the short (GPR35a) and long (GPR35b) variants is still limited. Previous studies have suggested that GPR35b may exhibit altered ligand recognition and allosterically modulate receptor–transducer coupling, thereby inducing intracellular pathway bias [33, 34]. In the present study, we focused on GPR35a and did not assess the activity of pelargonidin toward human GPR35b. Given that GPR35b is reported to be expressed in colonic tissue, its potential recognition of pelargonidin should also be taken into consideration in future studies.
In summary, we screened 28 different phytochemicals for their potential to activate GPR35, and our detailed analysis revealed that pelargonidin is a novel and potent GPR35 agonist. To the best of our knowledge, this is the first report of anthocyanidins acting as GPR35 agonists. We also found that the 3‐hydroxy group in the C‐ring may be essential for GPR35 activation by anthocyanidins. Moreover, our findings suggest that Asn169 plays a critical role in GPR35 activation and that the hydrogen bond between the 3‐hydroxy group in the C‐ring and Asn169 seemed important for pelargonidin‐induced GPR35 activation. Based on the previous report that a substantial proportion (approximately 13%) of orally administered pelargonidin reaches the intestinal tract within 2 h in rats [35], consumption of foods containing pelargonidin may achieve sufficient concentrations in the intestine to activate GPR35. These results provide new insights of chemopreventive effects of anthocyanidins at a molecular level, in addition to the possibility that GPR35 may serve as a receptor for dietary anthocyanidins.
Materials and methods
Materials
Luteolin, cyanidin, luteolinidin, pelargonidin, and delphinidin were purchased from Cayman Chemical (Ann Arbor, MI, USA). Diosmetin, diosmin, naringenin, naringin, hesperetin, hesperidin, epicatechin, epicatechin gallate, epigallocatechin, epigallocatechin gallate, chlorogenic acid, curcumin, resveratrol, biotin, riboflavin, and capsaicin were obtained from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). Quercetin and caffeic acid were purchased from Nacalai Tesque (Kyoto, Japan). Spiraeoside was purchased from Extrasynthese (Lyon, France). Catechin, (−)‐limonene, and (+)‐limonene were purchased from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan). Allyl sulfide, diallyl disulfide, and diallyl trisulfide were purchased from Sigma‐Aldrich Co. (St. Louis, MO, USA). ELISA MAX™ Deluxe Set Human IL‐8 was purchased from BioLegend (San Diego, CA, USA).
Cell culture
Both HEK293 (RRID:CVCL_0045) and Caco‐2 (RRID:CVCL_0025) cells were obtained from ATCC. HEK293 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (1 g/L Glucose) with L‐Gln and Sodium Pyruvate (FUJIFILM Wako Pure Chemical Corporation) Caco‐2 cells were maintained DMEM (4.5 g/L glucose) with L‐Gln and Sodium Pyruvate (Nacalai Tesque). Medium was supplemented with 10% heat‐inactivated fetal bovine serum (FBS), 4 mm L‐glutamine, 100 U·mL−1 penicillin, and 100 μg·mL−1 streptomycin. The cells were incubated at 37 °C in a humidified 5% CO2 atmosphere. All cell experiments were performed with mycoplasma‐free cells.
TGFα shedding assay
TGFα shedding assay was performed as previously described by Inoue et al [19]. HEK293 cells were seeded at a density of 1.0 × 105 cells/well in a 24‐well plate. After incubation for 24 h, the cells were transfected with polyethylenimine (PEI) (Polysciences Inc., Warrington, PA, USA) and DNA vectors (human GPR35, AP‐TGFα, and Gαq/i1, a chimeric small Gα protein consists of a Gαq backbone, which enhances TNFα‐converting enzyme‐mediated AP‐TGFα release, and a C‐terminal sequence derived from the Gαi subfamily for GPCR binding). In detail, 1.5 μg of PEI was mixed with 25 μL of Opti‐MEM (Gibco Life Technologies (New York, NY, USA)) and incubated for 5 min at room temperature. The vectors for human GPR35 (50 ng), AP‐TGFα (125 ng), and Gαq/i1 protein (25 ng) were added to 25 μL of Opti‐MEM and the solution was added to the PEI mixture. The combined mixture was incubated for 20 min at room temperature and then added dropwise to the cells at 50 μL per well. After incubation for 24 h at 37 °C in a humidified 5% CO2 atmosphere milieu incubator, transfected cells were washed with D‐PBS (−) and stripped with trypsin. The cells were centrifuged to remove the supernatant, resuspended in HBSS (+) containing 5 mm HEPES, and reseeded in a 96‐well plate at 90 μL per well. After incubation for 30 min at 37 °C in a humidified 5% CO2 atmosphere, the cells were added samples at 10 μL per well and incubated for another 1 h at 37 °C in a humidified 5% CO2 atmosphere. Conditioned media (80 μL per well) were transferred into another empty 96‐well plate and the remaining medium was removed by aspiration. Warmed up 10 mm of p‐nitrophenyl phosphate (Cayman Chemical) was added at 80 μL per well into both a conditioned medium plate and a cell plate. Both plates were placed in an incubator at 37 °C. The absorbance at 405 nm was measured at 0 h (background absorbance) and 1 h of incubation, and the agonist activity of each phytochemical was calculated from the two absorbances (0 h and 1 h). Hill coefficients were calculated from log[concentration] (M)–response (AP‐TGFα release (%)) curves by nonlinear regression analysis using a variable‐slope four‐parameter logistic equation in graphpad prism (version 9.5.1). TGFα shedding assay for evaluating agonist efficacy of pelargonidin for metabolite‐sensing GPCRs was performed as follows. HEK293 cells transfected with GPR40, GPR43, GPR41, GPR120, GPR84, or GPR119 with AP‐TGFα and with or without respective Gα vectors (GPR41, Gαq/i1; GPR120, Gαq/o; GPR84, Gαq/i1) were treated with 1 μm of pelargonidin. As a positive control, 0.1 μm of TAK875 (GPR40), 100 μm of propionic acid (GPR43), 100 μm of propionic acid (GPR41), 10 μm of TUG891 (GPR120), 100 μm of lauric acid (GPR84), or 10 μm of oleoylethanolamide (GPR119) were used.
Construction of mutants
The plasmid containing the cDNA encoding the Halo‐epitope‐tagged human G protein‐coupled receptor 35, transcript variant 1 (GPR35, NM_005301) in pcFN21A vector with kanamycin resistance gene was purchased from Kazusa DNA Research Institute and subcloned to pF4K CMV Flexi® Vector using Flexi® Cloning System (Promega, Madison, WI, USA) to generate untagged GPR35 cDNA plasmid vector. An untagged GPR35 vector was used for generating F163A, T166A, R167A, H168A, N169A, R240A, V243A, G244A, and W245A mutants. Primers for site‐directed mutagenesis were designed using QuickChange Primer Design online software (Agilent Technologies, Waldbronn, Germany), and following mutagenesis primers were used: F163A, 5′‐CCGGGTGCTCCTGGCGCAGAAGCCGCCC‐3′ (forward) and 5′‐ GGGCGGCTTCTGCGCCAGGAGCACCCGG‐3′ (reverse); T166A, 5′‐TTGAAATTGTGCCGGGCGCTCCTGAAGCAGAAG‐3′ (forward) and 5′‐CTTCTGCTTCAGGAGCGCCCGGCACAATTTCAA‐3′ (reverse); R167A 5′‐GGAGTTGAAATTGTGCGCGGTGCTCCTGAAGCAG‐3′ (forward) and 5′‐CTGCTTCAGGAGCACCGCGCACAATTTCAACTCC‐3′ (reverse); H168A, 5′‐CCATGGAGTTGAAATTGGCCCGGGTGCTCCTGAAG‐3′ (forward) and 5′‐CTTCAGGAGCACCCGGGCCAATTTCAACTCCATGG‐3′ (reverse); N169A, 5′‐CGCCATGGAGTTGAAAGCGTGCCGGGTGCTCCTG‐3′ (forward) and 5′‐CAGGAGCACCCGGCACGCTTTCAACTCCATGGCG‐3′ (reverse); R240A, 5′‐GCCCACTGCGAGGGCCACTGTCAGCCCC‐3′ (forward) and 5′‐GGGGCTGACAGTGGCCCTCGCAGTGGGC‐3′ (reverse); V243A, 5′‐CGTTCCAGCCCGCTGCGAGGCGC‐3′ (forward) and 5′‐GCGCCTCGCAGCGGGCTGGAACG‐3′ (reverse); G244A, 5′‐CAGGCGTTCCAGGCCACTGCGAGGC‐3′ (forward) and 5′‐ GCCTCGCAGTGGCCTGGAACGCCTG‐3′ (reverse); W245A, 5′‐GGCACAGGCGTTCGCGCCCACTGCGAGG‐3′ (forward) and 5′‐CCTCGCAGTGGGCGCGAACGCCTGTGCC‐3′ (reverse); Mutagenesis PCR and subsequent digestion of parental DNA were conducted using the QuickChange Lightning Site‐Directed Mutagenesis Kit (Agilent Technologies). The resulting DNA was amplified in XL 10‐Gold Ultracompetent cells and isolated using NucleoBond® Xtra Maxi (MACHEREY‐NAGEL, Duren, Germany). The presence of the mutation was verified by sequencing.
Building the 3D models of GPR35
3D models of GPR35 were built using the homology modeling approach and from AlphaFold2. The homology model technique was reliable to provide protein structure based on template selection. The amino acid sequence of GPR35 was retrieved from UniProt (Q9HC97) in FASTA format. The protein sequence length is 309 aa with a molecular weight of 34 kDa. We used topological information from the database to verify the 3D structure of this protein since the 3D structure is not yet available. Automated modeling provided by SWISS‐MODEL (https://swissmodel.expasy.org/) was employed to build the tertiary structure. The AlphaFold2 model was provided by the AlphaFold Protein Structure Database (https://alphafold.ebi.ac.uk/entry/Q9HC97). All models were compared with the results of the sequence identity and the structural quality calculated by MolProbity (http://molprobity.biochem.duke.edu/index.php) and the homology model created with the template (5xsz) was selected for the docking simulation study.
Molecular docking and interaction of GPR35 agonist
Molecular docking simulations were used for determining the binding position and comparing the affinity to the ligands. Computational analysis was conducted using Molecular Operating Environment (MOE) software ver. 2020.09. Induce fit method was used in this study. All ligands were docked specifically to the active site of GPR35 (Y96, R100, R151, R164, and R167) [20, 21, 22]. We expected to reveal the mode of action for the most potential ligand as the GPR35 agonist. All docking results were analyzed using LIGPLOT+ to understand the key residues and types of interactions. Data were visualized by MOE software. The generated structure was deposited in the ModelArchive (https://modelarchive.org/doi/10.5452/ma‐88yab).
Western blotting
Cell fractionation was performed using EzSubcell Extract (ATTO, Tokyo, Japan) following the manufacturer's instructions. The proteins were incubated with sample buffer at 37 °C for 2 h before they were subjected to reduced SDS/PAGE (10% polyacrylamide gel). After electrophoresis, the gel was transblotted onto a PVDF membrane and blocked with 0.25% polyvinylpyrrolidone (Sigma‐Aldrich) in TBS/T (Tris‐buffered saline containing 0.05% Tween 20) for 1 h at room temperature and incubated with the following primary antibodies at 4 °C: rabbit polyclonal anti‐GPR35 (ProteinTech, Rosemont, IL, USA), rabbit polyclonal anti‐Flotillin‐1 (ProteinTech), and mouse monoclonal anti‐glyceraldehyde‐3‐phosphate dehydrogenase (anti‐GAPDH) (MilliporeSigma, Burlington, MA, USA) antibodies. The blots were washed with TBS/T and then probed with horseradish peroxidase (HRP)‐linked secondary anti‐IgG antibody for 1 h at room temperature. Finally, Chemi‐Lumi One L western blotting detection reagents (Nacalai Tesque) were added and the bands were visualized using the WSE‐6100 LuminoGraph I chemiluminescence imaging system (ATTO).
RT‐qPCR
Total RNA was extracted from Caco‐2 cells by each experimental condition using ISOGENII (Nippon Gene, Tokyo, Japan) according to the manufacturer's instruction. Reverse transcription was performed by ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). First‐strand cDNA was prepared from 0.5 μg of total RNA. The real‐time PCR reaction was performed in a volume of 15 μL containing 37.5 ng of cDNA, 0.4 μm of each primer (IL‐8 sense 5′‐ACACTGCGCCAACACAGAAATTA‐3′ and anti‐sense 5′‐TTTGCTTGAAGTTTCACTGGCATC‐3′, β‐actin sense 5′‐CCCAGCCATGTACGTTGCTA‐3′ and anti‐sense 5′‐TCACCGGAGTCCATCACGAT‐3′), and TB Green Premix Taq II (Tli RNaseH Plus) (Takara‐Bio, Shiga, Japan). All the results were normalized by β‐actin mRNA levels. Relative gene expression changes, calculated using the 2−ΔΔCT method, are reported as number‐fold changes compared to those in the control samples. Unless it was overwise indicated, the average of three biological replicates was calculated.
Statistical analysis
Results are means ±S.D. Significant differences were analyzed using graphpad prism (version 9.5.1) (GraphPad, La Jolla, CA, USA). For normally distributed data, one‐way ANOVA followed by Tukey's multiple comparison test was used. A value of P < 0.05 indicated statistical significance.
Author contributions
FN: Investigation, validation, visualization, writing original draft, review and editing; SS: Investigation, formal analysis, writing original draft; MW: Investigation; WQL: Investigation; HA: Investigation; HS: Investigation; HH: Formal analysis of MOE, writing original draft; DHU: Formal analysis of MOE; MK: Formal analysis of MOE, writing – review and editing; AI: Funding acquisition, supervision, methodology, resources, writing – review and editing; KU: Supervision; TS: Conceptualization, visualization, funding acquisition, supervision, writing original draft, review and editing; and all authors approved the final version of the manuscript.
Conflict of interest
The authors declare no conflict of interest.
Supporting information
Fig. S1. Dose‐dependent activation of mouse GPR35 by pelargonidin.
Fig. S2. Evaluation of 3D structures of human GPR35 using Mol Probity.
Fig. S3. Ramachandran plot for the 3D model of GPR35 using lysophosphatidic acid receptor as the template.
Fig. S4. Characterization of mutant and wild‐type GPR35.
Table S1. Details of the curve fitting procedure.
Acknowledgements
Funding information: This work was supported in part by JSPS Grant‐in‐Aid for Challenging Research (Exploratory) (Grant number JP21K19073) (T.S.), and Asahi Group Foundation (T.S.). A.I. was funded by JP21H04791, JP24K21281 and JP25H01016 from JSPS; JPMJFR215T and JPMJMS2023 from JST; JP22ama121038 and JP22zf0127007 from AMED. K.U. was funded by JP17H06170 from JSPS.
Data availability statement
All data are contained in the article and in the Supporting Information.
References
- 1. Briscoe CP, Tadayyon M, Andrews JL, Benson WG, Chambers JK, Eilert MM, Ellis C, Elshourbagy NA, Goetz AS, Minnick DT et al. (2003) The orphan G protein‐coupled receptor GPR40 is activated by medium and long chain fatty acids. J Biol Chem 278, 11303–11311. [DOI] [PubMed] [Google Scholar]
- 2. Brown AJ, Goldsworthy SM, Barnes AA, Eilert MM, Tcheang L, Daniels D, Muir AI, Wigglesworth MJ, Kinghorn I, Fraser NJ et al. (2003) The orphan G protein‐coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J Biol Chem 278, 11312–11319. [DOI] [PubMed] [Google Scholar]
- 3. He W, Miao FJP, Lin DCH, Schwandner RT, Wang Z, Gao J, Chen JL, Tlan H & Ling L (2004) Citric acid cycle intermediates as ligands for orphan G‐protein‐coupled receptors. Nature 429, 188–193. [DOI] [PubMed] [Google Scholar]
- 4. Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto Y, Miyazaki S & Tsujimoto G (2005) Free fatty acids regulate gut incretin glucagon‐like peptide‐1 secretion through GPR120. Nat Med 11, 90–94. [DOI] [PubMed] [Google Scholar]
- 5. Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, Fukusumi S, Habata Y, Itoh T, Shintani Y et al. (2003) A G protein‐coupled receptor responsive to bile acids. J Biol Chem 278, 9435–9440. [DOI] [PubMed] [Google Scholar]
- 6. Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H et al. (2003) Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422, 173–176. [DOI] [PubMed] [Google Scholar]
- 7. Oh DY, Walenta E, Akiyama TE, Lagakos WS, Lackey D, Pessentheiner AR, Sasik R, Hah N, Chi TJ, Cox JM et al. (2014) A Gpr120‐selective agonist improves insulin resistance and chronic inflammation in obese mice. Nat Med 20, 942–947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Tang C, Ahmed K, Gille A, Lu S, Gröne HJ, Tunaru S & Offermanns S (2015) Loss of FFA2 and FFA3 increases insulin secretion and improves glucose tolerance in type 2 diabetes. Nat Med 21, 173–177. [DOI] [PubMed] [Google Scholar]
- 9. O'Dowd BF, Nguyen T, Marchese A, Cheng R, Lynch KR, Heng HHQ, Kolakowski LF & George SR (1998) Discovery of three novel G‐protein‐coupled receptor genes. Genomics 47, 310–313. [DOI] [PubMed] [Google Scholar]
- 10. Okumura SI, Baba H, Kumada T, Nanmoku K, Nakajima H, Nakane Y, Hioki K & Ikenaka K (2004) Cloning of a G‐protein‐coupled receptor that shows an activity to transform NIH3T3 cells and is expressed in gastric cancer cells. Cancer Sci 95, 131–135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Wang J, Simonavicius N, Wu X, Swaminath G, Reagan J, Tian H & Ling L (2006) Kynurenic acid as a ligand for orphan G protein‐coupled receptor GPR35. J Biol Chem 281, 22021–22028. [DOI] [PubMed] [Google Scholar]
- 12. Oka S, Ota R, Shima M, Yamashita A & Sugiura T (2010) GPR35 is a novel lysophosphatidic acid receptor. Biochem Biophys Res Commun 395, 232–237. [DOI] [PubMed] [Google Scholar]
- 13. Deng H, Hu H, Ling S, Ferrie AM & Fang Y (2012) Discovery of natural phenols as G protein‐coupled Receptor‐35 (GPR35) agonists. ACS Med Chem Lett 3, 165–169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Taniguchi Y, Tonai‐Kachi H & Shinjo K (2006) Zaprinast, a well‐known cyclic guanosine monophosphate‐specific phosphodiesterase inhibitor, is an agonist for GPR35. FEBS Lett 580, 5003–5008. [DOI] [PubMed] [Google Scholar]
- 15. Zhao P, Sharir H, Kapur A, Cowan A, Geller EB, Adler MW, Seltzman HH, Reggio PH, Heynen‐Genel S, Sauer M et al. (2010) Targeting of the orphan receptor GPR35 by pamoic acid: a potent activator of extracellular signal‐regulated kinase and β‐arrestin2 with antinociceptive activity. Mol Pharmacol 78, 560–568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Milligan G (2011) Orthologue selectivity and ligand bias: translating the pharmacology of GPR35. Trends Pharmacol Sci 32, 317–325. [DOI] [PubMed] [Google Scholar]
- 17. Quon T, Lin LC, Ganguly A, Tobin AB & Milligan G (2020) Therapeutic opportunities and challenges in targeting the orphan G protein‐coupled receptor GPR35. ACS Pharmacol Transl Sci 3, 801–812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Imielinski M, Baldassano RN, Griffiths A, Russell RK, Annese V, Dubinsky M, Kugathasan S, Bradfield JP, Walters TD, Sleiman P et al. (2009) Common variants at five new loci associated with early‐onset inflammatory bowel disease. Nat Genet 41, 1335–1340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Inoue A, Ishiguro J, Kitamura H, Arima N, Okutani M, Shuto A, Higashiyama S, Ohwada T, Arai H, Makide K et al. (2012) TGFα shedding assay: an accurate and versatile method for detecting GPCR activation. Nat Methods 9, 1021–1029. [DOI] [PubMed] [Google Scholar]
- 20. Jenkins L, Alvarez‐Curto E, Campbell K, De Munnik S, Canals M, Schlyer S & Milligan G (2011) Agonist activation of the G protein‐coupled receptor GPR35 involves transmembrane domain III and is transduced via gα13 and β‐arrestin‐2. Br J Pharmacol 162, 733–748. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. MacKenzie AE, Caltabiano G, Kent TC, Jenkins L, McCallum JE, Hudson BD, Nicklin SA, Fawcett L, Markwick R, Charlton SJ et al. (2014) The antiallergic mast cell stabilizers lodoxamide and bufrolin as the first high and equipotent agonists of human and rat GPR35. Mol Pharmacol 85, 91–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Zhao P, Lane TR, Gao HGL, Hurst DP, Kotsikorou E, Le L, Brailoiu E, Reggio PH & Abood ME (2014) Crucial positively charged residues for ligand activation of the GPR35 receptor. J Biol Chem 289, 3625–3638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Duan J, Liu Q, Yuan Q, Ji Y, Zhu S, Tan Y, He X, Xu Y, Shi J, Cheng X et al. (2022) Insights into divalent cation regulation and G13‐coupling of orphan receptor GPR35. Cell Discov 8, 135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Jenkins L, Brea J, Smith NJ, Hudson BD, Reilly G, Bryant NJ, Castro M, Loza MI & Milligan G (2010) Identification of novel species‐selective agonists of the G‐protein‐coupled receptor GPR35 that promote recruitment of β‐arrestin‐2 and activate Gα13. Biochem J 432, 451–459. [DOI] [PubMed] [Google Scholar]
- 25. Jenkins L, Harries N, Lappin JE, MacKenzie AE, Neetoo‐Isseljee Z, Southern C, McIver EG, Nicklin SA, Taylor DL & Milligan G (2012) Antagonists of GPR35 display high species ortholog selectivity and varying modes of action. J Pharmacol Exp Ther 343, 683–695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. MacKenzie AE, Lappin JE, Taylor DL, Nicklin SA & Milligan G (2011) GPR35 as a novel therapeutic target. Front Endocrinol (Lausanne) 2, 68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kaya B, Melhem H & Niess JH (2021) GPR35 in intestinal diseases: from risk gene to function. Front Immunol 12, 17392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Divorty N, Mackenzie AE, Nicklin SA & Milligan G (2015) G protein‐coupled receptor 35: an emerging target in inflammatory and cardiovascular disease. Front Pharmacol 6, 41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Farooq SM, Hou Y, Li H, O'Meara M, Wang Y, Li C & Wang JM (2018) Disruption of GPR35 exacerbates dextran sulfate sodium‐induced colitis in mice. Dig Dis Sci 63, 2910–2922. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Agudelo LZ, Ferreira DMS, Cervenka I, Bryzgalova G, Dadvar S, Jannig PR, Pettersson‐Klein AT, Lakshmikanth T, Sustarsic EG, Porsmyr‐Palmertz M et al. (2018) Kynurenic acid and Gpr35 regulate adipose tissue energy homeostasis and inflammation. Cell Metab 27, 378–392. [DOI] [PubMed] [Google Scholar]
- 31. Horikawa Y, Oda N, Cox NJ, Li X, Orho‐Melander M, Hara M, Hinokio Y, Lindner TH, Mashima H, Schwarz PEH et al. (2000) Genetic variation in the gene encoding calpain‐10 is associated with type 2 diabetes mellitus. Nat Genet 26, 163–175. [DOI] [PubMed] [Google Scholar]
- 32. Keshavarzian A, Fusunyan RD, Jacyno M, Winship D, MacDermott RP & Sanderson IR (1999) Increased interleukin‐8 (IL‐8) in rectal dialysate from patients with ulcerative colitis: evidence for a biological role for IL‐8 in inflammation of the colon. Am J Gastroenterol 94, 704–712. [DOI] [PubMed] [Google Scholar]
- 33. Schihada H, Klompstra TM, Humphrys LJ, Cervenka I, Dadvar S, Kolb P, Ruas JL & Schulte G (2022) Isoforms of GPR35 have distinct extracellular N‐termini that allosterically modify receptor‐transducer coupling and mediate intracellular pathway bias. J Biol Chem 298, 102328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Marti‐Solano M, Crilly SE, Malinverni D, Munk C, Harris M, Pearce A, Quon T, Mackenzie AE, Wang X, Peng J et al. (2020) Combinatorial expression of GPCR isoforms affects signalling and drug responses. Nature 587, 650–656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. El Mohsen MA, Marks J, Kuhnle G, Moore K, Debnam E, Srai SK, Rice‐Evans C & Spencer JPE (2006) Absorption, tissue distribution and excretion of pelargonidin and its metabolites following oral administration to rats. Br J Nutr 95, 51–58. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1. Dose‐dependent activation of mouse GPR35 by pelargonidin.
Fig. S2. Evaluation of 3D structures of human GPR35 using Mol Probity.
Fig. S3. Ramachandran plot for the 3D model of GPR35 using lysophosphatidic acid receptor as the template.
Fig. S4. Characterization of mutant and wild‐type GPR35.
Table S1. Details of the curve fitting procedure.
Data Availability Statement
All data are contained in the article and in the Supporting Information.
