Abstract
Vibrio harveyi is a major bacterial pathogen of shrimp and finfish aquaculture. Traditionally, bioluminescence and sucrose fermentation have served as key phenotypic marker for its identification. However, frequent misidentification with closely related species like V. campbellii necessitates a reassessment of these phenotypic traits. Therefore, these traits were evaluated for genomic distribution, targeted phenotypic validation and its potential role in evolution and speciation. We generated chromosome-level assemblies for seven strains, including V. harveyi SB1 reference genome, and performed genome-wide mapping of 282 strains (204 V. harveyi and 78 V. campbellii), followed by phenotypic validation of 49 isolates. In silico analysis revealed that only 2.9% of V. harveyi strains carry luminescence operon (luxCDABEGH), whereas 100% strains of V. campbellii carried either a functional luxCDABEGH (87.2%) or a defective luxBG operon (12.8%). The functional sucrose operon (scrRAKB) was present in 89.5% strains of V. harveyi (yellow colonies on TCBS agar) but was absent in all V. campbellii (green colony) except strain 170502. Mobilome and synteny analysis revealed horizontal gene transfer of scr operon in 1% strains, while no mobile genetic elements were associated with the luxCDABEGH operon in V. harveyi, despite rare occurrence. Core genome phylogeny indicated that V. harveyi represents an early-evolved lineage, whereas V. campbellii is a recently evolved species within the Harveyi clade. The evolutionary trajectory of V. campbellii further suggests that luminescence-defective strains (e.g., type strain CAIM519T) evolved alongside a group of strains carrying luminescence operon flanked by mobile-genetic elements (e.g., BAA-1116). Phenotypic assays and PCR screening of the luciferase gene (luxA) and sucrose uptake gene (scrA) results were consistent with the genomic findings. Collectively, the present study demonstrates that V. harveyi is predominantly non-luminescent and sucrose-fermenting (yellow), while V. campbellii is primarily luminescent and sucrose non-fermenting (green colonies), providing refined phenotypic criteria for their differential diagnosis.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-026-37651-3.
Keywords: Bioluminescence, Evolution, Genomics, LuxCDABEGH, Scr, Sucrose, Vibrio campbellii, Vibrio harveyi
Subject terms: Biotechnology, Genetics, Microbiology, Molecular biology
Introduction
Vibrio harveyi and V. campbellii are major aquatic pathogens causing significant economic losses in aquaculture. They have been associated with luminescent vibriosis in shrimp hatcheries, where they can cause up to 100% mortality in mysis and early postlarval stages1–3. They have also been linked to acute hepatopancreatic necrosis disease (AHPND) in shrimp4–7. Beyond crustaceans, V. harveyi has also been implicated with vibriosis in several marine farmed fishes, including Asian seabass (Lates calcarifer)8,9, European seabass (Dicentrarchus labrax)10, gilthead sea bream (Sparus aurata)10,11, rainbow trout (Oncorhynchus mykiss)12, Atlantic salmon (Salmo salar)12, grey mullet (Mugil cephalus)13 and milk fish (Chanos chanos)14. Additionally, V. harveyi served as model organism for advancing the understanding of quorum sensing, a cell-density dependent regulatory mechanism controlling community behaviors such as bioluminescence15.
Despite great pathogenic significance in aquaculture and serving as a model organism in microbial research, V. harveyi and V. campbellii have been frequently misidentified. For example, comparative genomics study by Lin et al.16 revealed that 28% strains within the Harveyi clade were misidentified. Notably, V. harveyi BAA-1116, a model strain widely used in quorum sensing and luminescence studies, was reclassified as V. campbellii16. Studies from Indian shrimp farms and hatcheries revealed that 93 to 100% suspected V. harveyi strains were, in fact, V. campbellii2,17. This taxonomic confusion largely arises from the poor discriminatory power of the 16S rRNA gene, which share > 99% sequence identity between these species, well above the 97% threshold of species boundary16 as well as from incomplete understanding of their differential phenotypic traits. Over the past two decades, multilocus sequence analysis18,19 and genome-based phylogeny20 have markedly improved species resolution within the Harveyi clade, providing far superior discriminatory power compared to 16S rRNA based approaches. Species-specific PCR assays21,22have also been developed for rapid detection following culture on Vibrio-selective media. However, a gap remains between these molecular tools and traditional phenotypic markers such as bioluminescence and sucrose fermentation that continues to be widely used in field diagnostics due to their simplicity and ease of use.
Bioluminescence, encoded by luxCDABEGH operon, is one of the most widely cited phenotypic traits of V. harveyi1,15,23–25. The enzyme luciferase (LuxAB) generates light by oxidizing FMNH₂ and a long-chain fatty aldehyde, provided by LuxGH and LuxCDE, respectively26–28, and is regulated by quorum sensing networks29,30. Another widely used diagnostic test is sucrose fermentation on thiosulfate citrate bile salts sucrose (TCBS) agar, where sucrose fermenters produce yellow colonies and non-fermenters form green colonies31,32. In Gram-negative bacteria, sucrose utilization is encoded by the scrRAKB operon33. This encodes for sucrose-specific phosphotransferase system (PTS) ScrA, sucrose-6-phosphate hydrolase, ScrB, fructokinase ScrK, and the regulatory protein ScrR, and has been functionally characterized in V. alginolyticus34.
There are conflicting reports with respect to colony characteristics on TCBS agar (green/yellow) and bioluminescence in V. harveyi. Many studies describe V. harveyi as non-sucrose fermenter (green colony on TCBS) and predominantly luminescent24,35,36. Conversely, other studies report it as a sucrose-fermenter (yellow colonies) and majority of strains being non-luminescent37,38. Farm-level interpretations have further compounded this confusion, where the dominance of yellow colonies on TCBS agar is often taken as an indicator of “healthy flora,” while green colonies are regarded as problematic39. These inconsistencies, against a backdrop of widespread species misidentification, necessitate a systematic re-evaluation of these phenotypic markers. The availability of large number of high-quality bacterial genome sequences allows robust phylogenomic classification using average nucleotide identity (ANI)40,41 and core genome phylogeny42. Once species identity is reliably established, genotype–phenotype associations43 such as bioluminescence and sucrose utilization can be reassessed with accuracy. Accordingly, this study first generated chromosome-level assemblies for six V. campbellii strains and one V. harveyi strain. We then delineated species boundaries and evolutionary pattern across 315 publicly available genomes of Harveyi clade, including 288 strains of V. harveyi and V. campbellii, using ANI and core genome phylogeny. Further, we analysed the distribution of the luxCDABEGH (bioluminescence) and scrRAKB (sucrose utilization) operons across 282 confidently identified genomes (204 V. harveyi and 78 V. campbellii), supported by phenotypic validation in 49 representative isolates. Finally, the study investigated the potential role of horizontal gene transfer in atypical operon patterns by analysing associated mobile genetic elements.
Results
Bacterial strain profile for insilico and phenotypic study
A total of 315 genome assemblies from NCBI database were selected for pangenome, core-genome based phylogeny and average nucleotide identity (Supplementary Table S1). These strains were collected during 1935 to 2024. V. harveyi was isolated from diverse range of sources, including 147 strains from 43 different aquatic animals, 30 strains from human, and 20 from environmental sources. In contrast, V. campbellii was mostly recovered from seawater (35 strains) and aquatic animals, primarily shrimp (36 strains). Overall, 75 strains had chromosome-level genome assemblies, eight strains were assembled up to 5 contigs/scaffolds, while the remaining strains had contigs/scaffold ranging from 13 to 921. A highly curated secondary dataset was used for evolutionary and speciation analysis, comprising 82 genomes; 70 complete genomes, six strains assembled up to 5 contigs and remaining 6 with contig numbers ranging from 52 to 93 (Supplementary Table S1).
Forty-nine bacterial isolates were subjected to phenotypic characterization and PCR screening and is presented in Table 1. Nucleotide BLAST analysis of rpoD gene identified 18 isolates as V. harveyi and 31 isolates as V. campbellii. The V. harveyi isolates showed the highest sequence identity with the type strain ATCC14126, while the V. campbellii isolates were most similar to V. campbellii CAIM 519ᵀ, and each group clustered phylogenetically with its respective reference strain (Supplementary Fig. S1). This was further confirmed by species-specific multiplex PCR using the hemolysin. Eighteen isolates of V. harveyi produced the desirable 454 bp amplicon while 31 V. campbellii isolates had 328 bp amplicon (Supplementary Fig. S2).
Table 1.
Bacterial isolates used for phenotypic characterization and validation of in silico results on luminescence and sucrose fermentation.
| Sl.No | Species | Isolate name | Details of isolation | Disease | Year of isolation | Accession number for rpoD |
|---|---|---|---|---|---|---|
| 1 | V. campbellii | LB1 | P. monodon brooder gills | Luminescent vibriosis | 2006 | MW428977 |
| 2 | V. campbellii | LB3 | P. monodon spawning tank water | Luminescent vibriosis | 2006 | MW428978 |
| 3 | V. campbellii | LB10 | P. monodon brooder surface | Luminescent vibriosis | 2006 | MW428979 |
| 4 | V. campbellii | LB14 | P. monodon maturation tank water | Luminescent vibriosis | 2006 | MW428980 |
| 5 | V. campbellii | LB16 | Brooder intestine | No | 2006 | MW428981 |
| 6 | V. campbellii | LB25 | Faecal matter | No | 2006 | MW428982 |
| 7 | V. campbellii | LB27 | Brooder surface | No | 2006 | MW428983 |
| 8 | V. campbellii | LB33 | Brooder surface | No | 2006 | MW428984 |
| 9 | V. campbellii | LB37 | P. monodon Maturation tank water | Luminescent vibriosis | 2006 | MW428985 |
| 10 | V. campbellii | LB39 | Brooder surface | No | 2006 | MW428986 |
| 11 | V. campbellii | LB67 | Faecal matter | No | 2006 | MW428987 |
| 12 | V. campbellii | LB102 | P. monodon Maturation tank water | Luminescent vibriosis | 2006 | MW428988 |
| 13 | V. campbellii | LB131 | Pond water | No | 2007 | MW428989 |
| 14 | V. campbellii | LB135 | Pond sediment | No | 2007 | MW428990 |
| 15 | V. campbellii | LB157 | Pond water | No | 2007 | MW428991 |
| 16 | V. campbellii | LB164 | Pond water | No | 2007 | MW428992 |
| 17 | V. campbellii | LB171 | Pond water | No | 2007 | MW428993 |
| 18 | V. campbellii | LB178 | Pond sediment | No | 2007 | MW428994 |
| 19 | V. campbellii | LB186 | Shrimp gills | No | 2007 | MW428995 |
| 20 | V. campbellii | LB195 | P. monodon Postlarvae | Luminescent vibriosis | 2007 | MW428996 |
| 21 | V. campbellii | LB198 | P. monodon Postlarvae | Luminescent vibriosis | 2007 | MW428997 |
| 22 | V. campbellii | LB204 | P. monodon Postlarvae | Luminescent vibriosis | 2007 | MW428998 |
| 23 | V. campbellii | LB210 | P. monodon Postlarvae | Luminescent vibriosis | 2007 | MW428999 |
| 24 | V. campbellii | LB217 | P. monodon Postlarvae | Luminescent vibriosis | 2007 | MW429000 |
| 25 | V. campbellii | LB235 | P. monodon Mysis | Luminescent vibriosis | 2007 | MW429001 |
| 26 | V. campbellii | LB314 | Brooder surface | Luminescent vibriosis | 2008 | MW429002 |
| 27 | V. campbellii | LB503 | P. monodon Postlarvae | Luminescent vibriosis | 2009 | MW429003 |
| 28 | V. campbellii | LB515 | P. vannamei postlarvae | Luminescent vibriosis | 2018 | MW429004 |
| 29 | V. campbellii | LB516 | P. vannamei postlarvae | Luminescent vibriosis | 2018 | MW429005 |
| 30 | V. campbellii | BAA- 1116 | Seawater | – | 1993 | JF930357.1 (Procured from ATCC) |
| 31 | V. campbellii | LMG 11216 T (CAIM519T) | Seawater | No | 1971 |
A8140_02280 (Procured from LMG) |
| 32 | V. harveyi | SB1 | Asian seabass | Vibriosis | 2020 | QMY49_12835 |
| 33 | V. harveyi | LMG 4044 T (ATCC14126) | Dead Amphipod | Yes | 1935 | Procured from LMG |
| 34 | V. harveyi | LMG7890 (ATCC 35084) | – | – |
(Procured from LMG) |
|
| 35 | V. harveyi | LMG 19643 | – | – | (Procured from LMG) | |
| 36 | V. harveyi | 2301 | Penaeus vannamei gut | No | 2023 | PV550895 |
| 37 | V. harveyi | 2426 | Hepatopancreas of P. japonicus | Black spot on exoskeleton | 2024 | PV550896 |
| 38 | V. harveyi | 2427 | Hepatopancreas of P. japonicus | Black spot on exoskeleton | 2024 | PV550897 |
| 39 | V. harveyi | 2432 | Gut of P. japonicus | Black spot on exoskeleton | 2024 | PV550898 |
| 40 | V. harveyi | 2437 | Blood of P. japonicus | Loose shell | 2024 | PX116711 |
| 41 | V. harveyi | 2438 | Muscle of P. japonicus | Loose shell | 2024 | PV550899 |
| 42 | V. harveyi | 2439 | Haemolymph of P. japonicas | Loose shell | 2024 | PV550900 |
| 43 | V. harveyi | 2441 | Hepatopancreas of P. japonicus male | Loose shell | 2024 | PV550901 |
| 44 | V. harveyi | 2452 | Haemolymph of P. vannamei | Running mortality | 2024 | PV550902 |
| 45 | V. harveyi | Y12-23 | Lates calcarifer | - | 2023 | PV550903 |
| 46 | V. harveyi | FCD 2025/2 | Kidney of Asian seabass brooder affected with disease | Vibriosis affected | 2025 | PX116707 |
| 47 | V. harveyi | FCD 2023/4 | Asian seabass fry | Vibriosis affected | 2023 | PX116708 |
| 48 | V. harveyi | FCD 2023/7 | Asian seabass fry | Vibriosis affected | 2023 | PX116709 |
| 49 | V. harveyi | Y1/12/23 | Asian seabass | – | 2023 | PX116710 |
Whole genome sequencing
In the present study, one highly pathogenic strain of V. harveyi (SB1) and 6 representative strains of V. campbellii (LB3, LB10, LB102, LB135, LB198, LB314 and LB503) were sequenced on PacBio RS II and Illumina Novaseq platform. All the strains had chromosome level assembly. V. campbellii strains had two chromosomes while V. harveyi SB1 had two chromosomes and additional 153.4 kb plasmid (Table 2). V. harveyi SB1 has been designated as reference genome at NCBI database, providing key resource for genomic studies. It has the genome size of 5.87 Mb. Comparatively, the genome size of sequenced V. campbellii strains were smaller and ranged between 5.62 Mb (LB198) to 5.74 Mb (LB3).
Table 2.
Whole genome sequencing information and assembly statistics of V. harveyi and V. campbellii strains sequenced in the present study.
| V. harveyi | V. campbellii | ||||||
|---|---|---|---|---|---|---|---|
| SB1 | LB3 | LB10 | LB135 | LB198 | LB314 | LB503 | |
| Sequencing information: PacBio raw reads | |||||||
| No. of Polymerase Reads | 138,596 | 143,067 | 184,843 | 123,094 | 146,450 | 64,680 | 157,065 |
| Number of polymerase read base | 11,981,660,465 | 12,143,024,654 | 15,852,613,494 | 10,619,531,394 | 12,622,234,805 | 5,513,630,052 | 13,708,080,644 |
| Sequencing information: PacBio HiFi reads | |||||||
| Total HiFi reads | 89,477 | 91,529 | 1,23,472 | 73,554 | 95,007 | 39,546 | 97,614 |
| Average length | 8,791.4 | 8,455.8 | 8,006.2 | 11,162.9 | 9,076.5 | 10,089.2 | 10,694.9 |
| Total Base | 786,625,340 | 773,948,040 | 988,538,194 | 821,076,498 | 862,329,476 | 398,988,339 | 1,043,975,381 |
| Sequencing information: Illumina reads | |||||||
| Illumina total reads | 26,158,232 | 18,865,742 | 23,395,124 | 19,926,546 | 20,027,342 | 22,863,006 | 21,956,386 |
| Illumina mean read length | 151 | 151 | 151 | 151 | 151 | 151 | 151 |
| Assembly method | Flye polished by NextPolish | ||||||
| Total length of assembly (Mb) | 5.869 | 5.737 | 5.643 | 5.703 | 5.615 | 5.615 | 5.637 |
| Total number of chromosomes | 2 Choromosomes and 1 Plasmid | 2 Choromosomes | 2 Choromosomes | 2 Choromosomes | 2 Choromosomes | 2 Choromosomes | 2 Choromosomes |
| Average depth in PacBio | 134 | 135 | 175 | 144 | 154 | 71 | 185 |
| Average depth in Illumina | 673 | 496 | 626 | 528 | 539 | 615 | 588 |
| Busco score | 100 | 99 | 100 | 100 | 100 | 100 | 100 |
Average nucleotide identity (ANI)
The ANI is a whole genome similarity matrix and has been presented as heatmap and dendrogram in Fig. 1. The ANIm score threshold of 95% is selected as the criteria to assign a species. The analysis revealed that four strains of V. harveyi (BSW5, BSW7, 1DA3 and KC13.17.5) were misidentified as their ANIm score ranged from 88.4% to 90% with reference to V. harveyi type strain ATCC 14126 T (Fig. 1; Supplementary Table S2). The ANIm score identified these strains as V. campbellii (KC13.17.5), V. jasicida (BSW5 and BSW7) and V. owensii (1DA3). Similarly, three strains of V. campbellii (Tx.T18, VB18PR-0194–1 and VB18PR-0122–1) were found to be misclassified, as they exhibited lower ANIm score (84.7 to 92.8%) relative to V. campbellii type strain CAIM519T. Of these, VB18PR-0194–1 and VB18PR-0122–1 had the closest similarity to V. owensii LMG25443T (ANIm = 94.1%) but did not satisfy the criteria for inclusion within this species. Notably, Tx.T18 appeared the most divergent, with its maximum ANI (94.2%) with V. chagasii LMG21353, a species of the Splendidus clade of Vibrio (Supplementary Fig. S3 and Supplementary Table S3). Overall, ANIm score identified 204 strains as V. harveyi and 78 strains as V. campbellii.
Fig. 1.
Phylogenetic tree of Harveyi clade species based on average nucleotide identity (ANI) generated using pyANI. Vh, V. harveyi; Vc, V. campbellii; Vo, V. owensii; Vj, V. jasicida; Vr, V. rotiferianus; Vp; V. parahaemolyticus
Pangenome analysis and core genome-based phylogeny
Pangenome analysis of 315 strains identified 2,379 core (genes present in 99% of strains), 1,173 soft-core (95—99% strains), 2,527 shell (15—95% strains) and 35,503 cloud genes (< 15% strains), yielding a pangenome of 41,582 genes (Fig. 2A). The curated 82-genome dataset showed an expanded core genome (2595 genes) and markedly reduced cloud (22,132 genes) and pangenome (28,146 genes) (Fig. 2B). The pangenome was found to be open, as inclusion of additional genomic sequences continued to increase the pangenome size (Fig. 2C,D).
Fig. 2.
Pangenome characteristics of Vibrio harveyi and V. campbellii (A) Distribution of pangenome statistics (core, soft-core, shell, cloud and total genes) in 315 genomes datasets. (B) Distribution of pangenome statistics in the curated dataset of 82 genomes. (C) Pangenome accumulation curve based on 315 genomes. (D) Pangenome accumulation curve based on the curated dataset of 82 genomes
Core genome-based maximum-likelihood phylogenies were constructed using the full dataset of 315 genomes and the curated dataset of 82 genomes (Fig. 3A,B). Each recognized species formed a monophyletic lineage supporting clear species boundary within Harveyi clade. Both the phylogenetic analysis consistently placed V. harveyi as an early diverging lineage, clustering closely with V. rotiferianus. In contrast, V. campbellii emerged as the most recently diverged species, showing closer proximity to V. owensii and V. jasicida, which formed a sister-species. V. harveyi appears as a genetically cohesive lineage with minimal internal subdivision, whereas, V. campbellii exhibited greater internal diversification, suggesting ongoing speciation process within the species. Overall, the inferred speciation trajectory within Harveyi clade followed the order of V. parahaemolyticus → V. rotiferianus → V. harveyi → V. jasicida/V. owensii → V. campbellii. The phylogenetic analysis further identified 204 strains as V. harveyi and 78 strains as V. campbellii (Fig. 3A). Similar to ANIm score four V. harveyi strains (BSW5, BSW7, 1DA3 and KC13.17.5) were misidentified. These strains clustered with V. campbellii (KC13.17.5), V. owensii (1DA3), and V. jasicida (BSW5, BSW7). Similarly, three V. campbellii strains were found misidentified. Strain VB18PR-0194–1 and VB18PR-0122–1 clustered adjacent to V. owensii, forming a distinct lineage separated from the V. campbellii groups. Although, these isolates do not form a monophyletic group with V. owensii, their phylogenetic placement indicates a greater genomic affinity to V. owensii than to the canonical V. campbellii cluster. Among the misidentified strains, V. campbellii Tx.T18 was highly divergent, forming a distinct lineage that branched outside even to V. rotiferianus and V. parahaemolyticus.
Fig. 3.
Core-genome based maximum likelihood phylogeny of the Harveyi clade (A) Phylogenetic tree constructed using the dataset of 315 genomes. The tree was generated from a concatenated alignment of 2,379 core genes produced by Panaroo pipeline. (B) Phylogenetic tree constructed using the curated dataset of 82 genomes. The tree was generated from a concatenated alignment of 2595 orthologous core genes produced by Panaroo. Different species are indicated by different color shading. Branches with bootstrap value greater than 75 are highlighted in blue. The strain sequenced in the present study is depicted in blue, whereas misidentified strain are shown in red. V. cha, V. chagasii; Vh, V. harveyi; Vc, V. campbellii; Vo, V. owensii; Vj, V. jasicida; Vr, V. rotiferianus; Vp; V. parahaemolyticus. V. campbellii strains are further classified into three groups: Vc_Gr-L (strains possessing luminescence operon), Vc_Gr-LM (strains carrying luminescence operon flanked with mobile genetic elements), and Vc_Gr-LD (strains harboring luminescence-defective operon). Trees were visualized and annotated using iTOL and InkScape (version 1.4.2)
The core genome-based phylogeny resolved V. campbellii into three major groups: Gr-L (luminescent), Gr-LM (luminescence with mobile genetic elements) and Gr-LD (luminescence-defective) (Fig. 3B). In both the phylogenetic tree, Gr-LD consistently clustered in close association with Gr-LM, suggesting a shared evolutionary history. However, the two phylogenies differed slightly in their clustering pattern of Gr-L group. The highly curated phylogeny revealed a clear evolutionary progression from Gr-L to Gr-LM and ultimately to Gr-LD (Fig. 3B). However, in the 315-genome phylogeny, luminescent Gr-L strains were distributed on either side of the Gr-LM/Gr-LD cluster, reflecting increased topological complexity associated with broader strain diversity. Overall, the Gr-L was the most dominant group, accounting for 83.3% of the strains (65 isolates), and it carried functional luminescence operon. All V. campbellii strains sequenced in the present study were the part of Gr-L group. The Gr-LD constituted the second most dominant group (12.8%; 10 isolates) and included type strain CAIM519T. The Gr-LM comprised three strains, including the model bioluminescent strain BAA-1116.
Comparative genomic metrics
A significant difference (p < 0.001) was observed in key genomic parameters between V. harveyi and V. campbellii. For example, the GC content was significantly higher (p < 0.001; R2 = 0.74) in V. campbellii (45.43 ± 0.02%) compared to V. harveyi (44.94 ± 0.01%) (Fig. 4A). However, the genome size and number of protein coding genes were significantly higher in V. harveyi (5.94 ± 0.02 Mb; 5323 ± 15.63 genes) compared to V. campbellii (5.76 ± 0.03 Mb; 5089 ± 32.82 genes) (p < 0.001; R2 = 0.20 and 0.27, respectively) (Fig. 4B,C). Further, the ANI analysis indicated that V. harveyi is a highly conserved species as the type strain ATCC 14126 showed 0.01–1.43% divergence. In contrast, V. campbellii exhibited higher genomic plasticity, as its type strain CAIM 519T differed 1.00–3.52% from other strains.
Fig. 4.
Comparative analysis of genomic parameters between Vibrio harveyi and V. campbellii and among V. campbellii phylogenetic groups (A–C) Comparative analysis of (A) GC content, (B) genome size, and (C) number of protein-coding genes between V. harveyi and V. campbellii. (D–F) Corresponding comparisons of (D) GC content (E) genome size and (F) number of protein coding-genes among Gr-L, Gr-LM, and Gr-LD groups of V. campbellii. Difference in genomic parameters between V. harveyi and V. campbellii were analysed using a two-tailed independent t-test. Genomic indices among three groups of V. campbellii were compared using one-way ANOVA followed by Tukey’s multiple comparison. V. campbellii strains were classified into three phylogenetic groups; Gr-L (luminescent), Gr-LD (luminescence-defective), and Gr-LM (luminescent with mobile genetic elements) based on core genome phylogeny and synteny organization. Data represent mean ± SE. The level of significance is indicated as: P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***)
Within V. campbellii, notable genomic differences were observed among the three phylogenetic groups. The luminescent groups Gr-L and Gr-LM exhibited higher genomic indices such as elevated GC content (45.5%) (p < 0.001; R2 = 0.43), larger genome sizes (~ 5.80 Mb) (p < 0.001 for Gr-L and p < 0.05 for Gr-LM; R2 = 0.25), and greater number of protein-coding genes (5,137 to 5,394) (p < 0.01; R2 = 0.17) compared to the Gr-LD group (GC content 45.1%; genome size 5.43 Mb; protein-coding genes 4809) (Fig. 4D,F). However, no significant difference (p > 0.05) was observed for these genomic indices between Gr-L and Gr-LM groups.
Mapping of luminescence and sucrose operon
Luminescence (luxCDABEGH) and sucrose (scrRAKB) operons were in silico mapped in 204 strains of V. harveyi and 78 strains of V. campbellii (Fig. 5, Table 3, Supplementary Tables S4, S5, S6 and S7). BLASTP analysis showed 93.1–100% identity for the lux operon against the query sequence (Table 3). Only 2.94% strains of V. harveyi (6 isolates; ATCC 14126, ATCC 33843, Fish5, Fish10, XH2145, and VARA 4 1.1) carried a functional luxCDABEGH operon while one isolate (Hep-2a-10) possessed partial luxBEG operon (Fig. 5). The remaining 197 strains, including V. harveyi SB1 lacked all luminescence-related genes. In contrast, all V. campbellii strains carried either complete or partial lux operon; 83.4% had complete luxCDABEGH operon, 12.8% harboured defective luxBG and 3.8% (3 strains) had an operon with missing luxB or luxC. All V. campbellii strains sequenced in this study carried functional luxCDABEGH operon. Defective luxBG operon were observed in the type strain CAIM 519 T and widely studied strain DS40M4.
Fig. 5.
Distribution of luminescence and sucrose operon genes in Vibrio harveyi and V. campbellii Strains sequenced in the present study has been shown in blue color. Luminescence operon (luxCDABEGH) has been shown as blue color shaded circle while scrRAKB operon as red shaded square. The empty circle/square represents the absence of gene. The tree was visualized and annotated using iTOL. Vh, V. harveyi; Vc, V. campbellii
Table 3.
Protein BLAST of luminescence and sucrose operon.
| Gene | Identity % | Coverage | E value | Bit score |
|---|---|---|---|---|
| Luminescence operon | ||||
| V. harveyi | ||||
| LuxC | 96.9 | 100 | 0 | 927–929 |
| luxD | 97.0–97.4 | 100 | 0 | 616–620 |
| luxA | 98.9 | 100 | 0 | 742 |
| luxB | 98.1–98.5 | 100 | 0 | 668—669 |
| luxE | 97.9–98.4 | 100 | 0 | 778—781 |
| luxG | 93.1–96.1 | 100 | 2.91E-165–3.85E-169 | 458—468 |
| LuxH | 97.4–98.3 | 100 | 1.44E-164–1.71E-168 | 456–466 |
| V. campbellii | ||||
| LuxC | 96.5–100 | 51–100 | 7.29E-167—0 | 471–953 |
| LuxD | 97.4–100 | 100 | 0 | 620–633 |
| LuxA | 98.9–100 | 97–100 | 0 | 726–748 |
| LuxB | 97.5–100 | 74–100 | 0 | 504—679 |
| LuxE | 98.4–100 | 100 | 0 | 782–793 |
| LuxG | 95.3–100 | 100 | 2.23E-168–6.68E-176 | 465–484 |
| LuxH | 98.7–100 | 100 | 2.49E-169–2.19E-172 | 468—475 |
| Scr Operon | ||||
| V. harveyi including operon1 of V423 and V424 | ||||
| scrA | 98.1–98.7 | 52—100 | 0 | 481 −939 |
| scrB | 96.1–97.7 | 99 | 0 | 973—990 |
| scrK | 96.7–98.7 | 61—100 | 0 | 373—617 |
| scrR | 98.8–100 | 100 | 0 | 666—673 |
| V. harveyi V423 and 424 operon2 | ||||
| scrA | 91.65 | 100 | 0 | 865 |
| scrB | 74.32 | 99 | 0 | 769 |
| scrK | 81.31 | 99 | 0 | 512 |
| scrR | 86.89 | 100 | 0 | 586 |
| V. campbellii 170,502 | ||||
| scrA | 98.7 | 100 | 0 | 939 |
| scrB | 96.7 | 99 | 0 | 978 |
| scrK | 98.0 | 100 | 0 | 613 |
| scrR | 99.4 | 100 | 0 | 671 |
Mapping of the scr operon revealed that 89.2% of V. harveyi strains carried a complete and putatively functional scrRAKB operon, containing all genes required for sucrose utilization (Fig. 5). All V. harveyi strains harbored a single scr operon, except strains V423 and V424, which carried two copies. The scrRAKB operon in V. harveyi, including the first operon of V423 and V424, exhibited 96.1% (ScrB) to 100% (ScrR) protein identity against the V. alginolyticus reference sequence (Table 3). In contrast, the second scrRAKB operon of V423 and V424 showed lower identity, ranging from 74.3% (ScrB) to 91.6% (ScrA) with V. alginolyticus. BLASTP analysis indicated that these second operon shared the highest identity (95.8% for ScrB to 99.1% for ScrR) with V. crassostreae and V. toranzoniae, members of the Splendidus clade of Vibrio (Supplementary Table S8).
Despite high prevalence, 10.8% of V. harveyi strains lacked one or more scr genes. Notably, 6.4% (13 strains) lacked only the scrA gene. Nucleotide BLAST revealed that 12 of these strains carried scrA with ≥ 98.4% nucleotide identity, but with disruptive mutations. Nine strains had a guanine deletion at 628th position, within a stretch of seven consecutive guanines, causing a frameshift (Supplementary Fig. S4). Additional mutations included a C → T substitution at position 178 introducing a premature stop codon, and an insertion at position 710 resulting in a frameshift. Among the examined 204 V. harveyi strains, only strain 345 lacked all four scrRAKB genes. In contrast, among 78 V. campbellii strains, all lacked the scr operon except strain 170502, which showed 96.7% (scrB) to 99.4% (scrR) identity with V. alginolyticus 170502.
Syntenic organization of luminescence and sucrose operon
In V. campbellii, the bioluminescence operon is located on chromosome 2 and organized syntenically as luxCDABEGH (Fig. 6A). Three distinct syntenic patterns for luminescence operon were noticed in V. campbellii. A) Functional luxCDABEGH operon (LB503 type): Present in the Gr-L group, this is the most dominant pattern and observed in 83.4% V. campbellii strains. The group is represented by highly luminescent strain LB503 (sequenced in this study). The operon is flanked upstream by an LruC domain-containing protein and downstream by molybdenum utilization genes (MoeB and MoeA). B) Functional operon with mobile genetic elements (BAA-1116 type): This is found in Gr-LM group (three strains; BAA-1116, BB120 and MP1). This pattern retains a functional luxCDABEGH operon with downstream MoeB and MoeA, but is flanked upstream by pseudo IS4 and IS3 type transposase, disrupting LruC, forming a potential hotspot for horizontal gene transfer. C) Defective luxBG (CAIM519T type): Observed in the Gr-LD group (including type strain CAIM 519ᵀ and DS40M4), this pattern retains flanking lruC upstream and moeB/moeA downstream but lacks luxCDAEH, indicating partial operon loss without disruption to surrounding genes. In V. harveyi, the luxCDABEGH operon is similarly located on chromosome 2 with flanking regions analogous to the LB503 type and lacks nearby mobile genetic elements.
Fig. 6.
Syntenic organization of luminescence operon (A) and scrRAKB operon (B) in Vibrio harveyi and V. campbellii Vh, V. harveyi; Vc, V. campbellii; Va, V. alginolyticus. T3SS indicates start of T3SS operon by VopD. The luxCDABEGH operon and scrRAKB operon is represented by orange color. Blue color is representing the presence of transposable elements. The tree was generated using EasyFig and annotated using InkScape (version 1.4.2)
The syntenic organization of the scrRAKB operon is presented in Fig. 6B. In V. harveyi SB1, the operon is arranged as scrRAKB, similar to V. alginolyticus. However, few notable differences were also observed. In V. alginolyticus, scrRAKB is located on chromosome 2 with no genes of the type 3 secretion system (T3SS) in proximity. In contrast, in V. harveyi SB1 it is located on chromosome 1, with complete 29-gene T3SS operon at upstream. The upstream flanking genes include carbohydrate porin, carboxymuconolactone decarboxylase, a MerR transcriptional regulator, and T3SS. The downstream flanking genes include Yjdm, an ABC transporter, siderophore biosynthesis genes, and a class I SAM-dependent methyltransferase. The first scrRAKB operon of V. harveyi V423 and V424 displayed a syntenic pattern identical to SB1. However, the second operon in these strains showed evidence of horizontal gene transfer, being flanked upstream by a complete IS110 and a pseudogene of IS5, and downstream by a complete IS30, and pseudogenes of IS5, IS21, and IS982. In V. campbellii 170502, scrRAKB is also located on chromosome 1 adjacent to T3SS, with signs of horizontal gene transfer, as it lies in a mobile genetic hotspot flanked by IS4 and IS200/IS605 transposases.
Phylogenetic analysis of lux and scr operon
Phylogenetic reconstructions of the lux and scr operons are presented in Figs. 7A,B. The concatenated LuxCDABEG protein sequences from six V. harveyi strains formed a distinct monophyletic group, suggesting a shared evolutionary origin of their luminescence operons. Further, it clustered together with V. campbellii, and the closest sister group comprised three strains (V. campbellii LB102, LB198, and LB314) sequenced in this study.
Fig. 7.
Maximum likelihood Phylogenetic analysis of concatenated sequence of luminescence (LuxCDABEG) (A) and ScrRAKB (B) in V. harveyi and V. campbellii. The strains having full set of LuxCDABEG and ScrRAKB were selected for phyologenetic analysis. V. vulnificus ATCC 43382 served as outgroup for bioluminescence and V. alginolyticus ATCC 17749 for ScrRAKB clustering. Strains sequenced in the present study has been shown in blue color. Bootstrap value of more than 0.75 has been shown as star. Increasing size of star indicates higher bootstrap value. The tree was visualized and annotated using iTOL. Vh, V. harveyi; Vc, V. campbellii; Vv, V. vulnificus; Va, V. alginolyticus
In the present study, both V. harveyi V423 and V424 harbored two scr operons. The first operon (operon1) in both strains clustered with other V. harveyi, showing closest phylogenetic relation with V. harveyi ISF-200–6, consistent with their taxonomy. In contrast, the second operon (operon2) formed a distinct outgroup to all V. harveyi and V. alginolyticus strains, suggesting a possible acquisition via horizontal gene transfer (HGT) from distantly related donors. Evidence of HGT was also found in V. campbellii 170502, whose concatenated ScrRAKB protein sequence clustered within the V. harveyi group, showing highest similarity to V. harveyi strains such as Y6, 2020 V-1021, VB18PR-0039–2, and Vh427, implying possible acquisition from a V. harveyi-like ancestor.
Mobilome analysis
Mobilome analysis results are presented in Table 4 and supplementary Tables S9, S10, S11 and S12. Among six V. harveyi strains carrying luminescence operon, five had chromosome-level assemblies with operon consistently located on chromosome 2. The mobilome analysis revealed that IS element counts on chromosome 2 ranged from 0 to 5, with the closest IS located 117.1 kb (ATCC 14126) to 683.9 kb (ATCC 33843) from the lux operon. Further, among analyzed strains, an intact prophage (12B12) was detected on chromosome 2 in V. harveyi Fish10 which is positioned 98.9 kb from the lux operon. The other mobilome types like integrative/conjugative elements (ICE/IME/T4SS), integrons, and CALINs (clustered attC sites lacking integrase) were absent in these strains on chromosome 2. Overall, no mobile genetic elements were detected within 50 kb of the luminescence operon, suggesting its location in a genomically stable region.
Table 4.
Distribution of mobile genetic elements in Vibrio harveyi and V. campbellii strains suspected for horizontal gene transfer of the luminescence and scr operon.
| Strains | Accession | Chr/contigs | Luminescence/scr operon coordinates (bp) | Complete integron | CALINs | IS | ICE/IME/T4SS | Prophage | MGE proximity to luminescence/scr operon |
|---|---|---|---|---|---|---|---|---|---|
| Luminescence operon (luxCDABEGH) | |||||||||
| V. harveyi ATCC 14126/FDAARGOS_109 | GCA_001471575.2 | LOSK02000001.1(Chr II) |
1,384,022 - 1,391,131 |
0 | 0 |
4 (1266958_1267701) |
0 | 0 | 117.1 kb |
| V. harveyi ATCC 33843 | GCA_000770115.2 | CP009468.1 (Chr II) | 318,403–325,512 | 0 | 0 | 5 | 0 | 0 | 683.9 kb |
| V. harveyi XH2145 | GCA_021397735.1 | CP090178.1 (Chr II) |
373,388 - 380,497 |
0 | 0 |
4 (496818_497561) |
0 | 0 | 123.2 kb |
| V. harveyi Fish5 | GCF_028898825.1 | NZ_CP118585.1 (Chr II) |
1,410,033 - 1,415,017 |
0 | 0 |
1 (994039_995403 |
0 | 0 | 416.2 kb |
| V. harveyi Fish10 | GCF_028898705.1 |
(Chr II) |
1,968,092 - 1,975,201 |
0 | 0 | 1 | 0 |
1 (Intact; 12B12) 2,074,095–2,100,556) |
98.9 kb from prophage and 204.7 kb from IS |
| V. harveyi VAR A4 1.1 | GCA_049311325.1 | Contig18 |
11,063- 18,172 |
0 | 0 | 0 | 0 | 0 | No |
| ScrRAKB operon | |||||||||
| V. harveyi V424 | GCA_050017355.1 | JBNGUA010000001 | 980,982—986,207 | 0 | 0 |
7 (976,471–1,008,584) |
0 | 0 | Seven IS elements flank 2nd scr operon |
| V. harveyi V423 | GCA_050017375.1 | JBNGUB010000002 | 356,055—361,280 | 0 | 0 |
7 (351,544—383,657) |
0 | 0 | Seven IS elements flank 2nd scr operon |
| V. campbellii 170502 | GCA_003691485.1 |
(Chr 1) |
1,214,367—1,219,603 |
1 (2,061,932–2,070,280) |
4 ( 2,019,323–2,057,584) |
30 | 0 | 0 | Two IS elements flank scr operon |
Potential HGT of the scr operon was assessed V. harveyi V423, V. harveyi V424, and V. campbellii 170502, where the operons were located on contigs JBNGUB010000002, JBNGUA010000001, and Chromosome 1, respectively. No prophage or ICEs were found near the operons. However, the second scr operon in both V. harveyi strains was flanked by seven IS elements and V. campbellii 170502 by two IS elements, suggesting possible HGT. Although V. campbellii 170502 carried integrons on chromosome 1, these were located 842 kb from the scr operon, indicating no direct association.
Phenotypic validation of luminescence and sucrose utilization in V. harveyi and V. campbellii
Eighteen V. harveyi and thirty-one V. campbellii strains were phenotypically characterized for luminescence (Fig. 8A and B). Among V. harveyi, only the type strain ATCC 14126 was luminescent, consistent with the presence of functional luminescence operon by in silico analysis. In contrast, all V. campbellii strains were luminescent, except the type strain CAIM519T, which was sole non-luminescent strain. Luminescence intensity varied markedly, ranging from a 1,582-fold increase in V. harveyi ATCC 14126 to a 133,166-fold increase in V. campbellii LB164, relative to the negative control. The model strain V. campbellii BAA-1116 demonstrated an 80,870-fold increase, underscoring substantial inter-strain variability.
Fig. 8.
Luminescence behaviour and sucrose utilization in V. harveyi and V. campbellii (A) Luminescence on Zobell marine agar by representative strain of V. campbellii. (B). Luminescence by different strains of V. harveyi (n = 18) and V. campbellii (n = 31) at 12 h of incubation. (C). Yellow and green colouration on TCBS agar. Number 1 to 18 (yellow colony) represents eighteen strain of V. harveyi. All strains of V. campbellii produced green colonies. Therefore, number 19 to 30 is representative strains of V. campbellii (green colony) (D). Growth of V. harveyi (n = 18) and V. campbellii (n = 31) in M9-Sucrose medium
To validate in-silico findings on sucrose utilization, the same 49 isolates were screened on TCBS agar containing sucrose (Fig. 8C). All V. harveyi strains produced yellow colonies (scr+ phenotype), whereas all V. campbellii strains formed green colonies (scr- phenotype). Growth kinetics in well-defined M9 medium with 1% sucrose (Fig. 8D) further confirmed these results: V. campbellii strains showed no growth, while 100% V. harveyi isolates recorded growth in the medium. Among V. harveyi, Y1/12–23 exhibited the highest growth while the isolate LMG 19643 had the lowest growth.
PCR screening of luxA and scrA genes
The presence of luminescence operon in V. harveyi and V. campbellii was further verified in the 49 selected isolates by PCR screening of the luciferase gene luxA (Fig. 9A,B and supplementary Fig. S5 A, B, C, D). Consistent with phenotypic observations, among V. harveyi only the type strain ATCC 14126 produced the expected 828 bp amplicon, whereas all V. campbellii isolates, except the type strain CAIM519T produced the amplicon. Sucrose utilization was further verified by screening scrA gene (Fig. 9C,D). All V. harveyi strains produced the desired 698 bp amplicon, confirming the presence of scrA gene. In contrast, no V. campbellii strain produced an amplicon, indicating the absence of scrA in this species.
Fig. 9 .
Gel picture showing presence of luxA (A and B) and scrA (C and D) gene. (A) and (B): M, 100 bp ladder; L1 to L18 represents 18 V. harveyi strains (L1, ATCC 14126; L2, LMG 7890; L3, LMG 19643; L4, SB1; L5, V2301; L6, V2426; L7, V2427; L8, V2432; L9, V2437; L10, V2438; L11, V2439; L12, V2441; L13, V2452; L14, Y/12–23; L15, Y2/12–23; L16, FCD2023/4; L17, FCD2023/7; L18, FCD2025/2) L19, Negative control for V. harveyi; L20 to L50 represents 31 V. campbellii strains (L20, LMG11216/CAIM 519 T; L21, BAA-1116; L22 to L50, 29 strains between LB1 to LB516; L51, Negative control for V. campbellii). (C)and (D): Distribution of scrA gene. M; 100 bp ladder; L1 to L18 represents 18 V. harveyi strains having desirable 698 bp amplicon. L19, Negative control for V. harveyi; L20 to L50 represents 31 V. campbellii strains with missing scrA gene. L51: Positive control for scrA using V. alginolyticus. L52: Negative control for V. campbellii
Discussion
V. harveyi is a major pathogen in aquaculture causing diseases in shrimp and fishes. There are several reports of misidentification of V. harveyi with closely related species like V. campbellii, V. owensii and V. jasicida2,16,17,44. Average nucleotide identity (ANI) and core genome-based phylogeny identified seven misidentified strains; four labelled as V. harveyi (BSW5, BSW7, 1DA3 and KC13.17.5) and three as V. campbellii (Tx.T18, VB18PR-0194–1 and VB18PR-0122–1) (Fig. 1 and 3A). Consistent with earlier studies, KC13.17.5 was reclassified as V. campbellii, BSW5 and BSW7 as V. jasicida45 and 1DA3 as V. owensii20. The two V. campbellii (VB18PR-0194–1 and VB18PR-0122–1) strains exhibited ANIm values of 94.1% with V. owensii and 92.8% with V. campbellii, placing them below the 95% species delineation threshold46, suggesting affiliation with V. owensii or a distinct lineage within Harveyi clade. Among all misidentified strain, V. campbellii Tx.T18 was most divergent and exhibited ANIm score of only 84.7% with V. campbellii and other strains of Harveyi clade. Further analysis revealed that it had maximum ANIm score of 94.2% with V. chagasii a member of Splendidus clade (Supplementary Table S3). Overall, ANI and core genome-based phylogeny confirmed 204 strains as V. harveyi and 78 as V. campbellii.
High-quality genome sequences enable clear reconstruction of evolutionary patterns. To investigate the speciation within the closely related Harveyi clade (V. harveyi, V. campbellii, V. owensii, V. jasicida, V. rotiferianus and V. parahaemolyticus), we constructed two core genome-based phylogenies. The first, based on 315 genomes, primarily aimed to identify misclassified strains and provide a framework for screening bioluminescence and sucrose utilization. For this dataset, we relaxed genome-quality thresholds (upto 1000 contigs) to include historically important strains (e.g., V. harveyi ATCC 35,804, CAIM 148, CAIM 464, CAIM 1075; V. campbellii CAIM 115), which were sequenced earlier and had highly fragmented genomes (Supplementary Table S1). To overcome this limitation, we constructed a curated dataset of 82 strains using mostly complete genomes (Supplementary Table S1). Phylogenetic analysis of both the datasets revealed a consistent evolutionary trajectory within the Harveyi clade; V. parahaemolyticus → V. rotiferianus → V. harveyi → V. owensii/V. jasicida → V. campbellii. In this topology, V. harveyi represents an earlier-diverging lineage, whereas V. campbellii emerges as the most recently evolved species45. The concordance of this evolutionary pattern across datasets of different genome quality underscores the robustness of the inferred speciation framework and provides a reliable phylogenetic context for evolution of trait like bioluminescence.
V. harveyi has traditionally been described as luminescent bacterium and luminescence served as a distinctive and easily observed phenotypes for its identification1,23,26,47. However, our earlier work demonstrated that all luminescent bacterial isolates initially suspected as V. harveyi were in fact V. campbellii2. Similarly, in another similar study, 93% of strains presumed as V. harveyi were re-identified as V. campbellii17. This high rate of misidentification prompted us to re-examine luminescent properties in V. harveyi and V. campbellii. Contrary to the earlier reports describing V. harveyi as luminescent bacterium, our genomic analysis revealed that 97.1% of the 204 V. harveyi strains lacked luxCDABEGH operon and were therefore predicted to be non-luminescent (Fig. 5). Further, only six strains (2.9%) carried the operon, retaining the genetic capacity for bioluminescence. Of these lux-positive strains, only the type strain ATCC 14126 was available for phenotypic testing, and it exhibited luminescence consistent with its genomic profile (Fig. 8B). Similarly, Nakayama et al.48 reported that only one out six V. harveyi strains tested exhibited luminescence. Defoirdt et al49 further compared luminescence in seven V. campbellii and six V. harveyi strains. They reported luminescence in five V. campbellii strains and only one V. harveyi strain (BB120). Notably, BB120 was later reclassified as V. campbellii16. Thus, evidence from the present study and previous study strongly suggests that V. harveyi is predominantly a non-luminescent bacterium.
In the present study, only six out of 204 analyzed V. harveyi strains carried luxCDABEGH operon while the majority lacked all associated genes (Fig. 5). Phylogenetic analysis of the concatenated protein sequence of the operon revealed that these strains clustered closely with V. campbellii, a pattern incongruent with the core genome-based phylogeny. The HGT of luminescence operon has been previously documented in Vibrio species such as V. vulnificus VVL1 and V. chagasii 21N-12 and SB-5250, supporting the possibility of inter-species transfer. However, in the present study, no mobile genetic elements were detected within 50 kb of the operon (closest located at 98.9 kb), indicating that, if HGT occurred, it was likely ancient followed by stablisation of the operon. Although speculative, these strains may represent a remnants of an ancestral luminescent V. harveyi population, now largely lost across the species due to niche-specific selective pressures that rendered bioluminescence dispensable. However, further study is needed to conclusively determine the evolutionary origin of luminescence operon in V. harveyi.
In the present study, each strain of V. campbellii carried either a functional luxCDABEGH (87.2% strains) or a defective luxBG variant (Fig. 5). Phenotypically, 30 out of tested thirty-one isolates were luminescent and carried luxA gene (Fig. 9A), confirming the high prevalence of bioluminescence within this species. These findings strongly suggests that V. campbellii is inherently a luminescent bacterium and corroborate previous reports implicating this species as a causative agent of luminescent vibriosis in shrimp hatcheries2,51. Core genome-based phylogeny clustered V. campbellii into three major groups; Gr-L (luminescent), Gr-LM (luminescence operon with mobile genetic elements), and Gr-LD (luminescent defective) (Fig. 3B,C). Notably, in both the phylogenetic reconstructions, the Gr-LM and Gr-LD groups clustered together, suggesting that the presence of insertion sequences may have induced structural instability, ultimately leading to partial deletion of operon in Gr-LD. The strong phylogenetic concordance between synteny-based grouping and core genome-based phylogeny supports that bioluminescence in V. campbellii is not merely an accessory trait but an evolutionary conserved and functionally significant phenotype. This may reflect the adaptive advantage conferred by bioluminescence in natural marine environments, such as facilitating intercellular communication and niche colonization. As bioluminescence is tightly regulated by quorum sensing, a regulatory system that also governs virulence, colonization and other physiological processes, future research should investigate how distinct syntenic groups influence virulence potential and ecological adaptability of V. campbellii.
Despite the dominance of luminescent properties in V. campbellii, a sub-set (12.8%) of strains including type strain CAIM519T, carried a dysfunctional luxBG operon and lacked luxCDAE genes (Fig. 6A). Core genome-based phylogeny clustered these strains into a distinct luminescence-defective (Gr-LD) group, suggesting a common evolutionary origin and conserved pattern of operon loss. Notably, the phylogeny also showed that the Gr-LD lineage clusters closely with the luminescence group flanked with mobile genetic elements (Gr-LM), representing the evolutionary transition (Fig. 3B). This highlights that the unstable luminescence operon within Gr-LM strains may have served as precursor for gene loss and emergence of the Gr-LD lineage. Consistent with this trajectory, Gr-LD strains exhibited significantly lower GC content, smaller genome size and reduced protein-coding genes compared to luminescent groups (Gr-L and Gr-LM) (Fig. 4E,F). Similar pattern has been reported for V. campbellii DS40M4, which lack luxCDAE and key quorum sensing genes such as luxM,—responsible for synthesizing autoinducer-1, a homoserine lactone signal molecule, along with markedly reduced regulon52. Several earlier studies have suggested that V. campbellii comprises two to three genomically distinct subgroups45,53. Our findings further support these findings as phenotypically V. campbellii segregate into luminescent (Gr-L and Gr-LM) and luminescent defective (Gr-LD) groups. Notably, most Gr-LD strains originated from offshore, deep-sea environments ranging from the surface to hadal depths (> 6000 m), consistent with niche-driven reductive evolution54. We hypothesize that as part of ecological adaptation in low-nutrient environments, these strains may have evolved to abandon quorum sensing-regulated community behaviours, such as bioluminescence, in favor of solitary survival strategies.
Colony morphology on TCBS agar serves as widely used test in the presumptive identification of Vibrio spp. In the past, several studies reported V. harveyi as non-sucrose fermenter (green colony on TCBS agar)24,35,36. On the contrary, few studies found V. harveyi as sucrose fermenter (yellow colony on TCBS agar)37,38. In the present study, all 18 V. harveyi isolates including the type strain ATCC 14126, produced yellow colonies (Fig. 8C), and grew luxuriantly in M9 minimal medium with sucrose as sole carbon source (Fig. 8D). Additionally, all isolates harbored the sucrose uptake gene (scrA) (Fig. 9C), consistent with their fermentation phenotype. Although phenotype testing was done on a limited number of strains, a complementary in silico analysis of 204 V. harveyi genomes revealed that 89.5% harbor a complete scrRAKB operon. This suggests that majority of V. harveyi strains have the metabolic capacity for sucrose utilization. The discrepancy in earlier reports may reflect strain-level variation, misidentification, or limitations in phenotypic characterization methods. This underscores the value of combining phenotypic and genomic data to define species-level metabolic traits within the Vibrio genus.
ScrA plays a critical role in sucrose metabolism by mediating the uptake via phosphoenolpyruvate-dependent carbohydrate phosphotransferase systems (PTS). It has been reported that mutation in scrA can abolish sucrose utilization55. In the present study, BLASTP analysis indicated absence of ScrA in 6.4% (13 out of 204) V. harveyi strains. Subsequent BLASTN analysis showed high sequence identity (95 to 98.6%) against the scrA gene of V. harveyi SB1 suggesting the gene presence in these isolates. However, multiple sequence alignment revealed frameshift mutation (10 strains) or immature stop codon (1 strain). It is well-established that microbial populations often exhibit phenotypic heterogeneity, and up to 10% of bacterial strains can naturally lack a particular phenotype due to genetic variation, and other potential differences in transcription, translation and regulatory mechanisms56,57. This raises the likelihood that a subset of V. harveyi strains harbor inactivating mutation in scrA, leading to a non-sucrose-fermenting phenotype. Notably, the mutation hotspot coincided with a missing guanine at position 628 within a homopolymeric G-rich region (seven consecutive guanines spanning positions 622–628). Many of these isolates were sequenced using Oxford Nanopore sequencing technology which is known to have elevated base-calling error rates, especially within homopolymeric stretches58. Interestingly, one isolate (94/17) has been phenotypically characterized and reported to ferment sucrose59, suggesting that scrA is likely intact and functional in few of these strains. Collectively, the presence of frameshift mutation in scrA provide genetic basis for the non-sucrose-fermenting phenotype and highlight the role of gene-level variation in shaping metabolic diversity.
In the present study, mapping of the scr operon in 78 isolates of V. campbellii revealed its absence in all the strains except V. campbellii 170,502 (Fig. 5). The lack of sucrose utilization in V. campbellii was further supported by phenotypic study; all 31 tested strains produced green colonies on TCBS agar, failed to grow in M9-sucrose medium and lacked scrA gene. These findings support earlier reports that V. campbellii is a sucrose non-fermenter2,6. Based upon these studies it could be concluded that V. campbellii is a non-sucrose fermenter and form green colonies on TCBS agar. Among all examined strains, only V. campbellii 170,502 carried the scrRAKB operon. This was flanked by IS4 and IS200/IS605 family transposases and clustered phylogenetically with V. harveyi, strongly suggesting acquisition via horizontal gene transfer (HGT) from V. harveyi. Additional evidence for scr operon mobility was observed in V. harveyi strains V423 and V424, each carrying two distinct scr operons. While one operon clustered with other V. harveyi strains, the second formed an outgroup even to V. alginolyticus. BLAST analysis indicated highest identity with the scr operons of V. crassostreae and V. toranzoniae, both members of the Splendidus clade, suggesting interclade HGT. Mobilome analysis and synteny further revealed that the second scr operon in these strains was flanked by seven transposable elements, reinforcing the likelihood of acquisition via HGT. Similarly, HGT for scr operon has been reported in V. parahaemolyticus60 and Photobacterium damselae susbsp damselae55. Given that sucrose is the most abundant disaccharide in nature, acquisition of the scr operon likely confers a selective advantage by enabling utilization of diverse ecological niches, thereby favoring its horizontal transfer via transposable elements.
In the present study, V. harveyi appears to function as a niche specialist, with most strains isolated from marine animals, 43 different hosts including humans, indicating strong adaptation to host-associated environments. In contrast, V. campbellii behaves as an ecological generalist61,62, being predominantly free-living in seawater, with host adaptation mostly limited to crustaceans. These ecological distinctions align with key phenotypic trait: V. harveyi as mostly non-luminescent consistent with host-associated requirements, whereas V. campbellii luminescent favorable for free-living or planktonic survival62. Collectively, the ecological, phenotypic, and genomic contrasts highlight that niche specialization in V. harveyi versus ecological generalism in V. campbellii has been a major driver of their evolutionary divergence and ongoing speciation within the Harveyi clade.
The present study combines the genome-wide in silico analysis of 282 strains (204 V. harveyi and 78 V. campbellii) with phenotypic validation of 49 representative isolates (18 V. harveyi and 31 V. campbellii) to assess bioluminescence and sucrose utilization. While this approach yielded robust comparative genomic insights, the phenotypic dataset represents only a subset of strains. As a result, our conclusions comparatively rely more on the in silico predictions, and it is possible that certain phenotypic variations were not captured within the tested isolates. Nonetheless, the integration of extensive genomic mapping with targeted phenotypic validation offers a strong framework for understanding these phenotypic traits in two major aquatic pathogens. Studies incorporating larger datasets across diverse geographic and ecological sources will further help to refine and validate these findings.
Conclusion
Bioluminescence and sucrose utilization in V. harveyi and V. campbellii were characterized by genome-wide operon mapping with targeted phenotypic validation. The distribution of bioluminescence (LuxCDABEGH) and sucrose (ScrRAKB) operons suggested V. harveyi as primarily non-luminescent, sucrose fermenter (yellow-colony on TCBS agar), whereas V. campbellii is predominantly luminescent and sucrose non-fermenter (green colonies). While the study provides a practical framework for presumptive identification of these two important aquatic pathogens, conclusions rely largely on in silico prediction as phenotypic validation was limited to a smaller subset of strains. Expanded phenotypic validation with broader strain diversity will further strengthen these findings.
Methods
Bacterial strains for genomic and phenotypic study
Bacterial strains for in silico analysis
A total of 374 genome assemblies (238 V. harveyi and 136 V. campbellii) were retrieved from NCBI GenBank collected during 1935 to 2024 (June 2025; Supplementary Table S1). A total of 59 accessions (13 V. harveyi and 46 V. campbellii) were excluded due to redundancy. This included 38 accessions for V. campbellii strain MP1 (sequenced for 39 times; MP1_replicate1 to MP1_replicate39)63. Additional duplicity for V. campbellii comprised two accessions for type strain CAIM519T, one each for DS40M4, 151112 C, and HQB174 as well as three ENA-EUAN accessions (selected corresponding NCBI accession). For V. harveyi, duplicate included four accessions corresponding to type strain ATCC 14126 (which was sequenced for five times), five ENA-EUAN accessions, and one accession each for VH2, A2, 94/17 and HQB-19 (Supplementary Table S1). An additional 21 accessions (12 V. harveyi and 9 V. campbellii) were removed due to poor genome assembly (> 1000 contigs or < 4000 protein coding genes), and six accessions (five V. harveyi and one V. campbellii) for lacking annotated CDS at NCBI database. This filtering yielded 288 genomes (208 V. harveyi, 80 V. campbellii). To investigate evolutionary relationships and speciation patterns, we incorporated an additional 27 genome sequences from closely related species like V. parahaemolyticus (n = 5), V. rotiferianus (n = 4), V. jasicida (n = 9) and V. owensii (n = 9). This original dataset of 315 genomes were subjected for pangenome analysis, core genome-based phylogeny and average nucleotide identity (ANI) calculations. The analysis identified 282 strains comprising 204 V. harveyi and 78 V. campbellii and rest as misidentified strains belonging to other species. These 282 strains were subsequently used for genome wide in silico mapping of the bioluminescence and sucrose operon.
To better resolve phylogenetic relationship within the Harveyi clade, we generated a second set of dRep64 filtered dataset (ANI threshold 99.9%; sa = 0.999; completeness ≥ 98%; contamination ≤ 5%). This refined dataset comprised 82 genomes, including V. harveyi (n = 34), V. campbellii (n = 24), V. owensii (n = 8), V. jasicida (n = 8), V. rotiferianus (n = 3), and V. parahaemolyticus (n = 5) (Supplementary Table S1). All species were represented by complete genome assemblies, except V. jasicida, which included one complete reference genome and seven high-quality draft assemblies (< 100 contigs).
Bacterial strains for phenotypic study and their molecular confirmation
In silico results were verified by phenotypic characterization and PCR screening of marker genes in 49 bacterial isolates; 18 V. harveyi and 31 V. campbellii (Table 1). V. harveyi isolates were recovered from disease affected Asian seabass (L. Calcarifer), Penaeus japonicus and P. vannamei while V. campbellii isolates were recovered from P. monodon and P. vannamei hatcheries and farms. Identity of these isolates was confirmed by multiplex PCR21 and partial sequencing of RNA polymerase sigma factor (rpoD) using published primers65 (Table 5). Overall, 3 strains of V. harveyi (SB1, ATCC 14126 and ATCC 35084) and 9 strains of V. campbellii (CAIM519T, BAA-1116, LB3, LB10, LB102, LB135, LB198, LB314 and LB503) were the part of in silico as well as phenotypic analysis.
Table 5.
Primers sequence used for the characterization of bacterial isolates (rpoD) and confirmation of luciferase (luxA) and sucrose uptake (scrA) gene.
| Sl. No | Gene | Primer sequence | Amplicon length | Reference |
|---|---|---|---|---|
| 1 | rpoD |
70F: ACGACTGACCCGGTACGCATGTAYATG MGNGARATGGGNCANGT 70R: ATAGAAATAACCAGACGTAAGTTNGC Y TCNACCATYTCYTTYT |
780 | 65 |
| 2 | luxA |
5F: AATTTGGAAACTTCCTTCTCACTTA 5R: TCACGCCATTGACCTTTATT |
828 | This study |
| 3 | scrA |
F196: GGATCAGGCATCGTAAACCA R196: CAGTTCAGACCATCACCCAATA |
698 | This study |
Whole genome sequencing
Whole genome sequencing was carried out for highly pathogenic V. harveyi SB1 and six representatives V. campbellii strains (LB3, LB10, LB135, LB198, LB314 and LB503). V. harveyi SB1 originated from vibriosis affected Asian seabass while V. campbellii strains were isolated from shrimp hatcheries and farm (Table 1). The genomic DNA was extracted using DNeasy Blood & Tissue Kits (Qiagen) according to the manufacturer’s instructions. The purity, concentration and integrity of the extracted DNA were determined using a NanoDrop 2000 (Thermofisher Scientific, Massachusetts, USA), Qubit 3.0 fluorometer (Thermofisher Scientific, Massachusetts, USA) and Agilent FEMTO pulse analyser (Agilent Technologies, California, USA), respectively. The whole genome sequencing was carried out at PacBio RS II and Illumina platform. For PacBio RSII sequencing, the DNA shearing was performed on Megaruptor 3 (Diagenode, Belgium) system. The SMRTbell library was constructed using the SMRTbell Express template Preparation Kit 2.0 (Pacific Biosciences, California, USA). The purified libraries were sequenced on SMRTcells containing 8M ZMW and sequenced in PacBio Sequel II system in CCS/HiFi mode at Nucleome Informatics, Hyderabad, India. For Illumina read, the library was constructed using the KAPA Hyper plus kit as per manufacturers’ protocol. The prepared libraries were quantified using Qubit 3.0 fluorometer (Thermofisher Scientific, Massachusetts, USA) and size of DNA was checked on Agilent 2100 bioanalyzer. The pooled libraries were sequenced using Illumina novoseq 6000 S4 flow cell.
Genome assembly was performed with the Flye 2.8.166 tool in the –pacbio-hifi mode. Polishing of these contigs for base errors and indels were carried out with Illumina short reads using NextPolish 1.4.067 brought the base consensus quality to 99.99%.
Average nucleotide identity
To determine the degree of genomic relatedness, pairwise average nucleotide identity (ANI) was calculated using the program Pyani v0.2.12 with MUMmer (ANIm)68. Standard threshold of 95% identity and 70% sequence coverage was considered for species delimitation46. The result was visualized using an heatmap generated by the R package gplots (https://cran.r-project.org/web/packages/gplots/index.html).
Pangenome analysis and core genome-based phylogeny
Pangenome analysis was performed using Panaroo pipeline69, which employ graph-based filtering and alignment-correction strategies to retain conserved orthologs while removing spurious gene calls and collapsed paralogs. Panaroo was run with the options –clean-mode moderate using the.gff3 files generated by Prokka70. The pangegnome accumulation curve were generated in R using custom script in Rstudio. Core genome-based phylogeny was constructed using 2,379 single-copy orthologus genes identified by Panaroo, aligned with MAFFT and trimmed by trimal under the automated1 setting71. Maximum-likelihood phylogenetic tree was inferred using IQ-tree 2 (v 2.2.6)72 under the best-fit substitution model GTR + F + I + R10. Node support was estimated using 1000 ultrafast bootstrap replicates, and the resulting phylogenetic tree was visualized using iTol73. A second core genome phylogeny was constructed on the curated dataset of 82 genomes following the same workflow (Panaroo → MAFFT → trimAl → IQ-TREE2). In this dataset, 2,595 single-copy orthologus genes were used and phylogenetic inference was again performed under the automatically selected GTR + F + I + R10 model with 1,000 bootstrap replicates.
Genome wide mapping of bioluminescence and sucrose pathway in V. harveyi and V. campbellii
Mapping of bioluminescence (luxCDABEGH) and sucrose (scrRAKB) operons was carried out using query protein sequence described in Table 6. V. campbellii BAA 1116, a model strain for bioluminescence, was used as query sequence for luxCDABEGH29 while well-characterized V. alginolyticus ATCC 17749 served as query sequence for scrRAKB operon33,34. The protein BLAST with 50% minimum identity, query coverage and e value of 0.0001 considered as strain carrying the gene. The gene distribution pattern of luxCDABEGH and scrRAKB operons were visualized using iTOL with phylogenetic tree drawn from core genome-based phylogeny73.
Table 6.
Query sequence used for mapping of luminescence (LuxCDABEGH) and sucrose (ScrRAKB) operon in Vibrio harveyi and V. campbellii.
| Sl. No | Gene name | Gene accession | Gene description | Query organism | Reference |
|---|---|---|---|---|---|
| Bioluminescence (LuxCDABEGH operon) | |||||
| 1 | LuxC | AGU98399.1 | Fatty acid reductase | V. campbellii BAA-1116 | 29 |
| 2 | LuxD | AGU98400.1 | Myristoyl-ACP-specific thioesterase | ||
| 3 | LuxA | AGU98401.1 | Luciferase alpha chain | ||
| 4 | LuxB | AGU98402.1 | Luciferase beta chain | ||
| 5 | LuxE | AGU98403.1 | Long-chain-fatty-acid luciferin-component ligase | ||
| 6 | LuxG | AGU97355.1 | NAD(P)H-dependent FMN reductase | ||
| 7 | LuxH | AGU97356.1 | 3,4-dihydroxy-2-butanone 4-phosphate synthase | ||
| Sucrose (ScrRAKB operon) | |||||
| 1 | ScrR | AGV19641.1 | Sucrose operon repressor | V. alginolyticus ATCC 17749 | 34,33 |
| 2 | ScrA | AGV19642.1 | Type II phosphoenolpyruvate-dependent sucrose phosphotransferase system (PTS) | ||
| 3 | ScrK | AGV19643.1 | Fructokinase | ||
| 4 | ScrB | AGV19644.1 | Sucrose-6-phosphate dehydrogenase | ||
Syntenic organization and phylogenetic analysis of bioluminescence and sucrose pathway
The syntenic organization of the bioluminescence and sucrose operon was visualized using genome visualization tool EasyFig74 with manually curated Genbank file (gbff). Further, protein sequences of these two operons were extracted, aligned with MUSCLE and concatenated using the script catfasta2phyml.pl (https://github.com/nylander/catfasta2phyml). Phylogenetic reconstruction of the lux operon was performed with concatenated LuxCDABEG protein sequences among V. harveyi (6 strains) and V. campbellii (65 strains), carrying complete operon, using the luminescent V. vulnificus ATCC 43382 (VVL1) as the outgroup. For the scrRAKB operon, concatenated protein sequences from 182 strains of V. harveyi, and V. campbellii 170502 were analyzed with V. alginolyticus ATCC 17749 as the outgroup. Two V. harveyi strains (V423 and V424) carried two scr operons, and each operon was analyzed independently. Alignment was performed using MUSCLE, and maximum likelihood (ML) phylogenetic trees were constructed with RAxML-NG75 using 1000 bootstrap replicates. The best-fit substitution model (JTT + I + G4) was identified with ModelTest-NG76. The phylogenetic tree was visualized using iTOL73.
Mobilome analysis
Mobile genetic elements were analysed in nine bacterial strains suspected for horizontal gene transfer (HGT). These included six V. harveyi strains suspected of acquiring the luminescence operon, two V. harveyi strains carrying two copies of the scr operon, and V. campbellii 170502 carrying scr operon. Prophage regions were predicted using PHASTEST77, a high-throughput tool that identifies intact, questionable, and incomplete prophage. Insertion sequences (ISs) and transposable elements were annotated using ISEScan78, which employs Hidden Markov Models. The identified transposases were further confirmed by blastP analysis. Integrons and CALINs (Clusters of attC sites Lacking Integron-integrase) were identified using IntegronFinder version 2.079. Integrated conjugative elements (ICEs), which mediate gene transfer via conjugation, were detected using ICEFinder 2.080.
Phenotypic characterization
In silico results were validated by bioluminescence and sucrose utilization assay. Bioluminescence assay was carried out as per our earlier described method2. Briefly, V. harveyi and V. campbellii isolates were cultured in 10 ml LB broth (1.5% NaCl) at 30 °C, 120 rpm. A 200 µl bacterial culture (in triplicates) was transferred to a 96-well white opaque microplate (optiplate, PerkinElmer) and luminescence was recorded at 12 h post-incubation (Spark 10 M, Tecan, Grödig, Austria). Values were expressed as fold change of luminescence relative to the negative control.
Sucrose utilization was initially assessed on TCBS agar (30 °C, overnight), with yellow colonies scored as sucrose-fermenter and green colonies as non-fermenter. This was further confirmed by growth kinetics in M9 medium containing sucrose (10 g L−1) as the sole carbon source81. In brief, culture was grown in LB broth to OD600 ≈ 0.5, centrifuged (6000 g, 10 min), and resuspended in an equal volume of M9 broth. A 5 µl inoculum was transferred to 1 ml M9-sucrose in sterile 24-well microtitre plate (Tarson, India) and incubated statically at 30 °C in triplicates. The M9-sucrose broth without inoculum served as negative control and culture with V. alginolyticus served as positive control. The OD600 was recorded at regular intervals using multimode reader (Spark 10 M, Tecan, Grödig, Austria).
Screening of luxA and scrA genes
In silico results were further verified by PCR screening of marker gene of bioluminescence (luciferase gene luxA) and sucrose uptake gene scrA. Primers were designed using IDT PrimerQuest tool (https://www.idtdna.com/pages/tools/primerquest) (Table 5). The luxA and scrA genes were screened using bacterial DNA extracted by DNeasy blood and tissue kit (Qiagen). The PCR reaction condition consisted of initial denaturation (95 °C, 5 min) followed by 35 cycles of denaturation (95 °C, 30 s), annealing (60 °C, 30 s), and extension (72 °C, 30 s) with final extension of 72 °C for 10 min.
Statistical analysis
Comparative genomic analysis was conducted to evaluate differences in GC content, genome size, and the number of protein-coding genes between V. harveyi and V. campbellii. A two-tailed independent sample t-test was performed to assess significant differences in these genomic features. Furthermore, V. campbellii strains were categorized into three distinct phylogenetic groups; Gr-L (luminescent), Gr-LD (luminescence-defective), and Gr-LM (luminescent strains harboring mobile genetic elements), based on core genome phylogeny and the distribution of the luminescence operon. A one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison was conducted to evaluate differences in GC content, genome size, and the number of protein-coding genes among the three groups. All statistical analysis was carried out in R4.0.2. The graphics were generated using GraphPad Prism version 7.0 (GraphPad Software, San Diego, CA, USA).
During the preparation of this manuscript, the authors used the web-based tool ChatGPT (version 5) to improve English language and rectify grammatical errors. Following its use, the authors carefully reviewed and edited the content, and take full responsibility for content of the publication.
Supplementary Information
Acknowledgements
This work was carried out under the Consortia Research Platform on Vaccines and Diagnostics funded by the Indian Council of Agricultural Research, New Delhi, India. The authors are grateful to the Director, ICAR-Central Institute of Brackishwater Aquaculture, Chennai, for providing the necessary facilities to carry out this work.
Author contributions
Sujeet Kumar: Conceptualization, Whole genome sequencing, Genomic and in silico analysis, Writing—original draft B. Nishanthini: Bacterial isolation, Phenotypic characterization, PCR screening Abhaya Robinson: Bacterial isolation, Phenotypic characterization, PCR screening T. Sathish Kumar: Whole genome sequencing and editing of the manuscript Vidya Rajendran: Provided many bacterial isolates used for phenotypic characterization Vinay Kumar Katneni: Phylogenetic analysis and data interpretation P.S. Shyne Anand: Editing of the manuscript M. Makesh: Project administration, Funding support, Review & Editing M.S. Shekhar: Editing of the manuscript.
Funding
This work was carried out under the Consortia Research Platform on Vaccines and Diagnostics funded by the Indian Council of Agricultural Research, New Delhi, India under the grant number AS/2/3/2022-ASR-IV(PI.Xe-233289).
Data availability
The accession numbers can be found in the article in Table 1 (https:/www.nature.com/articles/s41598-025-09812-3) and supplementary Table 1. The whole genome sequencing carried out in the present study are available in GenBank, under the bioproject PRJNA377806, PRJNA1177612, PRJNA1178820, PRJNA972608. The rpoD gene was used for strain identification and its accession number is MW428977 to MW429005, PV550895 to PV550903, PX116707 to PX116711. The primary BLAST output for lux and scr operon, average nucleotide identity score, mobilome analysis, including insertion sequence, integrative conjugative elements, integron and prophage elements, are presented in supplementary Tables 2 to 12.
Declaration
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Chrisolite, B. et al. Distribution of luminescent Vibrio harveyi and their bacteriophages in a commercial shrimp hatchery in South India. Aquaculture275, 13–19 (2008). [Google Scholar]
- 2.Kumar, S. et al. Delineating virulence of Vibrio campbellii: a predominant luminescent bacterial pathogen in Indian shrimp hatcheries. Sci Rep11, 1–16 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Abraham, T. J. & Palaniappan, R. Distribution of luminous bacteria in semi-intensive penaeid shrimp hatcheries of Tamil Nadu. India. Aquaculture232, 81–90 (2004). [Google Scholar]
- 4.Wangman, P. et al. PirA & B toxins discovered in archived shrimp pathogenic Vibrio campbellii isolated long before EMS/AHPND outbreaks. Aquaculture497, 494–502 (2018). [Google Scholar]
- 5.Muthukrishnan, S. et al. Vibrio parahaemolyticus and Vibrio harveyi causing Acute Hepatopancreatic Necrosis Disease (AHPND) in Penaeus vannamei (Boone, 1931) isolated from Malaysian shrimp ponds. Aquaculture511, 734227 (2019). [Google Scholar]
- 6.Soto-Rodriguez, S. A., Gomez-Gil, B., Lozano-Olvera, R., Aguilar-Rendón, K. G. & González-Gómez, J. P. Identification of new Vibrio campbellii strains harboring the pVA1 plasmid isolated from Penaeus vannamei postlarvae affected by outbreaks of acute hepatopancreatic necrosis disease (AHPND) in Mexico. Aquaculture579, 740221 (2024). [Google Scholar]
- 7.Dong, X. et al. Complete genome sequence of Vibrio campbellii strain 20130629003S01 isolated from shrimp with acute hepatopancreatic necrosis disease. Gut Pathog9, 31 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ransangan, J. & Mustafa, S. Identification of Vibrio harveyi isolated from diseased Asian seabass Lates calcarifer by use of 16S ribosomal DNA sequencing. J Aquat Anim Health21, 150–155 (2009). [DOI] [PubMed] [Google Scholar]
- 9.Dong, H. T. et al. Recovery of Vibrio harveyi from scale drop and muscle necrosis disease in farmed barramundi. Lates calcarifer in Vietnam. Aquaculture473, 89–96 (2017). [Google Scholar]
- 10.Pujalte, M. J. et al. Virulence and molecular typing of Vibrio harveyi strains isolated from cultured dentex, gilthead sea bream and European sea bass. Syst Appl Microbiol26, 284–292 (2003). [DOI] [PubMed] [Google Scholar]
- 11.Haldar, S. et al. Identification of Vibrio harveyi as a causative bacterium for a tail rot disease of sea bream Sparus aurata from research hatchery in Malta. Microbiol Res165, 639–648 (2010). [DOI] [PubMed] [Google Scholar]
- 12.Zhang, X. & Austin, B. Pathogenicity of Vibrio harveyi to salmonids. J Fish Dis23, 93–102 (2000). [Google Scholar]
- 13.Strem, R. I., Ehrlich, R., Shashar, N. & Sharon, G. First description of Vibrio harveyi as the causative agent of morbidity and mortality in farmed flathead grey mullet Mugil cephalus. Dis Aquat Organ154, 33–48 (2023). [DOI] [PubMed] [Google Scholar]
- 14.Estante-Superio, E. G., Pakingking, R. V. Jr., Corre, V. L. Jr. & Cruz-Lacierda, E. R. Vibrio harveyi-like bacteria associated with fin rot in farmed milkfish Chanos chanos (Forsskal) fingerlings in the Philippines. Aquaculture534, 736259 (2021). [Google Scholar]
- 15.Henke, J. M. & Bassler, B. L. Three parallel quorum-sensing systems regulate gene expression in Vibrio harveyi. J Bacteriol186, 6902–6914 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lin, B. et al. Comparative genomic analyses identify the Vibrio harveyi genome sequenced strains BAA-1116 and HY01 as Vibrio campbellii. Environ Microbiol Rep2, 81–89 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Haldar, S. et al. Identification of Vibrio campbellii isolated from diseased farm-shrimps from south India and establishment of its pathogenic potential in an Artemia model. Microbiology (N Y)157, 179–188 (2011). [DOI] [PubMed] [Google Scholar]
- 18.Thompson, F. L., Gomez-Gil, B., Vasconcelos, A. T. R. & Sawabe, T. Multilocus sequence analysis reveals that Vibrio harveyi and V. campbellii are distinct species. Appl Environ Microbiol.73, 4279–4285 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Cano-Gomez, A., Høj, L., Owens, L. & Andreakis, N. Multilocus sequence analysis provides basis for fast and reliable identification of Vibrio harveyi-related species and reveals previous misidentification of important marine pathogens. Syst Appl Microbiol34, 561–565 (2011). [DOI] [PubMed] [Google Scholar]
- 20.Urbanczyk, H., Ogura, Y. & Hayashi, T. Taxonomic revision of Harveyi clade bacteria (family Vibrionaceae) based on analysis of whole genome sequences. Int J Syst Evol Microbiol63, 2742–2751 (2013). [DOI] [PubMed] [Google Scholar]
- 21.Haldar, S. et al. Development of a haemolysin gene-based multiplex PCR for simultaneous detection of Vibrio campbellii, Vibrio harveyi and Vibrio parahaemolyticus. Lett Appl Microbiol50, 146–152 (2010). [DOI] [PubMed] [Google Scholar]
- 22.Kim, E. et al. Innovative multiplex diagnostic strategies for Vibrio harveyi and Vibrio campbellii: a comparative study of droplet digital PCR, real-time PCR, and point-of-care PCR. Aquaculture (2025).
- 23.Bassler, B. L., Wright, M. & Silverman, M. R. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway. Mol Microbiol13, 273–286 (1994). [DOI] [PubMed] [Google Scholar]
- 24.Karunasagar, I., Pai, R., Malathi, G. R. & Karunasagar, I. Mass mortality of Penaeus monodon larvae due to antibiotic-resistant Vibrio harveyi infection. Aquaculture128, 203–209 (1994). [Google Scholar]
- 25.Meighen, E. A. Bacterial bioluminescence: organization, regulation, and application of the lux genes. FASEB J.7, 1016–1022 (1993). [DOI] [PubMed] [Google Scholar]
- 26.Belas, R. et al. Bacterial bioluminescence: isolation and expression of the luciferase genes from Vibrio harveyi. Science1979(218), 791–793 (1982). [DOI] [PubMed] [Google Scholar]
- 27.Wilson, T. & Hastings, J. W. Bioluminescence. Annu Rev Cell Dev Biol14, 197–230 (1998). [DOI] [PubMed] [Google Scholar]
- 28.Brodl, E., Winkler, A. & Macheroux, P. Molecular mechanisms of bacterial bioluminescence. Comput Struct Biotechnol J16, 551–564 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bassler, B. L., Wright, M., Showalter, R. E. & Silverman, M. R. Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence. Mol Microbiol9, 773–786 (1993). [DOI] [PubMed] [Google Scholar]
- 30.Miller, M. B. & Bassler, B. L. Quorum Sensing in Bacteria. Annu Rev Microbiol55, 165–199 (2001). [DOI] [PubMed] [Google Scholar]
- 31.Alsina, M. & Blanch, A. R. Improvement and update of a set of keys for biochemical identification of Vibrio species. J. Appl. Bacteriol.77, 719–721 (1994). [DOI] [PubMed] [Google Scholar]
- 32.Noguerola, I. & Blanch, A. R. Identification of Vibrio spp. with a set of dichotomous keys. J Appl Microbiol105, 175–185 (2008). [DOI] [PubMed] [Google Scholar]
- 33.Reid, S. J. & Abratt, V. R. Sucrose utilisation in bacteria: genetic organisation and regulation. Appl Microbiol Biotechnol67, 312–321 (2005). [DOI] [PubMed] [Google Scholar]
- 34.Blatch, G. L. & Woods, D. R. Nucleotide sequence and analysis of the Vibrio alginolyticus scr repressor-encoding gene (scrR). Gene101, 45–50 (1991). [DOI] [PubMed] [Google Scholar]
- 35.Bramhachari, P. V. & Dubey, S. K. Isolation and characterization of exopolysaccharide produced by Vibrio harveyi strain VB23. Lett Appl Microbiol43, 571–577 (2006). [DOI] [PubMed] [Google Scholar]
- 36.Musa, N., Wei, L. S. & Wee, W. Phenotypic and genotypic characteristics of Vibrio harveyi isolated from black tiger shrimp (Penaeus monodon). World Appl Sci J3, 885–902 (2008). [Google Scholar]
- 37.Alcaide, E. et al. Vibrio harveyi causes disease in seahorse, Hippocampus sp. J Fish Dis 24, (2001).
- 38.Alavandi, S. V., Manoranjita, V., Vijayan, K. K., Kalaimani, N. & Santiago, T. C. Phenotypic and molecular typing of Vibrio harveyi isolates and their pathogenicity to tiger shrimp larvae. Lett Appl Microbiol43, 566–570 (2006). [DOI] [PubMed] [Google Scholar]
- 39.Pakingking, R. Jr., Palma, P., de Jesus-Ayson, E. G. & Usero, R. Vibrio load and percentage composition of sucrose‐fermenting vibrios in Nile tilapia (Oreochromis niloticus) cultured in brackish water earthen ponds and biocontrol potential of recycled tilapia‐conditioned greenwater against population growth of V. parahaemolyticus and non‐sucrose‐fermenting vibrios in the grow‐out culture of white leg shrimp (Litopenaeus vannamei). Aquac Res53, 6816–6831 (2022). [Google Scholar]
- 40.Orellana, L. H. Average nucleotide identity—the backbone of modern ecological genomics: Microbial genomics. Nat Rev Genet 1 (2025). [DOI] [PubMed]
- 41.Kim, M., Oh, H.-S., Park, S.-C. & Chun, J. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int J Syst Evol Microbiol64, 346–351 (2014). [DOI] [PubMed] [Google Scholar]
- 42.Chung, M., Munro, J. B., Tettelin, H. & Dunning Hotopp, J. C. Using core genome alignments to assign bacterial species. MSystems3, 10–1128 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Amaral, G. R. S. et al. Genotype to phenotype: identification of diagnostic vibrio phenotypes using whole genome sequences. Int J Syst Evol Microbiol64, 357–365 (2014). [DOI] [PubMed] [Google Scholar]
- 44.Hoffmann, M., Monday, S. R., Fischer, M. & Brown, E. Genetic and phylogenetic evidence for misidentification of Vibrio species within the Harveyi clade. Lett Appl Microbiol54, 160–165 (2012). [DOI] [PubMed] [Google Scholar]
- 45.Ke, H.-M. et al. Comparative genomics of Vibrio campbellii strains and core species of the Vibrio Harveyi clade. Sci Rep7, 1–11 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Richter, M. & Rosselló-Móra, R. Shifting the genomic gold standard for the prokaryotic species definition. Proc. Natl. Acad. Sci.106, 19126–19131 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Nurhafizah, W. W. I. et al. Virulence properties and pathogenicity of multidrug-resistant Vibrio harveyi associated with luminescent vibriosis in Pacific white shrimp. Penaeus vannamei. J Invertebr Pathol186, 107594 (2021). [DOI] [PubMed] [Google Scholar]
- 48.Nakayama, T., Nomura, N. & Matsumura, M. Study on the relationship of protease production and luminescence in Vibrio harveyi. J Appl Microbiol101, 200–205 (2006). [DOI] [PubMed] [Google Scholar]
- 49.Defoirdt, T., Verstraete, W. & Bossier, P. Luminescence, virulence and quorum sensing signal production by pathogenic Vibrio campbellii and Vibrio harveyi isolates. J Appl Microbiol104, 1480–1487 (2008). [DOI] [PubMed] [Google Scholar]
- 50.Urbanczyk, H., Ast, J. C., Kaeding, A. J., Oliver, J. D. & Dunlap, P. V. Phylogenetic analysis of the incidence of lux gene horizontal transfer in Vibrionaceae. J Bacteriol190, 3494–3504 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Wang, L. et al. Isolation and identification of Vibrio campbellii as a bacterial pathogen for luminous vibriosis of Litopenaeus vannamei. Aquac Res46, 395–404 (2015). [Google Scholar]
- 52.Simpson, C. A. et al. The quorum-sensing systems of Vibrio campbellii DS40M4 and BB120 are genetically and functionally distinct. Environ Microbiol23, 5412–5432 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Urbanczyk, H., Ogura, Y. & Hayashi, T. Contrasting inter-and intraspecies recombination patterns in the “Harveyi clade” vibrio collected over large spatial and temporal scales. Genome Biol Evol7, 71–80 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Liang, J. et al. Genomic analysis reveals adaptation of Vibrio campbellii to the hadal ocean. Appl Environ Microbiol88, e00575-e622 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Abushattal, S., Vences, A., Barca, A. V. & Osorio, C. R. Diverse horizontally-acquired gene clusters confer sucrose utilization to different lineages of the marine pathogen Photobacterium damselae subsp. damselae. Genes (Basel)11, 1244 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Li, W., Raoult, D. & Fournier, P.-E. Bacterial strain typing in the genomic era. FEMS Microbiol Rev33, 892–916 (2009). [DOI] [PubMed] [Google Scholar]
- 57.Read, T. D. & Massey, R. C. Characterizing the genetic basis of bacterial phenotypes using genome-wide association studies: a new direction for bacteriology. Genome Med6, 109 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Delahaye, C. & Nicolas, J. Sequencing DNA with nanopores: Troubles and biases. PLoS ONE16, e0257521 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Pavlinec, Ž et al. Biochemical and molecular characterization of three serologically different Vibrio harveyi strains isolated from farmed Dicentrarchus labrax from the Adriatic Sea. Sci Rep12, 7309 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Hammerl, J. A. et al. The Acquisition of the scr Gene Cluster Encoding Sucrose Metabolization Enzymes Enables Strains of Vibrio parahaemolyticus and Vibrio vulnificus to Utilize Sucrose as Carbon Source. Front Microbiol12, 754464 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Ke, H.-M. et al. Tracing genomic divergence of Vibrio bacteria in the Harveyi clade. J Bacteriol200, 10–1128 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Zhao, W. et al. Distinct coral environments shape the dynamic of planktonic Vibrio spp. Environ Microbiome18, 77 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Gu, C. H. et al. Investigating hospital Mycobacterium chelonae infection using whole genome sequencing and hybrid assembly. PLoS ONE15, e0236533 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Olm, M. R., Brown, C. T., Brooks, B. & Banfield, J. F. dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME J11, 2864–2868 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Pascual, J., Macián, M. C., Arahal, D. R., Garay, E. & Pujalte, M. J. Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA, pyrH, rpoD, gyrB, rctB and toxR genes. Int J Syst Evol Microbiol60, 154–165 (2010). [DOI] [PubMed] [Google Scholar]
- 66.Kolmogorov, M., Yuan, J., Lin, Y. & Pevzner, P. A. Assembly of long, error-prone reads using repeat graphs. Nat Biotechnol37, 540–546 (2019). [DOI] [PubMed] [Google Scholar]
- 67.Hu, J., Fan, J., Sun, Z. & Liu, S. NextPolish: a fast and efficient genome polishing tool for long-read assembly. Bioinformatics36, 2253–2255 (2020). [DOI] [PubMed] [Google Scholar]
- 68.Pritchard, L., Cock, P. & Esen, Ö. pyani v0. 2.8: average nucleotide identity (ANI) and related measures for whole genome comparisons. (2019).
- 69.Tonkin-Hill, G. et al. Producing polished prokaryotic pangenomes with the Panaroo pipeline. Genome Biol21, 180 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics30, 2068–2069 (2014). [DOI] [PubMed] [Google Scholar]
- 71.Capella-Gutiérrez, S., Silla-Martínez, J. M. & Gabaldón, T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics25, 1972–1973 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Minh, B. Q. et al. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol37, 1530–1534 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Letunic, I. & Bork, P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res52, W78–W82 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Sullivan, M. J., Petty, N. K. & Beatson, S. A. Easyfig: a genome comparison visualizer. Bioinformatics27, 1009–1010 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Kozlov, A. M., Darriba, D., Flouri, T., Morel, B. & Stamatakis, A. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics35, 4453–4455 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Darriba, D. et al. ModelTest-NG: a new and scalable tool for the selection of DNA and protein evolutionary models. Mol Biol Evol37, 291–294 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Wishart, D. S. et al. PHASTEST: faster than PHASTER, better than PHAST. Nucleic Acids Res51, W443–W450 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Xie, Z. & Tang, H. ISEScan: automated identification of insertion sequence elements in prokaryotic genomes. Bioinformatics33, 3340–3347 (2017). [DOI] [PubMed] [Google Scholar]
- 79.Néron, B. et al. IntegronFinder 2.0: identification and analysis of integrons across bacteria, with a focus on antibiotic resistance in Klebsiella. Microorganisms10, 700 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Wang, M. et al. ICEberg 3.0: functional categorization and analysis of the integrative and conjugative elements in bacteria. Nucleic Acids Res52, D732–D737 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Biener, R. et al. High-cell-density cultivation of Vibrio natriegens in a low-chloride chemically defined medium. Appl Microbiol Biotechnol107, 7043–7054 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The accession numbers can be found in the article in Table 1 (https:/www.nature.com/articles/s41598-025-09812-3) and supplementary Table 1. The whole genome sequencing carried out in the present study are available in GenBank, under the bioproject PRJNA377806, PRJNA1177612, PRJNA1178820, PRJNA972608. The rpoD gene was used for strain identification and its accession number is MW428977 to MW429005, PV550895 to PV550903, PX116707 to PX116711. The primary BLAST output for lux and scr operon, average nucleotide identity score, mobilome analysis, including insertion sequence, integrative conjugative elements, integron and prophage elements, are presented in supplementary Tables 2 to 12.









