Skip to main content
Springer logoLink to Springer
. 2026 Feb 28;58(1):16. doi: 10.1007/s00726-026-03508-2

Tryptophan metabolism reprogramming regulates Th1/Th2 immune balance and inhibits mast cell activation

Dongsheng Huang 1,, Dongxuan Huang 1, Lianhui Su 1, Chaowen He 1, Xiaopeng Zhang 1, Jianfeng Peng 1, Lumei Fan 1, Yahui Cao 1, Licheng Chen 1, Huifen Tong 1
PMCID: PMC12979366  PMID: 41764151

Abstract

Asthma is characterized by chronic airway inflammation and an imbalanced Th1/Th2 response. Although tryptophan metabolism has been implicated in immune regulation, its direct influence on Th1/Th2 differentiation and mast-cell activation remains insufficiently understood. CD4⁺ T cells were cultured under graded tryptophan concentrations (25, 50, 75 and 100 µM) to examine how tryptophan availability alters Th1/Th2 polarization. Flow cytometry, western blotting and RT-qPCR were used to evaluate phenotype markers and related metabolic pathways. In parallel, IgE-activated LAD2 mast cells were exposed to different tryptophan concentrations with or without the IDO1/TDO inhibitor HY-149,411, followed by immunofluorescence staining and ELISA to assess tryptase expression and histamine release. High tryptophan availability markedly enhanced Th1 differentiation, with increased Notch1/Jagged1 levels and elevated IL-2 and IFN-γ, while IL-4 expression was reduced. RT-qPCR showed upregulated T-bet and mTOR and downregulated GATA3, together with increased IDO1 and TDO mRNA levels in CD4⁺ T cells, indicating Th1-biased immunometabolic activation. In mast cells, tryptophan treatment suppressed tryptase expression and lowered histamine secretion, demonstrating reduced activation. HY-149,411 attenuated tryptophan-dependent differences in histamine release, suggesting that tryptophan catabolism contributes to mast-cell regulation. Tryptophan availability reprograms immune metabolism to promote Th1 differentiation and suppress mast-cell activation, offering a dual mechanism through which tryptophan may help correct Th1/Th2 imbalance and ameliorate allergic inflammation. These findings highlight tryptophan metabolism as a potential immunometabolic target for asthma therapy.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00726-026-03508-2.

Keywords: Tryptophan metabolism reprogramming, Asthma, Th1/Th2, Mast cells

Introduction

Asthma is a significant public health issue, affecting 4.2% of the Chinese population over 20 years old (Huang et al. 2019). The prevalence of asthma continues to rise, driven by factors like environmental pollution, genetics, immune dysregulation, and the disruption of nasal microbiota diversity. Understanding the mechanisms of asthma onset is crucial for addressing this trend (Miller et al. 2021, McCauley et al. 2019). Pathophysiologically, asthma is a chronic inflammatory disease characterized by a Th2-dominant immune response in susceptible individuals, leading to airway inflammation, remodeling, and hyperresponsiveness (AHR) (Hwang et al. 2017). Amino acid metabolic reprogramming involves cells altering the metabolism of certain amino acids to meet the nutritional needs of rapid proliferation. Tryptophan and arginine play significant roles in this process (Yang et al. 2023, Wang and Wan 2022). Tryptophan metabolism, in particular, is crucial for immunoregulation, with prior studies indicating its metabolites can inhibit T cell function and activate regulatory T cells. However, it is unclear whether the regulation of tryptophan metabolic reprogramming affects Th1/Th2 differentiation and whether it has an inhibitory effect on asthma (Gostner et al. 2016, Mándi and Vécsei 2012).The immune response in asthmatic airways is primarily driven by CD4(+) helper T cells (Th cells), with Th1 responses involved in autoimmune diseases and Th2 responses leading to hypersensitivity reactions (Zhang et al. 2014).

The Th1/Th2 imbalance is a core paradigm in allergic asthma pathogenesis (Luo et al. 2022, Muehling et al. 2020). Th2 cells drive disease progression by releasing cytokines, notably IL-4, which promote IgE production, eosinophil infiltration, and mast cell activation, culminating in allergic inflammation and bronchoconstriction. Conversely, Th1 responses, characterized by IFN-γ and IL-2 production, can counteract allergic inflammation (Hsieh et al. 1993, Seder et al. 1992). The balance between Th1 and Th2 cells can be characterized by the levels of these cytokines and transcription factors (Liang et al. 2017). Research has shown that asthma is primarily characterized by a Th2-dominant imbalance, with increased levels of Th2-secreted cytokines such as IL-4, IL-6, and IL-13, which promote airway inflammation, elevate eosinophil chemokine levels, and increase IgE production, further activating mast cells. Therefore, strategies to redirect the immune response from Th2 to Th1 are of therapeutic interest (Infante-Duarte and Kamradt 1999, Trinh et al. 2019). Beyond the classical Th1/Th2 paradigm, emerging evidence highlights the plasticity of T-cell differentiation and the involvement of other subsets, including regulatory T cells (Tregs) and Th17 cells, in asthma pathogenesis. For instance, recent studies demonstrate that strategies targeting multiple T-cell lineages – including Tregs, Th1, Th2, and Th17 – can effectively alleviate asthma (Choi et al. 2025) While this study focuses on Th1/Th2 modulation, we acknowledge the broader immune context in which tryptophan metabolism may operate.

Activated mast cells, originated from CD34 + and CD117 + pluripotent stem cells, release many inflammatory mediators and cytokines, exacerbating asthma and bronchoconstriction (Banafea et al. 2022, Dahlin and Hallgren 2015). Histamine and its receptors play a critical role in the development of various allergic diseases (Thangam et al. 2018), with mast cells being the primary producers of histamine and serving as common biomarkers for mast cell activation (Kabashima et al. 2018, Modena et al. 2016). However, the potential influence of tryptophan metabolism on mast cell activity is poorly understood.

Most previous studies have described correlative observations rather than establishing direct causal mechanisms. Our study differs by directly investigating the dose-dependent effects of tryptophan on Th1/Th2 differentiation and elucidating the underlying molecular pathways. Therefore, we aimed to investigate whether and how tryptophan metabolic reprogramming could rectify the pathogenic Th2-skewed immune milieu characteristic of allergic asthma by directly modulating asthma‑relevant Th1/Th2 differentiation and the activation of mast cells, which are central effector cells in asthma exacerbations. We induced Th1/Th2 polarization under gradient concentrations of tryptophan to explore its impact on differentiation ratios, key cytokine profiles, and related signaling molecules, further assessing its downstream effect on mast cell activation. This research provides novel mechanistic insights into the role of immunometabolism in asthma pathophysiology, potentially identifying new therapeutic targets for recalibrating the Th1/Th2 imbalance.

Materials and methods

Materials

Fetal Bovine Serum (FSD500) (Excell Bio, China), Penicillin-Streptomycin Solution (100X) (C0222) (Beyotime, China), Recombinant full-length Anti-Notch1 Antibody [EP1238Y] (ab52627) (Abcam, UK), Recombinant Anti-Jagged1 Antibody [EPR4290] (Abcam, UK), Anti-GAPDH Antibody [6C5] - Loading Control (ab8245) (Abcam, UK), Prestained Protein Marker II (G2058-250UL) (Servicebio, China), Human Interleukin-2 (IL-2) ELISA Kit (CB10349-Hu) (COIBO BIO, China), Human Interferon Gamma (IFN-γ) ELISA Kit (CB10293-Hu) (COIBO BIO, China), Human Interleukin-4 (IL-4) ELISA Kit (CB10371-Hu) (COIBO BIO, China), Human Histamine (HIS) ELISA Kit (CB11813-Hu) (COIBO BIO, China).

Cell culture

Human CD4 + T lymphocytes and human mast cells (LAD2 cell line) were acquired from the American Type Culture Collection (ATCC). To maintain primary-cell characteristics, CD4⁺ T cells were used within 2–3 passages after thawing, and LAD2 cells were maintained within routine recommended passages. All cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin at 37 °C in a 5% CO2 atmosphere. CD4 + T cells and mast cells were maintained separately. For routine maintenance, both cell types were collected by gentle centrifugation (300–400 g, 5 min) and were resuspended in fresh complete medium for passaging or subsequent experiments. The isolated CD4 + T cells were confirmed to be > 95% CD3 + CD4+ by flow cytometry prior to initiation of experiments. The LAD2 mast cells were confirmed by their characteristic morphology and positivity for CD117 and FcεRIα. This quality control step ensures the purity and appropriateness of the cells for our studies .

CD4⁺ T cells were cultured in media supplemented with varying concentrations of tryptophan: 25 µM (representing the baseline concentration in standard RPMI-1640 medium, designated as Baseline concentration, BS), 50 µM (approximating the lower range of physiological serum levels in healthy individuals, designated as Regular concentration, RS), 75 µM (designated as Medium high concentration, MHS), and 100 µM (reflecting elevated levels that may occur in localized inflammatory microenvironments, designated as High concentration, HS). This gradient allowed us to model a spectrum from standard culture conditions to states of nutrient abundance relevant to inflammatory pathology.

To induce Th1/Th2 polarization under different tryptophan concentrations, CD4⁺ T cells were first activated with plate-bound anti-CD3 (1 µg/mL) and soluble anti-CD28 (1 µg/mL). For Th1 polarization, cells were cultured in the presence of recombinant human IFN-γ (20 ng/mL) and a neutralizing anti-IL-4 antibody (10 µg/mL). For Th2 polarization, cells were cultured in the presence of recombinant human IL-4 (20 ng/mL) and a neutralizing anti-IFN-γ antibody (10 µg/mL). All polarization cultures were maintained for 5–7 days, with cytokines and neutralizing antibodies refreshed at day 3, before being harvested for analysis (Tau et al. 2000).

For mast cell activation assays, LAD2 cells were sensitized with human IgE (1 µg/mL, 16 h), followed by activation with anti-IgE (100 ng/mL, 30 min). To evaluate the regulatory effects of tryptophan, LAD2 cells were treated with different tryptophan concentrations (BS, RS, MHS, HS) during IgE activation. For experiments involving metabolic inhibition, the dual IDO1/TDO inhibitor HY-149,411 (MedChemExpress) was added 30 min before anti-IgE stimulation and maintained throughout the incubation period. Supernatants were collected for histamine ELISA, and cells were harvested for immunofluorescence staining.

Flow cytometry

Cells in the exponential growth phase were harvested by centrifugation, washed twice with PBS, and resuspended in staining buffer. For Th1/Th2 phenotypic analysis, 1 × 10⁶ cells from each group were incubated with fluorochrome-conjugated anti-CXCR3 and anti-CCR4 antibodies (BioLegend, USA) for 30 min at 4 °C in the dark, following the manufacturer’s instructions. After staining, cells were washed twice with PBS and resuspended in 300 µL staining buffer for flow cytometric acquisition on a BD FACS Celesta instrument. At least 10 000 CD4⁺-gated events were collected per sample. Data were analyzed using FlowJo Version 10.8.

Western blot

Cells at the logarithmic phase of growth were plated in 6-well dishes at a density of 1 million cells per well. To extract proteins, the cells were lysed on ice using RIPA buffer supplemented with PMSF. Protein concentration was determined using a BCA assay. The resultant protein samples (20 µg per lane) were then resolved via electrophoresis and transferred onto membranes under constant current conditions of 300 milliamperes for a duration of 1 h. Following transfer, the membranes underwent blocking and were subsequently incubated overnight at 4 °C with following primary primary antibodies: Anti-Notch1 (1:1000), Anti-Jagged1 (1:1000), and Anti-GAPDH (1:10000) as a loading control. After thorough incubation with the primary antibodies, the membranes were exposed to secondary antibodies (1:5000) at room temperature for 2 h. The membranes were then washed three times with TBST buffer, each wash lasting 10 min, to remove unbound antibodies and excess reagents. To quantify protein expression levels, the membranes were analyzed using ImageJ software (NIH), which measured the optical density of the bands. The expression of target proteins was normalized to GAPDH.

Enzyme linked immunosorbent assay (ELISA)

Cells in the logarithmic growth phase were seeded at a density of 1 × 106 cells per well in 6-well plates. Once the cells adhered, they were treated according to the specific experimental conditions and incubated for 24 h at 37 °C in an environment with 5% CO2. After incubation, the plates were removed, and the cell culture supernatants were collected and centrifuged at 1,000×g for 20 min. The resulting supernatants were then prepared for subsequent analysis. The concentrations of cytokines (IL-2, IFN-γ, IL-4) and histamine in cell culture supernatants were measured using specific commercial ELISA kits, strictly following the manufacturer’s protocols.

Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)

Total RNA was extracted from cells in the logarithmic growth phase. RNA purity and concentration were confirmed using a Nano 6000 spectrophotometer (all ratios were between 1.8 and 2.0). Subsequently, the RNA was reverse transcribed into cDNA in a reaction volume of 20 µL. The cDNA was then amplified using the CFX96 Touch Real-Time PCR Detection System (model 1855195). The PCR thermal cycling conditions included an initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 10 s.The primers used for these reactions were: T-Bet: Forward, GCCAAAGGATTCCGGGAGAA; Reverse, CCTGGGGAACCACATCCTTC; GATA3: Forward, GAAGGCAGGGAGTGTGTGAA; Reverse, GTCTGACAGTTCGCACAGGA; mTOR: Forward, GCCGCGCGAATATTAAAGGA; Reverse, CTGGTTTCCTCATTCCGGCT; IDO1: Forward, AAAGGCAACCCCCAGCTATC; Reverse, AGGAACTGAGCAGCATGTCC; TDO: Forward, CCAGGTGCCTTTTCAGTTGC; Reverse, CTTCGGTATCCAGTGTCGGG; GAPDH: Forward, GGTCTCCTCTGACTTCAACA; Reverse, GTGAGGGTCTCTCTCTTCCT; GAPDH expression levels were used as a housekeeping gene. The outcomes of the experiments were determined by employing the 2−ΔΔCt method (Modena et al. 2016). All reactions were performed in triplicate.

Immunofluorescence

As a validated surrogate for histamine release, tryptase expression in mast cells was assessed by immunofluorescence(Hallgren et al. 2000, Ge et al. 2016). Briefly, 2 × 105 cells were seeded on glass coverslips in 6-well plates. After treatments, cells were fixed with 1 mL of 4% paraformaldehyde on a shaker at 50 rpm for 20 min. After removing the fixative, the cells were washed three times with PBS and permeabilized with 1 mL of 0.25% Triton-X100 on a shaker at 50 rpm for 20 min. Following permeabilization, the cells were washed three times with PBS and blocked with 1 mL of goat serum for 30 min. The blocking solution was removed, and 1 mL of anti-tryptase antibody (1:200, Abcam) was added, followed by overnight incubation at 4 °C. After removing the primary antibody, the cells were washed three times with TBST, each wash lasting 5 min. Subsequently, 1 mL of Alexa Fluor 488–conjugated secondary antibody (1:200, Invitrogen) was added and incubated on a shaker at 50 rpm at room temperature in the dark for 1 h. The secondary antibody was discarded, and the cells were washed three times with TBST, each wash lasting 5 min. Nuclei were counterstained with DAPI for 5 min, then the staining was removed, and the cells were washed three times with TBST. Finally, the cells were immersed in 1 mL of TBST and imaged under a fluorescence microscope.

Statistical analysis

Data are presented as mean ± standard deviation (SD) from at least three independent experiments. For comparisons between two groups, an unpaired two-tailed Student’s t-test was used. For comparisons among multiple groups, one-way analysis of variance (ANOVA) was performed, followed by Tukey’s post-hoc test for pairwise comparisons. A p-value of less than 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism software (Version 9.4.0).

Limitations

We acknowledge limitations of our methodological approach. First, this study was conducted in vitro, which, while allowing for controlled manipulation of tryptophan levels, may not fully recapitulate the complex microenvironment of asthmatic airways in vivo. Second, the use of a commercial cell line may not represent the full heterogeneity of primary human mast cells or T cells.

Result

Assessment of CD4 + T cell differentiation into Th1 and Th2 subsets

To assess the impact of tryptophan availability on Th1/Th2 lineage commitment, CD4⁺ T cells were polarized under different tryptophan concentrations. Following induction with IFN-γ, the HS group demonstrated the highest proportion of Th1 cell differentiation. The Th1 differentiation ratio decreased in the MHS, RS, and BS groups, showing a significant concentration-dependent increase with higher tryptophan levels. In contrast, no significant differences were observed in Th2 cell differentiation under IFN-γ induction. Conversely, after induction with IL-4, the Th1 differentiation ratio remained comparable across groups. However, the Th2 differentiation ratio was highest in the BS group, followed by the RS, MHS, and HS groups, with statistically significant differences among them (Fig. 1). Taken together, these results indicate that high tryptophan availability promotes Th1 differentiation in a dose-dependent manner, while baseline tryptophan conditions favor a Th2 bias.

Fig. 1.

Fig. 1

Detection of Th1 and Th2 cell differentiation by flow cytometry. A and B Flow Cytometric Analysis of CXCR3 (Th1 Surface Marker) and CCR4 (Th2 Surface Marker) Expression in Four Distinct Groups Following IFN-γ Induction. The histogram overlays represent the fluorescence intensity of CXCR3-FITC and CCR4-FITC. C and D Flow Cytometric Analysis of CXCR3 (Th1 Surface Marker) and CCR4 (Th2 Surface Marker) Expression in Four Distinct Groups Following IL-4 Induction. The histogram overlays represent the fluorescence intensity of CXCR3-FITC and CCR4-FITC. ***P < 0.001. BS Baseline concentration (25 µM tryptophan), RS Regular concentration (50 µM tryptophan), MHS Medium high concentration (75 µM tryptophan) and HS High concentration (100 µM tryptophan)

Tryptophan modulates Notch1/Jagged1 expression to enhance Th1 and suppress Th2 cytokine responses

To explore the potential signaling mechanisms underlying the tryptophan-mediated Th1 shift, we examined the expression of key proteins in the Notch pathway and the secretion of lineage-defining cytokines. The protein expression levels of Notch1 and Jagged1 were significantly elevated in the HS group compared to other tryptophan concentration groups. The MHS group exhibited higher levels than the BS and RS groups, while the RS group showed greater expression than the BS group. Overall, both Notch1 and Jagged1 expression increased in a tryptophan concentration-dependent manner, with significant differences between groups (Fig. 2A and B). Moreover, tryptophan concentration influenced cytokine secretion: IL-2 and IFN-γ levels were significantly higher in the HS group than in the MHS, RS, and BS groups. Conversely, IL-4 levels were significantly lower in the HS group compared to the others (Fig. 2C-D). These findings suggest that high tryptophan concentration concomitantly upregulates the Notch1/Jagged1 axis and skews cytokine production toward a Th1 profile, providing a potential molecular link between tryptophan abundance and Th1 promotion.

Fig. 4.

Fig. 4

Effects of IgE activation and IDO1/TDO inhibition on mast-cell tryptase expression and histamine release. A Immunofluorescence staining showing tryptase (TPS) expression in LAD2 mast cells before IgE activation and after IgE activation. Tryptase levels were markedly reduced in the activated state following treatment with the IDO1/TDO inhibitor HY-149,411. Scale bar = 50 μm. B ELISA quantification of histamine (HIS) release in IgE-activated LAD2 mast cells treated with HY-149,411 under different tryptophan concentrations (IgE + HS+HY, IgE + MHS+HY, IgE + BS+HY, IgE + RS+HY). *P < 0.05, **P < 0.01

Fig. 2.

Fig. 2

Effects of different tryptophan concentrations on Notch signaling and Th1/Th2-associated cytokine production in CD4⁺ T cells. A Western blot detection of full-length Notch1 and Jagged1 protein expression. B Comparison of relative Notch1 and Jagged1 expression levels across groups. C Comparison of relative IL-2 expression levels across groups. D Comparison of relative IFN-γ expression levels across groups. E Comparison of relative IL-4 expression levels across groups. *P < 0.05, **P < 0.01, ***P < 0.001

Tryptophan availability regulates transcriptional programs associated with Th1/Th2 differentiation

To clarify how tryptophan availability influences T-cell differentiation, we examined the expression of key transcriptional and metabolic regulators in CD4⁺ T cells exposed to different tryptophan concentrations. Significant differences were observed in the mRNA levels of T-bet, GATA3, mTOR, IDO1 and TDO across the four groups (Fig. 3A–E, P < 0.05). The HS group showed the highest expression of T-bet, mTOR, IDO1 and TDO, indicating enhanced Th1-associated and metabolic activity. In contrast, GATA3 expression was highest in the BS group, consistent with a shift toward Th2-associated transcriptional programming under baseline tryptophan availability. These findings demonstrate that tryptophan levels modulate the transcriptional landscape governing Th1/Th2 differentiation. This pattern of gene expression demonstrates that tryptophan availability orchestrates a coordinated shift in both the transcriptional and immunometabolic programs that dictate CD4⁺ T cell fate.

Fig. 3.

Fig. 3

Effects of tryptophan on CD4⁺ T-cell transcriptional regulation. AE Relative expression of T-bet, GATA3, mTOR, IDO1 and TDO CD4⁺ T cells cultured with different tryptophan concentrations (BS, RS, MHS, HS). *P < 0.05, **P < 0.01, ***P < 0.001

Tryptophan metabolism and IDO1/TDO inhibition modulate mast-cell activation

To determine whether tryptophan metabolism also influences mast cell effector function, a key cell type in asthma exacerbations, we assessed tryptase expression and histamine release in IgE-activated LAD2 mast cells. Immunofluorescence staining revealed a pronounced increase in tryptase expression in IgE-activated mast cells. However, when these cells were cultured in high-tryptophan (HS) medium, the green fluorescent signal corresponding to tryptase was markedly attenuated. The merged images further indicated altered subcellular distribution of tryptase in the HS-treated group compared to IgE-activated controls (Fig. 4A). These results indicate that tryptophan inhibits tryptase expression, implying a concomitant reduction in histamine release. To further determine whether this regulatory effect depends on tryptophan metabolism, histamine release was examined in the presence of the dual IDO1/TDO inhibitor HY-149,411 (Fig. 4B). Following metabolic inhibition, histamine concentrations in the IgE + HS+HY, IgE + MHS+HY, and IgE + RS+HY groups were comparable and showed no significant differences. In contrast, the IgE + BS+HY group exhibited a significantly lower histamine level compared with the other three groups (P < 0.05). These results suggest that, when IDO1/TDO activity is blocked, baseline tryptophan availability retains a stronger inhibitory effect on mast-cell degranulation, whereas higher tryptophan concentrations do not further alter histamine release under inhibited metabolic conditions. These results suggest that tryptophan metabolism exerts an inhibitory effect on mast-cell degranulation, and this regulation is partially dependent on IDO1/TDO activity, as pharmacological inhibition attenuated the tryptophan-mediated suppression of histamine release.

Discussion

This study elucidates a dual immunometabolic mechanism operative in allergic asthma, whereby tryptophan availability reprograms the pathogenic Th1/Th2 imbalance and concurrently restrains mast cell degranulation, two hallmark events driving allergic airway inflammation. Our findings underscore the significance of amino acid metabolism, particularly tryptophan and its metabolites in immune regulation. We demonstrate that tryptophan concentration markedly affects the differentiation of CD4 + T cells into Th1 and Th2 subsets in a dose-dependent manner, corroborating earlier observations by Byakwaga et al. (Byakwaga et al. 2014).

Furthermore, RT-qPCR experiments revealed upregulated expression of the transcription factor T-bet, along with elevated secretion of IL-2 and IFN-γ under high tryptophan conditions, supporting a shift toward Th1-polarized immunity, which is generally associated with anti-inflammatory responses in asthma(Lee et al. 2019). Conversely, baseline tryptophanconcentrations favored Th2 differentiation, with downregulation of GATA3 expression. High tryptophan treatment also significantly increased the expression of metabolic enzymes IDO1 and TDO, likely attributable to increased substrate concentration—a finding consistent with other reports (Platten et al. 2019). We also found that the expression levels of Notch1 and Jagged1 correlated with the Th1 response to tryptophan. While canonical Notch signaling typically associates DLL4 with Th1 differentiation and Jagged1 with Th2 or regulatory T cell (Treg) responses(Bassil et al. 2011, Huang et al. 2017, Liotta et al. 2008), our data suggest a context-dependent role for Jagged1 in promoting Th1 differentiation under high tryptophan conditions. This aligns with recent evidence that Jagged1-Notch signaling can be modulated by microenvironmental cues, such as chemokine axes and metabolic factors, to influence T helper cell fate (Kun et al. 2024). Specifically, in allergic inflammation, Notch ligand-specific effects are disparate: Jagged1 often drives Th2 skewing, whereas DLL4 can promote Treg expansion and counterbalance Th2 responses (Huang et al. 2017).Thus, the correlation between tryptophan, Notch1/Jagged1 expression, and Th1 bias in our system may reflect a microenvironmentally instructed signaling adaptation, consistent with findings that Jagged1-Notch signaling can be harnessed to modulate Th1/Th2 balance in asthma(Kun et al. 2024).These collective outcomes suggest that tryptophan induces metabolic reprogramming in immune cells. Our findings support an ‘amplifier’ model of tryptophan-mediated immunomodulation, wherein elevated tryptophan not only fuels metabolic pathways like mTOR but also upregulates Notch1 and Jagged1. In addition to directing cell fate, Notch signaling may act as a general amplifier of T‑cell activation, boosting the existing Th1 program. Notably, Notch1 can form immune complexes with mitochondrial chaperones such as Grp75, modulating calcium dynamics and supporting mitochondrial metabolism to enhance cell survival under stress(Saini et al. 2022) .Thus, Notch1 upregulation in high‑tryptophan conditions may stabilize the metabolic state of Th1 cells, allowing sustained function in inflammatory environments. Coupled with Jagged1‑mediated amplification of Th1 differentiation—marked by increased T‑bet, IFN‑γ and IL‑2—this dual mechanism explains the dose‑dependent Th1 bias. This model aligns with findings in large vessel vasculitis, where VEGF amplifies pathogenic Th1/Th17 differentiation by upregulating endothelial Jagged1 and activating the Notch-mTORC1 pathway(Wen et al. 2017), highlighting a conserved role for microenvironmental signals in instructing T cell fate via Jagged1-Notch signaling.

Further studies suggest that the regulatory mechanism may involve promoting the expression of IDO1 and TDO, as their expression patterns paralleled the Th1-biased response to tryptophan. When treated with the IDO1 and TDO inhibitor HY-149,411, histamine concentrations in the HS, MHS, and RS groups showed no significant differences but were significantly higher than those in the BS group, suggesting that mast cell activity might be restored, leading to increased histamine release. However, the specific mechanism requires further investigation in subsequent studies.

Given the central role of mast cells in asthma-related allergic inflammation, we assessed tryptophan’s effect using immunofluorescence imaging of IgE-activated mast cells. Our study shows that tryptophan metabolic reprogramming can mitigate mast cell activation, with reduced histamine expression in the IgE + HS group(Banafea et al. 2022, Kabashima et al. 2018). This supports the hypothesis that enhancing Th1 differentiation while inhibiting Th2 responses can alleviate mast cell-mediated pathology in asthma. Based on these findings, we propose that increased tryptophan concentration elevates the expression of Th1-related inflammatory factors (IL-2, IFN-γ) and decreases the expression of Th2-related inflammatory factors (IL-4). This is likely due to metabolic reprogramming induced by high tryptophan concentrations, consistent with our findings. IL-2 and IFN-γ are primarily secreted by Th1 cells, while IL-4 is mainly secreted by Th2 cells. Immunofluorescence experiments revealed a decrease in tryptase concentration after co-culturing tryptophan with mast cells, indicating some alleviation of the inflammatory response. Our data show that tryptophan’s suppression of mast cells requires active IDO1/TDO catabolism, as inhibition by HY-149,411 abolishes this effect. While we did not measure IDO1/TDO in mast cells, clinical evidence links mast cell activation with elevated IDO1 activity and adverse outcomes(Georgin-Lavialle et al. 2016). Therefore, high tryptophan may upregulate IDO1/TDO, but its beneficial action depends on conversion to kynurenine for AhR signaling. Blocking this conversion could disrupt the balance, preventing stabilization without necessarily increasing histamine release. Conversely, in cancer models, high systemic tryptophan can enhance immunity by saturating catabolic enzymes(Schramme et al. 2020), highlighting the context-dependence of tryptophan’s role. Thus, the net effect hinges on the functional flux through the IDO1/TDO–kynurenine–AhR axis in mast cells.

Our observation that high tryptophan promotes Th1 differentiation may seem to contrast with studies showing immunosuppressive effects of its metabolites (e.g., kynurenines via IDO1) that enhance Tregs and suppress Th1/Th17 responses. We propose this discrepancy highlights the context-dependency of immunometabolism. This context may extend to disease-specific metabolic states. In cancer or chronic infection, tryptophan is often depleted through upregulated IDO1/TDO activity to suppress effector immunity(Solvay et al. 2023, Yang et al. 2021). In contrast, atopic conditions like asthma may present a state of relative “metabolic potential,” where sufficient or even elevated tryptophan levels coexist with impaired catabolic flux, failing to generate adequate immunosuppressive kynurenines and thereby permitting unchecked Th2 inflammation. Our study focused on the Th1/Th2 axis, yet immune responses in asthma involve a broader network of T-cell subsets. Tryptophan metabolites are known to influence Treg and Th17 differentiation, which also critically shape airway inflammation (Jiang et al. 2023). Emerging evidence underscores the therapeutic potential of multi‑lineage immune modulation in asthma, as demonstrated by strategies that simultaneously target Tregs and inflammatory T cells(Choi et al. 2025). Together, these findings highlight the importance of further investigating whether tryptophan metabolism similarly regulates Treg/Th17 homeostasis. The kynurenine pathway of tryptophan catabolism drives Treg differentiation via aryl hydrocarbon receptor (AhR) activation(Solvay et al. 2023). Although high tryptophan upregulated IDO1/TDO in our study, AhR activation and Treg induction are most potent under tryptophan depletion, which sensitizes the AhR pathway by increasing AhR expression and kynurenine uptake (Solvay et al. 2023). This suggests a dual immunomodulatory potential: ample tryptophan may promote Th1 bias, while induced IDO1/TDO could prime the microenvironment for future AhR-mediated tolerance if local tryptophan becomes depleted. Thus, the net immune effect likely depends on the dynamic balance between tryptophan availability and catabolic activity. In our system, high precursor concentration under strong polarizing signals (IFN-γ) may preferentially activate direct nutrient-sensing pathways like mTOR, driving inflammatory differentiation before significant catabolism to tolerogenic metabolites occurs. Conversely, in microenvironments with high IDO1/TDO activity, tryptophan depletion and kynurenine generation would dominate, promoting tolerance. Thus, the net immune effect depends on a balance between substrate availability and enzymatic activity. Notably, our data align with theoretical models by Martínez-Méndez et al. (28), who predicted metabolic concentrations could instruct T-cell fate. Our findings therefore do not contradict but rather complement the established paradigm, clarifying that tryptophan itself can be immunostimulatory in a high-concentration, pro-inflammatory context. Collectively, this establishes a dual immunoregulatory module: tryptophan sufficiency activates mTOR to promote Th1 differentiation, whereas its deprivation not only triggers GCN2 to inhibit mTORC1 but also sensitizes the AhR pathway by upregulating AhR and enhancing kynurenine uptake(Solvay et al. 2023). The resultant potent AhR activation by tryptophan catabolites then shifts the balance toward regulatory T-cell phenotypes(Li et al. 2025) Thus, tryptophan availability and its catabolism form a dual immunoregulatory module, dynamically calibrating immunity through opposing mTOR‑ and AhR‑driven signals.

The observed Th1 bias under high tryptophan conditions can be interpreted through the lens of T‑cell metabolic programming. Th1 differentiation requires an anabolic state supported by robust glycolytic and biosynthetic flux, a demand that is met by ample nutrient availability(Braun 2021, Shi et al. 2025). In our system, 100 µM tryptophan likely serves as a critical metabolic substrate and signaling precursor that preferentially fuels this Th1‑specific program, possibly through activating mTOR‑driven anabolism. This “metabolic wealth” contrasts with conditions of tryptophan limitation, where stress‑sensing pathways such as GCN2, important for T‑cell proliferative fitness even beyond canonical amino acid sensing(Velde et al. 2016), that would be engaged, potentially favoring alternative differentiation trajectories. Thus, tryptophan availability appears to instruct T‑cell fate by modulating the balance between anabolic effector programs and stress‑adapted regulatory responses.

Tryptophan-mediated suppression of mast cell degranulation, which was attenuated by IDO1/TDO inhibition, points to a role for its downstream metabolite kynurenine. In pulmonary fibrosis, kynurenine signals through the AhR to produce anti-fibrotic effects(Wang et al. 2025). AhR activation directly stabilizes mast cells, as its inhibition enhances degranulation(Nguyen et al. 2023). This suggests our observed mast cell inhibition likely involves the kynurenine-AhR axis. In T cells, tryptophan availability shapes differentiation. Ample tryptophan may support Th1 polarization via mTOR, whereas tryptophan limitation engages stress-response pathways. The stress kinase GCN2, crucial for T‑cell proliferative fitness, operates beyond simple nutrient sensing(Velde et al. 2016). Thus, tryptophan metabolism appears to coordinate immune responses by simultaneously promoting a Th1 profile and AhR‑mediated mast cell stabilization, while priming T cells for metabolic adaptation through GCN2. Future studies should directly examine AhR activation in mast cells and define GCN2’s role within this metabolic framework.

Our results highlight the potential of targeting tryptophan metabolism as a therapeutic strategy for asthma. Pharmacological or dietary interventions aimed at modulating local or systemic tryptophan levels could help rebalance Th1/Th2 responses, thereby mitigating allergic inflammation. However, several limitations must be acknowledged. First, this study was conducted in vitro, which may not fully replicate the complex microenvironment in vivo. Co-culture models incorporating epithelial cells, fibroblasts, and other immune cells could better mimic lung tissue conditions. Second, individual genetic variability in tryptophan metabolic pathways—such as polymorphisms in IDO1 or TDO genes—could influence treatment response and warrants clinical investigation. Additionally, the use of inhibitors may have off-target effects; thus, more specific genetic knockdown approaches could provide clearer mechanistic insights. Third, comorbidities commonly associated with asthma, such as metabolic syndrome or gut microbiota alterations—which are known to affect systemic tryptophan levels—may confound the translational applicability of our findings (29, 30). Fourth, our experimental focus on the Th1/Th2 axis and mast cells did not address the potential influence of tryptophan metabolism on other critical immune subsets, particularly the well-established link between tryptophan catabolism via the kynurenine pathway, AhR activation, and Treg differentiation. Fifth, our signaling analyses (e.g., Notch/mTOR) were confined to in vitro models; confirmation in human asthmatic lung tissues would strengthen the clinical applicability of these findings. Finally, our measurement of Notch1 signaling relied on total Notch1 protein levels. A more direct assessment of pathway activation would involve quantifying the cleaved Notch intracellular domain (NICD). Additionally, while our tryptophan gradient effectively modeled a shift from sufficiency to abundance, we note that using tryptophan‑free medium for precise supplementation would offer a more rigorous approach by eliminating the background tryptophan present in standard RPMI‑1640. Furthermore, our assessment of tryptophan catabolism was limited to mRNA expression of IDO1 and TDO. We did not measure the kynurenine-to-tryptophan (K/T) ratio, a more direct indicator of enzymatic flux, which precludes definitive conclusions about whether the observed transcriptional upregulation translates into increased catabolic activity.

Future research should validate these findings in vivo and explore combinatorial approaches with existing therapies. Specifically, direct measurement of kynurenine levels in culture supernatants will be conducted to confirm whether upregulated IDO1/TDO expression leads to increased catabolic flux. Future studies should directly quantify kynurenine and tryptophan levels to calculate the K/T ratio, which would confirm whether upregulated IDO1/TDO expression indeed leads to enhanced flux through the kynurenine pathway and clarify its contribution to the observed immunomodulatory effects. Studies should also integrate analyses of Tregs, Th17 cells, and AhR signaling to provide a more holistic understanding of tryptophan’s immunometabolic roles in asthma. Moreover, confirming Notch pathway activation by quantifying NICD or its target genes is warranted to verify that the elevated total Notch1 protein corresponds to enhanced canonical signaling. Employing tryptophan‑free media for precise supplementation in future work could further refine the dose‑response relationships described here. Natural compounds with immunomodulatory properties, such as Commiphora myrrh (31, 32), may offer complementary mechanisms for regulating immune responses in allergic diseases. Translational validation of the Notch/mTOR pathway in human asthma samples is also warranted.

Conclusion

Our findings underscore the therapeutic potential of modulating tryptophan concentration and metabolism as a strategy to rebalance the Th1/Th2 response, providing a novel avenue for alleviating chronic inflammation in asthma—particularly among patients who respond inadequately to conventional mast cell- or IgE-targeted treatments. However, our work has limitations and further research is needed to fully elucidate the molecular mechanisms by which tryptophan metabolites mediate immunomodulation. Additionally, clinical trials are necessary to assess the efficacy and safety of tryptophan metabolic interventions in asthma patients. To translate these insights into clinical applications, we propose the following future research directions: Investigating the specific tryptophan metabolites responsible for the observed effects using metabolomic profiling; Validating the role of the Notch1/Jagged1 axis using genetic knockdown models in vitro and in vivo; Assessing the efficacy of tryptophan modulation in preclinical animal models of allergic asthma, especially in combination with existing therapeutics. Overall, our study establishes a critical role for tryptophan metabolic reprogramming in regulating asthma-associated immune responses via effects on Th1/Th2 balance and mast cell activity.

Supplementary Information

Below is the link to the electronic supplementary material.

Acknowledgements

Not applicable.

Author contributions

Dongsheng Huang: study design, data analysis, drafting the manuscript and revision of the manuscript. Dongxuan Huang, Lianhui Su, Chaowen He, Xiaopeng Zhang, Jianfeng Peng, Lumei Fan, Yahui Cao, Licheng Chen, Huifen Tong: data collection and analysis, drafting the manuscript, investigation. All authors read and approved the final version of the manuscript.

Funding

This study is supported by Open Project of Guangdong Provincial Key Laboratory of Tropical Disease Research (KLTDR202002).

Data availability

All data generated or analysed during this study are included in this published article.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Clinical trial number

Not applicable.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Huang K et al (2019) Prevalence, risk factors, and management of asthma in China: a national cross-sectional study. Lancet 394(10196):407–418 [DOI] [PubMed] [Google Scholar]
  2. Miller RL, Grayson MH, Strothman K (2021) Advances in asthma: New understandings of asthma’s natural history, risk factors, underlying mechanisms, and clinical management. J Allergy Clin Immunol 148(6):1430–1441 [DOI] [PubMed] [Google Scholar]
  3. McCauley K et al (2019) Distinct nasal airway bacterial microbiotas differentially relate to exacerbation in pediatric patients with asthma. J Allergy Clin Immunol 144(5):1187–1197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Hwang YH, Paik MJ, Yee ST (2017) Diisononyl phthalate induces asthma via modulation of Th1/Th2 equilibrium. Toxicol Lett 272:49–59 [DOI] [PubMed] [Google Scholar]
  5. Yang L et al (2023) Amino acid metabolism in immune cells: essential regulators of the effector functions, and promising opportunities to enhance cancer immunotherapy. J Hematol Oncol 16(1):59 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Wang D, Wan X (2022) Progress in research on the role of amino acid metabolic reprogramming in tumour therapy: A review. Biomed Pharmacother 156:113923 [DOI] [PubMed] [Google Scholar]
  7. Gostner JM et al (2016) Tryptophan Metabolism in Allergic Disorders. Int Arch Allergy Immunol 169(4):203–215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Mándi Y, Vécsei L (2012) The kynurenine system and immunoregulation. J Neural Transm (Vienna) 119(2):197–209 [DOI] [PubMed] [Google Scholar]
  9. Zhang Y et al (2014) Th1/Th2 cell’s function in immune system. Adv Exp Med Biol 841:45–65 [DOI] [PubMed] [Google Scholar]
  10. Luo W et al (2022) Distinct spatial and temporal roles for Th1, Th2, and Th17 cells in asthma. Front Immunol 13:974066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Muehling LM et al (2020) Human TH1 and TH2 cells targeting rhinovirus and allergen coordinately promote allergic asthma. J Allergy Clin Immunol 146(3):555–570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hsieh CS et al (1993) Development of TH1 CD4 + T cells through IL-12 produced by Listeria-induced macrophages. Science 260(5107):547–549 [DOI] [PubMed] [Google Scholar]
  13. Seder RA et al (1992) The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4 + T cells from T cell receptor transgenic mice. J Exp Med 176(4):1091–1098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Liang P et al (2017) Huai Qi Huang corrects the balance of Th1/Th2 and Treg/Th17 in an ovalbumin-induced asthma mouse model. Biosci Rep, 37(6) [DOI] [PMC free article] [PubMed]
  15. Infante-Duarte C, Kamradt T (1999) Th1/Th2 balance in infection. Springer Semin Immunopathol 21(3):317–338 [DOI] [PubMed] [Google Scholar]
  16. Trinh HKT et al (2019) Asthma pharmacotherapy: an update on leukotriene treatments. Expert Rev Respir Med 13(12):1169–1178 [DOI] [PubMed] [Google Scholar]
  17. Choi S et al (2025) Asthma Alleviation by Ginsenoside Rb1 via Promotion of Treg Proliferation and Inflammatory T Cell Inhibition. Allergy 80(6):1647–1668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Banafea GH et al (2022) The role of human mast cells in allergy and asthma. Bioengineered 13(3):7049–7064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dahlin JS, Hallgren J (2015) Mast cell progenitors: origin, development and migration to tissues. Mol Immunol 63(1):9–17 [DOI] [PubMed] [Google Scholar]
  20. Thangam EB et al (2018) The Role of Histamine and Histamine Receptors in Mast Cell-Mediated Allergy and Inflammation: The Hunt for New Therapeutic Targets. Front Immunol 9:1873 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kabashima K et al (2018) Biomarkers for evaluation of mast cell and basophil activation. Immunol Rev 282(1):114–120 [DOI] [PubMed] [Google Scholar]
  22. Modena BD, Dazy K, White AA (2016) Emerging concepts: mast cell involvement in allergic diseases. Transl Res 174:98–121 [DOI] [PubMed] [Google Scholar]
  23. Tau GZ et al (2000) Interferon gamma signaling alters the function of T helper type 1 cells. J Exp Med 192(7):977–986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hallgren J et al (2000) Mechanism for activation of mouse mast cell tryptase: dependence on heparin and acidic pH for formation of active tetramers of mouse mast cell protease 6. Biochemistry 39(42):13068–13077 [DOI] [PubMed] [Google Scholar]
  25. Ge S et al (2016) Expression of proteinase-activated receptor (PAR)-2 in monocytes from allergic patients and potential molecular mechanism. Cell Biol Toxicol 32(6):529–542 [DOI] [PubMed] [Google Scholar]
  26. Byakwaga H et al (2014) The kynurenine pathway of tryptophan catabolism, CD4 + T-cell recovery, and mortality among HIV-infected Ugandans initiating antiretroviral therapy. J Infect Dis 210(3):383–391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee SY et al (2019) Macmoondongtang modulates Th1-/Th2-related cytokines and alleviates asthma in a murine model. PLoS ONE 14(12):e0224517 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Platten M et al (2019) Tryptophan metabolism as a common therapeutic target in cancer, neurodegeneration and beyond. Nat Rev Drug Discov 18(5):379–401 [DOI] [PubMed] [Google Scholar]
  29. Bassil R et al (2011) Notch ligand delta-like 4 blockade alleviates experimental autoimmune encephalomyelitis by promoting regulatory T cell development. J Immunol 187(5):2322–2328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Huang MT et al (2017) Notch Ligand DLL4 Alleviates Allergic Airway Inflammation via Induction of a Homeostatic Regulatory Pathway. Sci Rep 7:43535 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Liotta F et al (2008) Human immature myeloid dendritic cells trigger a TH2-polarizing program via Jagged-1/Notch interaction. J Allergy Clin Immunol 121(4):1000–5e8 [DOI] [PubMed] [Google Scholar]
  32. Kun W et al (2024) Modulating Th1/Th2 drift in asthma-related immune inflammation by enhancing bone mesenchymal stem cell homing through targeted inhibition of the Notch1/Jagged1 signaling pathway. Int Immunopharmacol 130:111713 [DOI] [PubMed] [Google Scholar]
  33. Saini N et al (2022) Notch1 Modulation of Cellular Calcium Regulates Mitochondrial Metabolism and Anti-Apoptotic Activity in T-Regulatory Cells. Front Immunol 13:832159 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wen Z et al (2017) The microvascular niche instructs T cells in large vessel vasculitis via the VEGF-Jagged1-Notch pathway. Sci Transl Med, 9(399) [DOI] [PMC free article] [PubMed]
  35. Georgin-Lavialle S et al (2016) Mast cells’ involvement in inflammation pathways linked to depression: evidence in mastocytosis. Mol Psychiatry 21(11):1511–1516 [DOI] [PubMed] [Google Scholar]
  36. Schramme F et al (2020) Inhibition of Tryptophan-Dioxygenase Activity Increases the Antitumor Efficacy of Immune Checkpoint Inhibitors. Cancer Immunol Res 8(1):32–45 [DOI] [PubMed] [Google Scholar]
  37. Solvay M et al (2023) Tryptophan depletion sensitizes the AHR pathway by increasing AHR expression and GCN2/LAT1-mediated kynurenine uptake, and potentiates induction of regulatory T lymphocytes. J Immunother Cancer, 11(6) [DOI] [PMC free article] [PubMed]
  38. Yang Z et al (2021) Antitumor Effect of Fluoxetine on Chronic Stress-Promoted Lung Cancer Growth via Suppressing Kynurenine Pathway and Enhancing Cellular Immunity. Front Pharmacol 12:685898 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Jiang ZM et al (2023) Sinomenine ameliorates rheumatoid arthritis by modulating tryptophan metabolism and activating aryl hydrocarbon receptor via gut microbiota regulation. Sci Bull (Beijing) 68(14):1540–1555 [DOI] [PubMed] [Google Scholar]
  40. Li B et al (2025) Tryptophan catabolites from microbiota ameliorate immune-mediated hepatitis through activating aryl hydrocarbon receptor of T cells. Gut Microbes 17(1):2557979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Braun MY (2021) The Natural History of T Cell Metabolism. Int J Mol Sci, 22(13) [DOI] [PMC free article] [PubMed]
  42. Shi Y, Zhang H, Miao C (2025) Metabolic reprogram and T cell differentiation in inflammation: current evidence and future perspectives. Cell Death Discov 11(1):123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Van de Velde LA et al (2016) Stress Kinase GCN2 Controls the Proliferative Fitness and Trafficking of Cytotoxic T Cells Independent of Environmental Amino Acid Sensing. Cell Rep 17(9):2247–2258 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang Y et al (2025) Kynurenine acts as a signaling molecule to attenuate pulmonary fibrosis by enhancing the AHR-PTEN axis. J Adv Res 71:521–532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Nguyen PT et al (2023) Ethyl Caffeate Can Inhibit Aryl Hydrocarbon Receptor (AhR) Signaling and AhR-Mediated Potentiation of Mast Cell Activation. Int J Mol Sci, 24(12) [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

All data generated or analysed during this study are included in this published article.


Articles from Amino Acids are provided here courtesy of Springer

RESOURCES