Abstract
Background
Sorafenib is the standard first-line treatment for advanced hepatocellular carcinoma (HCC), but its use is hampered by secondary drug resistance. Yes-associated protein (YAP) is a downstream effector of the Hippo signaling pathway, which is crucial for liver tumorigenesis. As yet, however, the mechanism underlying sorafenib resistance and the role of YAP therein is not fully understood and needs to be explored further.
Methods
Western blotting, flow cytometry and CCK-8 assays were used to assess the role of YAP in HCC sorafenib resistance. Next, qRT-PCR and Western blotting were performed to identify survivin as a YAP downstream effector, and rescue experiments were performed to confirm that YAP induces sorafenib resistance via survivin. Additionally, Western blotting, flow cytometry and in vivo xenograft models were used to evaluate the effect of verteporfin in combination with sorafenib on HCC.
Results
We found that sorafenib enhances YAP nuclear accumulation and activation, thereby promoting sorafenib resistance through inhibiting apoptosis in HCC cells. In addition, we found that survivin acts as a downstream mediator of YAP to resist sorafenib-induced apoptosis. Pharmacological inhibition of YAP by verteporfin increased the sensitivity of HCC cells to sorafenib and reversed sorafenib resistance. Moreover, verteporfin in combination with sorafenib significantly suppressed in vivo HCC tumor growth.
Conclusions
Our data indicate that YAP promotes sorafenib resistance through upregulation of survivin expression in HCC cells. Targeting YAP may be a therapeutic strategy to improve the antitumor effects of sorafenib in HCC.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13402-021-00595-z.
Keywords: Hepatocellular carcinoma, Sorafenib resistance, YAP, Survivin
Introduction
Liver cancer is one of the most frequent causes of cancer-related death worldwide, with a 5-year survival rate of 18 % [1]. The liver cancer incidence is rising faster than that for any other cancer in the United States [2]. Hepatocellular carcinoma (HCC) comprises 90 % of liver cancer cases [3]. China is one of the most high-risk regions for HCC [4]. HCC usually develops in patients with underlying chronic liver inflammation related to viral infection, alcohol consumption or metabolic disorders. Despite efforts that have been made to elucidate the molecular mechanisms underlying HCC development and progression, our understanding of this disease is still limited and its therapeutic options are not satisfactory. Sorafenib, a multi-kinase inhibitor, is the first-line treatment for advanced HCC patients [5]. Although this treatment has been shown to improve the overall survival of advanced HCC patients, the response rate is not satisfactory, and the development of sorafenib resistance often hampers its long-term use [5–9]. Thus, a systematic understanding of the molecular mechanism underlying sorafenib resistance is of critical importance to improve its antitumor effect in HCC patients.
The transcriptional co-activator YAP is a crucial downstream effector of the Hippo signaling pathway, which plays an important role in organ size control, tissue homeostasis and cancer [10–12]. YAP can be regulated through phosphorylation by the core MTS1/2-LATS1/2 kinase cascade [13]. Mounting evidence suggests that aberrant YAP expression or activity is involved in cancer initiation and progression [12, 14]. It has been reported that 5–10 % of human HCC cases show YAP gene amplification as part of a chromosome 11q22 amplicon [15] and that approximately 60 % of human HCC cases are associated with increased YAP activity [16, 17]. Additionally, it has been shown that YAP is critical for liver tumorigenesis [18–21]. YAP may also promote resistance to targeted therapy. Lin et al. reported, for example, that YAP promotes resistance to RAF and MEK inhibitors in cancer cell lines harboring BRAF, KRAS or NRAS activating mutations [22]. In HCC, YAP has additionally been reported to be involved in sorafenib resistance [23–25], although the mechanism underlying this resistance still needs to be clarified.
In this study, we explored the role of YAP in sorafenib resistance of HCC. We found that YAP contributes to sorafenib resistance by upregulating the expression of survivin. Targeting YAP may be a strategy to improve the antitumor effect of sorafenib in HCC.
Materials and methods
Cell culture and reagents
Huh-7, HepG2 and LO2 cells were obtained from the American Type Culture Collection (ATCC). Sorafenib resistant cell lines (Huh-7R and HepG2R) were obtained from Shanghai Aolu Biotechnology Co. Ltd. The cell lines were maintained in Dulbecco’s Modified Eagle Medium (DMEM; GIBCO BRL) supplemented with 10 % (v/v) FBS, 100 U/ml penicillin and 100 U/ml streptomycin. Cultures were maintained at 37oC in a humidified atmosphere with 5 % CO2. Sorafenib and Verteporfin were purchased from Selleck Chemicals. Antibodies directed against PARP, YAP, p-YAP(S127), survivin, Bcl-xl and Histone H3 were purchased from Cell Signaling Technology Inc., whereas an antibody directed against GAPDH was purchased from Santa Cruz Biotechnology Inc. and an antibody directed against Flag from Sigma.
Cell viability assay
Cells were seeded in 96-well plates (4,000 cells/well) and incubated overnight for attachment. Next, they were treated with the indicated agents in 10 % FBS-supplemented medium for 72 hours. This medium was replaced with cell counting kit-8 (CCK-8; Merck) at 37oC for 2 hours after which absorbance was measured at 450 nm.
Immunofluorescence assay
For immunofluorescence analysis, cells were seeded in chamber slides and subsequently fixed in methanol for 10 min at room temperature and permeabilized with 5 % bovine serum albumin in PBST. Next, the cells were exposed to a primary anti-YAP antibody 1:200 diluted in PBST containing 5 % bovine serum albumin overnight at 4oC. After washing three times with PBS for 10 min, a secondary antibody (Alexa Fluor 488-goat anti-rabbit) 1:200 diluted in PBST was added and incubated for 1 h at room temperature. Next, the cells were washed in PBS and mounted using 4,6-diamidino-2-phenylindole (DAPI) to counterstain DNA. Images were collected using a confocal microscope (Olympus FV-1000).
Colony formation assay
For colony formation assessment, cells were seeded into 6-well plates (500 cells per well) and next treated with sorafenib and verteporfin, alone or in combination. The medium was replaced with fresh medium containing the respective reagents every three days. After treatment for 10 days, the medium was removed and the cell colonies were fixed with 4 % paraformaldehyde for 20 minutes and stained with crystal violet (0.1 % in 20 % methanol) for 30 minutes. Next, they were washed slowly with running water and air dried. To record the results, pictures were taken using a digital camera, and the numbers of cell clones with more than 50 cells were counted under a microscope.
Plasmids and transfection
Plasmids encoding human YAP and survivin were cloned into a pcDNA3.1 vector equipped with a Flag-tag. For transient expression, plasmids were transfected with lipofetamine 2000 (Invitrogen) for 24 hours after which the cells were processed with the indicated reagents as described above.
RNA interference
Target siRNA was produced by GenePharma (Suzhou, China) and transfected using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer’s protocol. A non-targeting siRNA was used as negative control. The target sequence used was: survivin (5’-AAGGAGAUCAACAUUUUCA-3′). For stable YAP knockdown the following Addgene plasmids were used: pLKO1-shYAP#1(27,368) and pLKO1-shYAP#2 (27,369).
Quantitative RT-PCR
Total RNA was extracted using TRIZOL Reagent (Invitrogen) and subsequently reverse transcribed into cDNA using M-MLVReverse Transcriptase (Promega). Real-time PCR was carried out using FastStart Universal SYBR Green Master (Roche) after which cDNA amplification was measured using a StepOne RT-PCR System (Applied Biosystems). The primers used were: CTGF-forward: 5′AGGAGTGGGTGTGTGACGA3′ CTGF-reverse: 5′CCAGGCAGTTGGCTCTAATC3′; CYR61-forward: 5′CCTTGTGGACAGCCAGTGTA3′ CYR61-reverse: 5′ACTTGGGCCGGTATTTCTTC3′; Survivin-forward: 5′GAGGCTGGCTTCATCCACTG3′ Survivin-reverse: 5′ATGCTCCTCTATCGGGTTGTC3′;GAPDH-forward: 5′CTCCTGCACCACCAACTGCT3′ GAPDH-reverse: 5′GGGCCATCCACAGTCTTCTG3′.
Apoptosis assay
Apoptotic rates were detected by flow cytometry using an Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit (BD Biosciences). Briefly, cells were collected after different treatments after which the assay was performed according to the manufacturer’s instructions. Samples were analyzed immediately using a Cytomics FC500 flow cytometer (Beckman Coulter).
Caspase activity assay
Caspase activity was determined using a Caspase-Glo® 3/7 luminescent assay (Promega), according to the manufacturer’s instructions. After allowing the reagent and 96-well plates containing cells to equilibrate to room temperature, 100 µl Caspase-Glo® 3/7 Reagent was added to each well of a white-walled 96-well plate containing 100 µl blank, negative control cells or treated cells in culture medium. Next, the contents of the wells was gently mixed using a plate shaker at 300-500 rpm for 30 seconds and incubated at room temperature for 2 hours. Luminescence of each sample was measured using a plate-reading luminometer as directed by the luminometer manufacturer. The assays were performed in triplicate, and mean values were obtained based on the results of 3 independent assays.
Xenograft tumor assay
For the establishment of a xenograft tumor model, nude mice (BALB/c nu/nu, 5-week-old females) were injected subcutaneously in the dorsal flank with 5 × 106 HepG2 cells suspended in 0.1 ml serum-free medium. When the tumors reached 100 to 200 mm3, the mice were randomly divided into four groups receiving (i) vehicle, (ii) sorafenib (50 mg/kg) orally once daily, (iii) verteporfin (100 mg/kg) intraperitoneally every other day or (iv) the combination of sorafenib and verteporfin, respectively. Tumor volumes were measured every 4 days using calipers and their volumes calculated using the following formula: tumor volume = π/6 (L×W2). Mice were sacrificed on day 32, after which the tumors were dissected and analyzed. The animal experiments were approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University.
Immunohistochemistry (IHC)
Xenograft tumors were fixed in 4 % paraformaldehyde (PFA), embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E). Immunohistochemical staining of the tissues was performed using anti-survivin (CST, 1:100 dilution) and anti-Ki-67 (Abcam, 1:100 dilution) primary antibodies and an ABC Elite immunoperoxidase detection kit according to the manufacturer’s instructions.
Statistical analysis
The data were analyzed using SPSS 16.0 software. Student’s t test was used to compare the mean of different groups and p < 0.05 was considered statistically significant.
Results
Sorafenib induces apoptosis and activates YAP in HCC cells
Sorafenib has the potential to inhibit tumor growth, progression, metastasis and angiogenesis [26]. We found that sorafenib induced apoptosis in Huh-7 and HepG2 cells and that cleaved PARP levels were strongly increased in a dose- and time- dependent manner (Fig. 1a-d). Previous work indicated that YAP may play an important role in tumorigenesis by regulating cell proliferation and apoptosis [10, 27, 28]. Here, we first examined YAP protein expression in a human hepatic cell line (LO2) and several commonly used liver cancer cell lines, and found that YAP was highly expressed in the liver cancer cell lines (Supplemental Fig. 1). Next, YAP expression was evaluated after sorafenib treatment in Huh-7 and HepG2 cells. Using Western blotting, no detectable differences in total YAP protein levels were found, whereas a substantial decrease in YAP Ser127 phosphorylation after sorafenib treatment was noted (Fig. 1a-d). YAP phosphorylation at Ser127 mediated by the Hippo pathway has been reported to mainly lead to its cytoplasmic sequestration and degradation [29]. Therefore, we also assessed the localization of YAP by separating proteins from the cytoplasm and nucleus and found that sorafenib increased the nuclear accumulation of YAP (Fig. 1e-f). To further confirm activation of YAP in the sorafenib treated cells, we measured YAP target gene expression. We found that sorafenib significantly increased the transcription of CTGF and CYR61, two known YAP/TEAD target genes (Fig. 1g-h).
Fig. 1.
Sorafenib promotes YAP nuclear accumulation and activates YAP in HCC cells. a, b Huh-7 and HepG2 cells were exposed to the indicated doses of sorafenib for 24 h. Next, the cells were collected for Western blotting. c, d Huh-7 and HepG2 cells were treated with 5 µM sorafenib for the indicated times. Next, the cells were collected for Western blotting. e, f Cytoplasmic and nuclear proteins were separated, after which YAP localization was detected by Western blotting. g, h mRNA expressions of CTGF and CYR61 analyzed by qRT-PCR. The results are presented as mean ± SEM (n = 3) for each treatment. *p < 0.05, **p < 0.01, ***p < 0.001
In addition, we examined the effect of sorafenib on apoptosis in sorafenib resistant HCC cells (Huh-7R and HepG2R). Compared with the primary cells, the cleavage of PARP induced by sorafenib was weak in Huh-7R and HepG2R cells (Supplemental Fig. 2a-b). After sorafenib treatment, no significant difference in YAP protein and YAP Ser127 phosphorylation levels were observed (Supplemental Fig. 2a-b). Compared with Huh-7 and HepG2 cells, more YAP nuclear localization in Huh-7R and HepG2R cells was noted, but sorafenib did not increase the nuclear accumulation of YAP (Supplemental Fig. 2c-d). Correspondingly, we found that sorafenib did not significantly increase the transcription of CTGF and CYR61 in the sorafenib resistant cells (Supplemental Fig. 2e-f). These results suggest that YAP had a high basal activity in the sorafenib resistant cells, which were resistant to sorafenib-induced apoptosis.
Taken together, these data indicate that sorafenib promotes YAP nuclear accumulation and activation in HCC cells, and that activated YAP may be involved in sorafenib resistance.
YAP attenuates the sensitivity of HCC cells to sorafenib
Previous work indicates that YAP can regulate apoptosis [30, 31]. To investigate the biological significance of YAP in sorafenib-induced apoptosis, we knocked down YAP expression in Huh-7 and HepG2 cells using two independent short hairpin RNAs (shRNAs) (Supplemental Fig. 3). We found that sorafenib had no significant effect on YAP protein and mRNA expression (Fig. 2a, Supplemental Fig. 4a-b), but that YAP knockdown did promote sorafenib-induced apoptosis, as indicated by induction of both PARP cleavage and caspase activity in HCC cells (Fig. 2a-c). LO2 is a normal hepatocyte cell line, expressing a low level of endogenous YAP. We found that exogenous YAP overexpression inhibited sorafenib-induced apoptosis in LO2 cells (Fig. 2d-e). We also assessed sorafenib-induced apoptosis by performing flow cytometry using Annexin V-FITC/PI double staining. Apoptotic cell rates were assessed 48 hours after sorafenib treatment. We found that YAP knockdown increased about three-fold the number of apoptotic Huh-7 and HepG2 cells (Fig. 2f-i), while YAP overexpression reduced the number of apoptotic LO2 cells by 60 % (Fig. 2j-k). Since YAP could suppress sorafenib-induced apoptosis, we hypothesized that YAP may promote sorafenib resistance in HCC cells. Using a CCK-8 assay, we found that YAP knockdown enhanced the cytotoxicity of sorafenib in Huh-7 and HepG2 cells (Supplemental Fig. 5a-b). Conversely, we found that YAP overexpression reduced the cytotoxicity of sorafenib in LO2 cells (Supplemental Fig. 5c). Collectively, these data indicate that YAP plays a crucial role in mediating the sensitivity of HCC cells to sorafenib.
Fig. 2.
YAP attenuates the sensitivity of HCC cells to sorafenib. a-c Huh-7 and HepG2 cells transfected with shYAP were treated with sorafenib for 24 h. Next, PARP and YAP expression was analyzed by Western blotting and caspase activities were determined. d, e LO2 cells transfected with flag-YAP plasmids were treated with sorafenib for 24 h. Next, PARP, YAP and Flag expression was analyzed by Western blotting and caspase activities were determined. f- k Huh-7 and HepG2 cells with YAP knockdown and LO2 cells with YAP overexpression were treated with sorafenib and subsequently subjected to flow cytometry. Columns, indicating the total percentage of K2 and K4 cells, represent the average of three independent experiments. The results are presented as mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001
Survivin acts as a downstream mediator of YAP in sorafenib‐induced apoptosis
It has been reported that YAP can transcriptionally upregulate the expression of specific anti-apoptotic factors, including BCL-xL [22, 32] and survivin [33, 34] in certain cell types. We reasoned that YAP may enhance the expression of anti-apoptotic factors to promote survival and sorafenib resistance of HCC cells. Indeed, we found that YAP knockdown resulted in decreased expression of survivin, both at the protein and mRNA level, specifically after sorafenib treatment in Huh-7 and HepG2 cells (Fig. 3a-d). Conversely, we found that exogenous YAP overexpression increased survivin expression (Fig. 3e-f). The level of BCL-xL was, however, not markedly affected, indicating a potential link between YAP and survivin in sorafenib treated HCC cells.
Fig. 3.
YAP promotes the expression of survivin to inhibit sorafenib-induced apoptosis. a-d Huh-7 and HepG2 cells transfected with shYAP were treated with sorafenib for 24 h. Next, protein and mRNA expression were analyzed using Western blotting and qRT-PCR. e, f LO2 cells transfected with flag-YAP were treated with sorafenib for 24 h. Next, protein and mRNA expression were analyzed using Western blotting and qRT-PCR. g Huh-7 and HepG2 cells transfected with sisurvivin were treated with sorafenib for 24 h and analyzed using Western blotting. h LO2 cells transfected with different combinations of flag-YAP and si-survivin were treated with sorafenib and analyzed using Western blotting. i HepG2 cells transfected with different combinations of shYAP and flag-survivin were treated with sorafenib and analyzed using Western blotting
To substantiate the putative functional link between YAP and survivin, HCC cells were treated with small interfering RNA (siRNA) to knockdown survivin expression. The data obtained clearly showed that survivin silencing significantly increased sorafenib-induced PARP cleavage in Huh-7 and HepG2 cells (Fig. 3g). Moreover, we found that survivin silencing rescued the inhibitory effect of YAP overexpression on apoptosis in LO2 cells (Fig. 3h), while survivin overexpression reduced sorafenib-induced apoptosis promoted by YAP knockdown in HepG2 cells (Fig. 3i). Together, these data support the notion that survivin serves as a downstream mediator of YAP in sorafenib-induced apoptosis.
Verteporfin enhances sorafenib cytotoxicity and reverses sorafenib resistance
Verteporfin, a photosensitizer clinically used in photodynamic therapy, has been reported to abrogate the interaction between YAP and TEAD, thereby inhibiting YAP transcriptional activity [35]. Here, we hypothesized that verteporfin may enhance sorafenib cytotoxicity in HCC cells by inhibiting YAP. We found that in Huh-7 and HepG2 cells the combination of verteporfin and sorafenib significantly decreased survivin expression and enhanced PARP cleavage (Fig. 4a-b). Subsequent cell viability analyses revealed that verteporfin significantly increased the cytotoxicity of sorafenib in Huh-7 and HepG2 cells (Fig. 4c-d). Furthermore, we found that the combination of verteporfin and sorafenib resulted in a marked reduction in colony formation of HCC cells compared with verteporfin or sorafenib alone (Fig. 4e-f). Verteporfin also significantly enhanced sorafenib-induced apoptosis in Huh-7 and HepG2 cells (Fig. 4g).
Fig. 4.
YAP inhibitor verteporfin promotes sorafenib cytotoxicity in HCC cells. a, b Huh-7 and HepG2 cells were treated with sorafenib in combination with or without verteporfin for 24 hours. Next, the cells were analyzed using Western blotting. c, d Huh-7 and HepG2 cells were treated with different combinations of sorafenib and verteporfin for 72 h. Next, cell viabilities were measured using a CCK-8 assay. e, f Huh-7 and HepG2 cells were treated with different combinations of sorafenib and verteporfin. Next, cells viabilities were analyzed using a colony formation assay. Columns represent the average of three independent experiments. g Huh-7 and HepG2 cells were treated with different combinations of sorafenib and verteporfin for 48 h. Next, the cells were analyzed using flow cytometry. Columns represent the average of three independent experiments. The results are presented as mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001
Next, we repeated the above experiments in sorafenib resistant cells. Surprisingly, we found that verteporfin could reverse sorafenib resistance in Huh-7R and HepG2R cells. In Huh-7R and HepG2R cells, the combination of verteporfin and sorafenib reduced survivin expression and enhanced PARP cleavage, while sorefinib alone had a weak effect (Supplemental Fig. 6a-b). Verteporfin also significantly increased the cytotoxicity of sorafenib in Huh-7R and HepG2R cells (Supplemental Fig. 6c-d). Furthermore, we found that the combination of verteporfin and sorafenib resulted in decreased colony formation and increased apoptosis, while sorefinib alone had no significant effect (Supplemental Fig. 6e-g).
Together, these findings indicate that verteporfin can increase the sensitivity of HCC cells to sorafenib and reverse sorafenib resistance.
Verteporfin enhances the in vivo antitumor activity of sorafenib
To verify whether the synergistic effect of sorafenib and verteporfin may have clinical implications, we evaluated the effect of verteporfin on the antitumor activity of sorafenib in vivo. To this end, BALB/c (nu/nu) mice were injected subcutaneously with HepG2 cells and divided randomly into 4 groups. Tumor-bearing mice were treated with vehicle, sorafenib (50 mg/kg) orally once daily, verteporfin (100 mg/kg) intraperitoneally every other day or the combination of sorafenib and verteporfin. All animals tolerated the treatments well without observable signs of toxicity, and had stable body weights throughout the course of the study. We found that the combination of sorafenib and verteporfin significantly delayed tumor growth compared with sorafenib or verteporfin alone (Fig. 5a-b). Accordingly, immunohistochemical staining revealed that the expression levels of survivin and Ki-67 were markedly decreased by the combination treatment of sorafenib and verteporfin (Fig. 5c-e). Thus, sorafenib in combination with verteporfin exhibits an increased antitumor activity in vivo and these effects are, at least in part, due to the inhibition of YAP and survivin (Fig. 6).
Fig. 5.
Verteporfin enhances the anti-cancer effect of sorafenib in HepG2 xenograft models. a HepG2 cells were subcutaneously implanted in nude mice, after which the mice were treated as described in Materials and methods. Tumor growth curves in each group were determined. b Tumor weights were measured after collection. c‐e H&E and immunohistochemical staining for Ki-67 and survivin in xenograft tumor samples from each group. Scale bar = 20 µm. The results are presented as mean ± SEM (n = 6) for each group. *p < 0.05, **p < 0.01, ***p < 0.001
Fig. 6.
Diagram depicting YAP-mediated sorafenib resistance in HCC. Sorafenib suppresses tumor growth by inhibiting the RAS/RAF/MEK/ERK pathway. Meanwhile, sorafenib activates YAP, which contributes to sorafenib resistance by increasing the expression of survivin
Discussion
Liver cancer is one of the leading causes of cancer-related death worldwide and, currently, it has the fastest rising incidence rate of all cancers. Although sorafenib represents the standard first-line treatment for advanced HCC, sorafenib resistance is a major concern due to a shortage of alternative systemic treatment options [36]. In this study, we show that activated YAP in HCC cells correlates with the therapeutic effect of sorafenib. Survivin was found to be a critical mediator of YAP in sorafenib resistance. Combination with the YAP inhibitor verteporfin significantly improved the antitumor activity of sorafenib both in vitro and in vivo. These findings suggest that inhibiting YAP may be a strategy to improve the efficacy of sorafenib in HCC.
Research over the past decade has revealed a critical role of the Hippo/YAP pathway in both normal organ development and cancer. As such, YAP is emerging as an attractive therapeutic target for cancer. Previous studies have shown that YAP contributes to the development of cancer resistance [37, 38]. However, the direct relationship between YAP and sorafenib resistance in HCC is currently poorly understood. Here, we show that YAP promotes sorafenib resistance and that YAP inhibition enhances the antitumor activity of sorafenib. Notably, we identified survivin as a crucial mediator of YAP in inducing sorafenib resistance in HCC cells. Survivin is a member of the inhibitor of apoptosis protein family that is widely overexpressed in human cancers and well known for its capacity to drive evasion from apoptosis. Thus, our findings not only confirm a regulatory relationship between YAP and survivin, but also provide evidence that survivin serves as an executor of YAP in promoting sorafenib resistance.
Targeting YAP has become an exciting yet challenging goal for cancer therapy. Verteporfin is a small molecule inhibitor of the YAP-TEAD interaction, and several studies have used verteporfin as an effective inhibitor to suppress YAP-induced tumorigenesis [39–41]. Recently, drugs such as metformin and statins have been shown to be able to effectively target upstream pathways and indirectly inhibit YAP activity [42, 43], indicating that inhibition of YAP may become clinically feasible.
Collectively, our study shows that YAP promotes sorafenib resistance in HCC cells through downstream regulation of survivin. Combination of YAP inhibitors with sorafenib may be a promising therapeutic strategy for advanced HCC.
Supplementary Information
The protein levels of YAP were analyzed by western blotting assay in liver cancer cell lines and in a normal human hepatic cell line LO2 (PNG 39 kb) (PNG 24 kb)
Huh-7R and HepG2R were resistant to sorafenib induced apoptosis. (a, b) Huh-7R and HepG2R cells were exposed to the indicated doses of sorafenib for 24 h. Cells were collected for western blotting. (c, d) Proteins from the cytoplasm and nucleus were separated, and the localization of YAP were detected by western blotting. (e, f) The mRNA expressions of CTGF and CYR61 were analyzed by qRT-PCR. Results were presented as mean ± sem (n = 3) for each treatment (PNG 114 kb)
Knockdown YAP expression using shRNAs in Huh-7 and HepG2 cells. Huh-7 and HepG2 cells were transfected with shYAP. (a, b) The protein levels of YAP were analyzed with western blotting. (c, d) The mRNA levels of YAP were analyzed with RT-PCR (PNG 83 kb)
Sorafenib had no significant effect on YAP mRNA expression. (a-b) Huh-7 and HepG2 cells transfected with shYAP were treated with sorafenib for 24 h. The mRNA levels of YAP were analyzed with RT-PCR (PNG 39 kb)
YAP attenuated the cytotoxicity of sorafenib. (a, b) Huh-7 and HepG2 cells transfected with shRNA were treated with different concentration of sorafenib for 72 h. Cell viability was measured by CCK-8. (c) LO2 cells transfected with flag-YAP or vector were treated with different concentration of sorafenib for 72 h. Cell viability was measured by CCK-8 (PNG 35 kb)
YAP inhibitor verteporfin reversed sorafenib resistance. (a, b) Huh-7R and HepG2R cells were treated with sorafenib in combination with or without verteporfin for 24 hours. Cells were analyzed using western blotting. (c, d) Huh-7R and HepG2R cells were treated with different combinations of sorafenib and verteporfin for 72 h. Cell viability was measured by CCK-8. (e, f) Huh-7R and HepG2R cells were treated with different combinations of sorafenib and verteporfin. Cells viability was analyzed by colony formation assay. Columns were the average of three independent experiments. (g) Huh-7R and HepG2R cells were treated with different combinations of sorafenib and verteporfin for 48 h. Cells were analyzed by flow cytometry. Columns were the average of three independent experiments. Results were presented as mean ± sem (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 (PNG 629 kb)
Abbreviations
- HCC
Hepatocellular carcinoma
- IHC
Immunohistochemistry
- QRT-PCR
quantitative real-time polymerase chain reaction
- siRNA
Small interfering RNA
- YAP
Yes-associated protein
Author contributions
TS designed the study and prepared the manuscript; WM and HP performed most of the experiments; TS and LJ analyzed the data and competed the figures; QW revised the manuscript. All authors read and approved the final manuscript.
Funding
This project was supported by the National Natural Science Foundation of China (No. 81874188) and the Science and Technology Project of Henan province of China (No. 202102310119).
Data availability
The data and materials supporting the conclusion of this manuscript are included in the article.
Declarations
Ethics approval and consent to participate
All experiments were performed in accordance with the standards of the ethics committee of the First Affiliated Hospital of Zhengzhou University.
Consent for publication
Not applicable.
Conflict of interest
The authors declare that they have no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 68, 394–424 (2018) [DOI] [PubMed] [Google Scholar]
- 2.R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2019. CA Cancer J. Clin. 69, 7–34 (2019) [DOI] [PubMed] [Google Scholar]
- 3.J. Zucman-Rossi, A. Villanueva, J.C. Nault, J.M. Llovet, Genetic landscape and biomarkers of hepatocellular carcinoma. Gastroenterology 149, 1226-1239.e1224 (2015) [DOI] [PubMed] [Google Scholar]
- 4.W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X.Q. Yu, J. He, Cancer statistics in China, 2015. CA Cancer J. Clin. 66, 115–132 (2016) [DOI] [PubMed] [Google Scholar]
- 5.J.M. Llovet, S. Ricci, V. Mazzaferro, P. Hilgard, E. Gane, J.F. Blanc, A.C. de Oliveira, A. Santoro, J.L. Raoul, A. Forner, M. Schwartz, C. Porta, S. Zeuzem, L. Bolondi, T.F. Greten, P.R. Galle, J.F. Seitz, I. Borbath, D. Haussinger, T. Giannaris, M. Shan, M. Moscovici, D. Voliotis, J. Bruix, S.I.S. Group, Sorafenib in advanced hepatocellular carcinoma. N. Engl. J. Med. 359, 378–390 (2008) [DOI] [PubMed] [Google Scholar]
- 6.M.S. Copur, Sorafenib in advanced hepatocellular carcinoma. N. Engl. J. Med. 359, 2498; author reply 2498–2499 (2008) [PubMed]
- 7.J.F. Dufour, The evasive promise of antiangiogenic therapy. J. Hepatol. 51, 970–972 (2009) [DOI] [PubMed] [Google Scholar]
- 8.M.A. Worns, P.R. Galle, HCC therapies–lessons learned. Nat. Rev. Gastroenterol. Hepatol. 11, 447–452 (2014) [DOI] [PubMed] [Google Scholar]
- 9.C. Berasain, Hepatocellular carcinoma and sorafenib: too many resistance mechanisms? Gut 62, 1674–1675 (2013) [DOI] [PubMed] [Google Scholar]
- 10.K.F. Harvey, X. Zhang, D.M. Thomas, The Hippo pathway and human cancer. Nat. Rev. Cancer 13, 246–257 (2013) [DOI] [PubMed] [Google Scholar]
- 11.J. Huang, S. Wu, J. Barrera, K. Matthews, D. Pan, The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila Homolog of YAP. Cell 122, 421–434 (2005) [DOI] [PubMed] [Google Scholar]
- 12.F.X. Yu, B. Zhao, K.L. Guan, Hippo pathway in organ size control, tissue homeostasis, and cancer. Cell 163, 811–828 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.B. Zhao, K. Tumaneng, K.L. Guan, The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal. Nat. Cell Biol. 13, 877–883 (2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.F. Zanconato, M. Cordenonsi, S. Piccolo, YAP/TAZ at the roots of cancer. Cancer Cell 29, 783–803 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.M. Overholtzer, J. Zhang, G.A. Smolen, B. Muir, W. Li, D.C. Sgroi, C.X. Deng, J.S. Brugge, D.A. Haber, Transforming properties of YAP, a candidate oncogene on the chromosome 11q22 amplicon. Proc. Natl. Acad. Sci. U. S. A. 103, 12405–12410 (2006) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.T. Zhang, J. Zhang, X. You, Q. Liu, Y. Du, Y. Gao, C. Shan, G. Kong, Y. Wang, X. Yang, L. Ye, X. Zhang, Hepatitis B virus X protein modulates oncogene Yes-associated protein by CREB to promote growth of hepatoma cells. Hepatology 56, 2051–2059 (2012) [DOI] [PubMed] [Google Scholar]
- 17.J. Tao, D.F. Calvisi, S. Ranganathan, A. Cigliano, L. Zhou, S. Singh, L. Jiang, B. Fan, L. Terracciano, S. Armeanu-Ebinger, S. Ribback, F. Dombrowski, M. Evert, X. Chen, S.P.S. Monga, Activation of beta-catenin and Yap1 in human hepatoblastoma and induction of hepatocarcinogenesis in mice. Gastroenterology 147, 690–701 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.W. Kim, S.K. Khan, J. Gvozdenovic-Jeremic, Y. Kim, J. Dahlman, H. Kim, O. Park, T. Ishitani, E.H. Jho, B. Gao, Y. Yang, Hippo signaling interactions with Wnt/beta-catenin and Notch signaling repress liver tumorigenesis. J. Clin. Invest. 127, 137–152 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.S.M.E. Weiler, F. Pinna, T. Wolf, T. Lutz, A. Geldiyev, C. Sticht, M. Knaub, S. Thomann, M. Bissinger, S. Wan, S. Rossler, D. Becker, N. Gretz, H. Lang, F. Bergmann, V. Ustiyan, T.V. Kalin, S. Singer, J.S. Lee, J.U. Marquardt, P. Schirmacher, V.V. Kalinichenko, K. Breuhahn, Induction of chromosome instability by activation of yes-associated protein and forkhead box M1 in liver cancer. Gastroenterology 152, 2037-2051.e2022 (2017) [DOI] [PubMed] [Google Scholar]
- 20.W.C. Yuan, B. Pepe-Mooney, G.G. Galli, M.T. Dill, H.T. Huang, M. Hao, Y. Wang, H. Liang, R.A. Calogero, F.D. Camargo, NUAK2 is a critical YAP target in liver cancer. Nat. Commun. 9, 4834 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.S. Zhang, D. Zhou, Role of the transcriptional coactivators YAP/TAZ in liver cancer. Curr. Opin. Cell Biol. 61, 64–71 (2019) [DOI] [PubMed] [Google Scholar]
- 22.L. Lin, A.J. Sabnis, E. Chan, V. Olivas, L. Cade, E. Pazarentzos, S. Asthana, D. Neel, J.J. Yan, X. Lu, L. Pham, M.M. Wang, N. Karachaliou, M.G. Cao, J.L. Manzano, J.L. Ramirez, J.M. Torres, F. Buttitta, C.M. Rudin, E.A. Collisson, A. Algazi, E. Robinson, I. Osman, E. Munoz-Couselo, J. Cortes, D.T. Frederick, Z.A. Cooper, M. McMahon, A. Marchetti, R. Rosell, K.T. Flaherty, J.A. Wargo, T.G. Bivona, The Hippo effector YAP promotes resistance to RAF- and MEK-targeted cancer therapies. Nat. Genet. 47, 250–256 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.T.Y. Zhou, L.H. Zhuang, Y. Hu, Y.L. Zhou, W.K. Lin, D.D. Wang, Z.Q. Wan, L.L. Chang, Y. Chen, M.D. Ying, Z.B. Chen, S. Ye, J.S. Lou, Q.J. He, H. Zhu, B. Yang, Inactivation of hypoxia-induced YAP by statins overcomes hypoxic resistance tosorafenib in hepatocellular carcinoma cells. Sci. Rep. 6, 30483 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.H. Xia, X. Dai, H. Yu, S. Zhou, Z. Fan, G. Wei, Q. Tang, Q. Gong, F. Bi, EGFR-PI3K-PDK1 pathway regulates YAP signaling in hepatocellular carcinoma: the mechanism and its implications in targeted therapy. Cell Death Dis. 9, 269 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.A.M. Gomes, T.S. Pinto, C.J. da Costa Fernandes, R.A. da Silva, W.F. Zambuzzi, Wortmannin targeting phosphatidylinositol 3-kinase suppresses angiogenic factors in shear-stressed endothelial cells. J. Cell. Physiol. 235, 5256–5269 (2020) [DOI] [PubMed] [Google Scholar]
- 26.F. Pitoia, F. Jerkovich, Selective use of sorafenib in the treatment of thyroid cancer. Drug Des. Devel. Ther. 10, 1119–1131 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.R. Johnson, G. Halder, The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nat. Rev. Drug Discov. 13, 63–79 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.D. Pan, The hippo signaling pathway in development and cancer. Dev. Cell 19, 491–505 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Z. Meng, T. Moroishi, K.L. Guan, Mechanisms of Hippo pathway regulation. Genes Dev. 30, 1–17 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.D.D. Shao, W. Xue, E.B. Krall, A. Bhutkar, F. Piccioni, X. Wang, A.C. Schinzel, S. Sood, J. Rosenbluh, J.W. Kim, Y. Zwang, T.M. Roberts, D.E. Root, T. Jacks, W.C. Hahn, KRAS and YAP1 converge to regulate EMT and tumor survival. Cell 158, 171–184 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.A. Kapoor, W. Yao, H. Ying, S. Hua, A. Liewen, Q. Wang, Y. Zhong, C.J. Wu, A. Sadanandam, B. Hu, Q. Chang, G.C. Chu, R. Al-Khalil, S. Jiang, H. Xia, E. Fletcher-Sananikone, C. Lim, G.I. Horwitz, A. Viale, P. Pettazzoni, N. Sanchez, H. Wang, A. Protopopov, J. Zhang, T. Heffernan, R.L. Johnson, L. Chin, Y.A. Wang, G. Draetta, R.A. DePinho, Yap1 activation enables bypass of oncogenic Kras addiction in pancreatic cancer. Cell 158, 185–197 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.J. Rosenbluh, D. Nijhawan, A.G. Cox, X. Li, J.T. Neal, E.J. Schafer, T.I. Zack, X. Wang, A. Tsherniak, A.C. Schinzel, D.D. Shao, S.E. Schumacher, B.A. Weir, F. Vazquez, G.S. Cowley, D.E. Root, J.P. Mesirov, R. Beroukhim, C.J. Kuo, W. Goessling, W.C. Hahn, beta-Catenin-driven cancers require a YAP1 transcriptional complex for survival and tumorigenesis. Cell 151, 1457–1473 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.W. Zhang, Y. Gao, F. Li, X. Tong, Y. Ren, X. Han, S. Yao, F. Long, Z. Yang, H. Fan, L. Zhang, H. Ji, YAP promotes malignant progression of Lkb1-deficient lung adenocarcinoma through downstream regulation of survivin. Cancer Res. 75, 4450–4457 (2015) [DOI] [PubMed] [Google Scholar]
- 34.K. Ma, Q. Xu, S. Wang, W. Zhang, M. Liu, S. Liang, H. Zhu, N. Xu, Nuclear accumulation of Yes-Associated Protein (YAP) maintains the survival of doxorubicin-induced senescent cells by promoting survivin expression. Cancer Lett. 375, 84–91 (2016) [DOI] [PubMed] [Google Scholar]
- 35.Y. Liu-Chittenden, B. Huang, J.S. Shim, Q. Chen, S.J. Lee, R.A. Anders, J.O. Liu, D. Pan, Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes Dev. 26, 1300–1305 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.B. Zhai, X.Y. Sun, Mechanisms of resistance to sorafenib and the corresponding strategies in hepatocellular carcinoma. World J. Hepatol. 5, 345–352 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.C.A. Hall, R. Wang, J. Miao, E. Oliva, X. Shen, T. Wheeler, S.G. Hilsenbeck, S. Orsulic, S. Goode, Hippo pathway effector Yap is an ovarian cancer oncogene. Cancer Res. 70, 8517–8525 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.J.M. Huang, I. Nagatomo, E. Suzuki, T. Mizuno, T. Kumagai, A. Berezov, H. Zhang, B. Karlan, M.I. Greene, Q. Wang, YAP modifies cancer cell sensitivity to EGFR and survivin inhibitors and is negatively regulated by the non-receptor type protein tyrosine phosphatase 14. Oncogene 32, 2220–2229 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.A. Perra, M.A. Kowalik, E. Ghiso, G.M. Ledda-Columbano, L. Di Tommaso, M.M. Angioni, C. Raschioni, E. Testore, M. Roncalli, S. Giordano, A. Columbano, YAP activation is an early event and a potential therapeutic target in liver cancer development. J. Hepatol. 61, 1088–1096 (2014) [DOI] [PubMed] [Google Scholar]
- 40.M.E. Garcia-Rendueles, J.C. Ricarte-Filho, B.R. Untch, I. Landa, J.A. Knauf, F. Voza, V.E. Smith, I. Ganly, B.S. Taylor, Y. Persaud, G. Oler, Y. Fang, S.C. Jhanwar, A. Viale, A. Heguy, K.H. Huberman, F. Giancotti, R. Ghossein, J.A. Fagin, NF2 loss promotes oncogenic RAS-induced thyroid cancers via YAP-dependent transactivation of RAS proteins and sensitizes them to MEK inhibition. Cancer Discov. 5, 1178–1193 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.E. Ciamporcero, H. Shen, S. Ramakrishnan, S. Yu Ku, S. Chintala, L. Shen, R. Adelaiye, K.M. Miles, C. Ullio, S. Pizzimenti, M. Daga, G. Azabdaftari, K. Attwood, C. Johnson, J. Zhang, G. Barrera, R. Pili, YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage. Oncogene 35, 1541–1553 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.T. Moroishi, C.G. Hansen, K.L. Guan, The emerging roles of YAP and TAZ in cancer. Nat. Rev. Cancer 15, 73–79 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.N. Gronich, G. Rennert, Beyond aspirin-cancer prevention with statins, metformin and bisphosphonates. Nat. Rev. Clin. Oncol. 10, 625–642 (2013) [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
The protein levels of YAP were analyzed by western blotting assay in liver cancer cell lines and in a normal human hepatic cell line LO2 (PNG 39 kb) (PNG 24 kb)
Huh-7R and HepG2R were resistant to sorafenib induced apoptosis. (a, b) Huh-7R and HepG2R cells were exposed to the indicated doses of sorafenib for 24 h. Cells were collected for western blotting. (c, d) Proteins from the cytoplasm and nucleus were separated, and the localization of YAP were detected by western blotting. (e, f) The mRNA expressions of CTGF and CYR61 were analyzed by qRT-PCR. Results were presented as mean ± sem (n = 3) for each treatment (PNG 114 kb)
Knockdown YAP expression using shRNAs in Huh-7 and HepG2 cells. Huh-7 and HepG2 cells were transfected with shYAP. (a, b) The protein levels of YAP were analyzed with western blotting. (c, d) The mRNA levels of YAP were analyzed with RT-PCR (PNG 83 kb)
Sorafenib had no significant effect on YAP mRNA expression. (a-b) Huh-7 and HepG2 cells transfected with shYAP were treated with sorafenib for 24 h. The mRNA levels of YAP were analyzed with RT-PCR (PNG 39 kb)
YAP attenuated the cytotoxicity of sorafenib. (a, b) Huh-7 and HepG2 cells transfected with shRNA were treated with different concentration of sorafenib for 72 h. Cell viability was measured by CCK-8. (c) LO2 cells transfected with flag-YAP or vector were treated with different concentration of sorafenib for 72 h. Cell viability was measured by CCK-8 (PNG 35 kb)
YAP inhibitor verteporfin reversed sorafenib resistance. (a, b) Huh-7R and HepG2R cells were treated with sorafenib in combination with or without verteporfin for 24 hours. Cells were analyzed using western blotting. (c, d) Huh-7R and HepG2R cells were treated with different combinations of sorafenib and verteporfin for 72 h. Cell viability was measured by CCK-8. (e, f) Huh-7R and HepG2R cells were treated with different combinations of sorafenib and verteporfin. Cells viability was analyzed by colony formation assay. Columns were the average of three independent experiments. (g) Huh-7R and HepG2R cells were treated with different combinations of sorafenib and verteporfin for 48 h. Cells were analyzed by flow cytometry. Columns were the average of three independent experiments. Results were presented as mean ± sem (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 (PNG 629 kb)
Data Availability Statement
The data and materials supporting the conclusion of this manuscript are included in the article.