Skip to main content
NCBI home page
Cellular Oncology logoLink to Cellular Oncology
. 2021 Nov 5;44(6):1373–1386. doi: 10.1007/s13402-021-00644-7

Hsa-circ_0058106 induces EMT and metastasis in laryngeal cancer via sponging miR-153 and inducing Twist1 nuclear translocation

Xiaowen Zhang 1,2,✉,#, Nan Wu 3,#, Jin Wang 4
PMCID: PMC12980774  PMID: 34738200

Abstract

Purpose

A new circular RNA (hsa-circ_0058106) has been found to be upregulated in laryngeal cancer, but its function remains unknown. Here, we explored its role in the metastasis of laryngeal cancer.

Methods

The level of hsa-circ_0058106 in laryngeal cancer was detected by qRT-PCR. The effect of hsa-circ_0058106 silencing on the metastasis of laryngeal cancer was assessed using scratch wound healing and transwell assays, as well as nude mouse lung metastasis models. Fluorescence in situ hybridization was employed to analyze the cellular localization of hsa-circ_0058106. A luciferase activity assay was used to assess binding between hsa-circ_0058106 and miR-153. Interaction between hsa-circ_0058106 and Twist1 was confirmed using RNA pull-down and RNA immunoprecipitation assays.

Results

A high level of hsa-circ_0058106 was found to be associated with lymph node metastasis and advanced clinical stages. Stable knockdown of hsa-circ_0058106 inhibited the migration and invasion of laryngeal cancer cells in vitro and in vivo. Moreover, we found that downregulation of hsa-circ_0058106 suppressed epithelial-mesenchymal transition (EMT), which was underscored by the observation that hsa-circ_0058106 silencing led to decreases in the expression of N-cadherin and Vimentin, and an increase in the expression of E-cadherin. Mechanistically, we found that hsa-circ_0058106 can specifically bind to miR-153 and regulate Snail1 expression by acting as a miR-153 sponge. In addition, we found that knockdown of hsa-circ_0058106 blocked the nuclear translocation of Twist1.

Conclusions

Our results indicate that hsa-circ_0058106 induces EMT and metastasis in laryngeal cancer by sponging miR-153 and inducing Twist1 nuclear translocation. These observations provide new insights into the regulatory effects of circRNAs in laryngeal cancer metastasis.

Keywords: Laryngeal cancer, Metastasis, Epithelial-mesenchymal transition, Circular RNA, microRNA

Introduction

Laryngeal cancer is one of the major head and neck malignancies worldwide, accounting for approximately 1–5 % of the overall incidence in cancer [1]. Although many advances have been made in the treatment of laryngeal cancer, such as surgical treatment, radiation therapy and chemotherapy in recent years, it has been difficult to substantially improve the 5-year survival rate of patients (approximately 63 %) affected by it [2]. Similar to other types of cancer, metastasis is regarded as the leading cause of death in patients with laryngeal cancer [3]. Therefore, there is an urgent need to explore the mechanism behind the metastasis of laryngeal cancer and to discover new therapeutic targets to block this process.

Circular RNAs (circRNAs), which are closed circular RNA molecules lacking a 5′-end nicotinamide adenine dinucleotide cap and a 3′-end poly(A) tail structure, are newly discovered members of the noncoding RNA family [4]. Compared with traditional linear RNAs, circRNAs are not affected by RNA exonuclease and tend to be more stably expressed [5]. It has been reported that circRNAs play a key role in the progression of cancer [6], especially in regulating the migration and invasion of cancer cells [7]. For example, circCCDC66, a novel circRNA identified in colorectal cancer, has been reported to function as an oncogene to promote the migration and invasion of colon cancer cells [8]. Moreover, it was found that circ-ITCH may serve as a powerful tumor suppressor to inhibit the progression of ovarian cancer [9]. Hence, circRNAs may provide a new direction to explore the molecular mechanism underlying the metastasis of laryngeal cancer. Notably, a recent study aimed at detecting the expression of circRNAs in laryngopharyngeal squamous cell carcinoma by microarray technology revealed 1304 upregulated and 1088 downregulated circRNAs [10]. Among these, hsa-circ_0058106 was confirmed to be significantly upregulated. This circRNA was first identified in a fetal lung fibroblast cell line (AG04450) and is shaped by back-splicing of exons 1, 2 and 3 of FN1 [11]. However, the function of hsa-circ_0058106 remains unknown.

In the present study, we found that a high level of hsa-circ_0058106 expression is associated with lymph node metastasis and an advanced clinical stage of laryngeal cancer. Furthermore, we found that stable knockdown of hsa-circ_0058106 inhibited the migration and invasion of laryngeal cancer cells in vitro and in vivo. Mechanistically, we found that hsa-circ_0058106 regulates epithelial-mesenchymal transition (EMT) by functioning as a miR-153 sponge and by modulating the nuclear translocation of Twist1.

Materials and methods

Laryngeal cancer tissue samples and cell lines

A total of 50 pairs of laryngeal cancer specimens was collected from patients diagnosed with laryngeal cancer by histopathological examination. All patients’ clinical characteristics have been reported before [12]. The use of samples and information was approved by the ethics committee of Shengjing Hospital affiliated to China Medical University, for which each patient also provided consent.

The two different human laryngeal cancer cell lines (Hep-2 and AMC-HN-8) used in this study were purchased from the Cell Biology Institute of Shanghai (Shanghai, China) and the American Type Culture Collection (Manassas, VA, USA), respectively. The cells were cultured in RPMI-1640 medium supplemented with 10 % fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin at 37 °C in a humidified incubator with 5 % CO2.

Cell transfections

A lentiviral plasmid system (LV-GV248-hsa-circ_0058106-shRNA-GFP-Puro) containing short hairpin RNA (shRNA) targeting hsa-circ_0058106, a green fluorescent signal and a puromycin resistance gene was constructed by Genechem Co., Ltd. (Genechem, Shanghai, China). hsa-circ_0058106-shRNA was transfected into laryngeal cancer cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), following the recommended experimental protocol. Forty-eight hours after transfection, the cells were screened by puromycin treatment for 2 weeks to establish cell lines with stable knockdown of hsa-circ_0058106. In addition, miR-153 mimic, miR-153 inhibitor and their corresponding negative controls (NC) obtained from Genechem Co., Ltd., were transfected using Lipofectamine 3000 following the recommended experimental protocol. At 24 or 48 h post-transfection, the cells were subjected to further analyses.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from tissue homogenates or whole-cell lysates using TRIZOL reagent. To analyze the hsa-circ_0058106 level in cytoplasm and nucleus, cytoplasmic and nuclear extracts of laryngeal cancer cells were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA was reverse-transcribed using a PrimeScript RT Reagent Kit (TaKaRa, Aichi Ken, Chiryu Shi, Japan), followed by PCR amplification employing SYBR Premix Ex Taq II (TaKaRa). miRNA was reverse-transcribed using a Mir-X™ miRNA First Strand Synthesis Kit (TaKaRa), followed by PCR amplification using a Mir-X™ miRNA RT-qPCR SYBR® Kit (TaKaRa). All primers used are listed in Table 1. GAPDH and U6 were used as internal controls for circular RNAs and miRNAs, respectively. Relative gene expression analysis was performed using the 2−ΔΔCt method [13].

Table 1.

The information of primer and probe sequences

Name Sequences (5′ to 3′)
Hsa-circ_0058106 forward CTGCAGGTCCAGATCAAACA
Hsa-circ_0058106 reverse GTTTAAGGCCGCTGATGGTA
TWIST1 forward GGGCCGGAGACCTAGATG
TWIST1 reverse TTTCCAAGAAAATCTTTGGCATA
miR-153 TTGCATAGTCACAAAAGTGATC
U6 forward CTCGCTTCGGCAGCACA
U6 reverse AACGCTTCACGAATTTGCGT
GAPDH forward ACAACTTTGGTATCGTGGAAGG
GAPDH reverse GCCATCACGCCACAGTTTC
Hsa-circ_0058106 probe sense Biotin-TGCAGTAACCAGAGGAAATAGCCCT
Hsa-circ_0058106 probe antisense Biotin-AGGGCTATTTCCTCTGGTTACTGCA
Open in a new tab

Scratch wound healing assay

1 × 106 laryngeal cancer cells were seeded into six-well plates in which, after confluency, scratches were made using a 200 ml pipette tip, followed by washing away the cell debris with PBS three times. The cells were cultured in DMEM supplemented with 10 % FBS for 24 h after which photos were taken under an inverted microscope (Olympus, Shinjuku, Tokyo, Japan) to measure the wound width. Relative wound width = Wf / Wi (in which Wi is the initial wound width and Wf is the final wound width).

Cell migration and invasion assays

Laryngeal cancer cells in logarithmic growth phase were detached by pancreatin, collected, and suspended in medium without serum. For the cell migration assay, 1 × 105 cells were seeded in the upper transwell chamber and medium containing 10 % FBS was added to the lower chamber, followed by incubation for 24 h at 37 °C and 5 % CO2. Cells migrating onto the lower surface of the membrane were subjected to methanol fixation, followed by hematoxylin and eosin staining. For the cell invasion assay, 100 µl Matrigel (BD Biosciences, San Jose, CA, USA) was added to the upper chamber to prepare a Matrigel-coated membrane. The next steps were the same as in the cell migration assay.

In vivo animal model

A total of 12 Balb/c nude male mice 6 weeks of age were purchased from Changsheng Biological Technology Co., Ltd. (Changsheng, Benxi, Liaoning, China) and kept under pathogen-free housing conditions with a 12 h light/dark cycle and ad libitum access to clean drinking water and food. The care and use of animals adhered to the Guide for the Care and Use of Laboratory Animals promulgated by the National Institutes of Health and was approved by the Animal Ethics Committee of Shengjing Hospital of China Medical University.

The lung metastatic model was established as previously described [14]. Briefly, the animals were divided into two groups as follows: (i) a sh-NC group, in which six mice were injected with 3 × 106 Hep-2 cells stably transfected with shRNA-NC via the tail vein and (ii) a sh-circ group, in which six mice were injected with 3 × 106 Hep-2 cells stably transfected with hsa-circ_0058106-shRNA via the tail vein. At 6 weeks post-injection, the mice were sacrificed by sodium pentobarbital anesthesia. Ten minutes before sacrifice, the mice were photographed using an in vivo imaging system (FX Pro, Kodak, Rochester, NY, USA) by which luciferase signals were determined. After sacrifice, the lungs were harvested, polyoxymethylene-fixed and paraffin-embedded, followed by HE staining.

Immunohistochemistry

Laryngeal cancer tissues and lung metastatic tumors formed by Hep-2 cells were sliced into 3.5-µm-thick sections after which the expression of E-cadherin, N-cadherin and Vimentin was determined by immunohistochemistry, as previously described [12]. The primary antibodies specific for E-cadherin, N-cadherin and Vimentin used were purchased from Abcam (Abcam, Cambridge, UK) and diluted to 1:200 with PBS for detection.

RNA fluorescence in situ hybridization (RNA-FISH)

RNA-FISH was carried out based on a previous report [15]. The probe targeting the back-splicing site of hsa-circ_0058106 labeled with biotin-dUTP was designed and synthesized by Servicebio (Servicebio, Wuhan, Hubei, China). Cells were fixed for 20 min in paraformaldehyde fixation and next treated with Proteinase K (20 µg/ml) for 5 min, followed by probe incubation (8 ng/µl) at 37 °C in a molecular hybridization chamber overnight. After washing with saline sodium citrate buffer, images were obtained by fluorescence microscopy (Nikon, Tokyo, Japan).

Luciferase activity assay

Sequences of hsa-circ_0058106 containing wild-type or mutant miR-153 binding sites were amplified by PCR and cloned into GV272 luciferase reporter vectors (GenePharma Co., Ltd., Shanghai, China), which were subsequently named GV272-hsa-circ_0058106-Wt and GV272-hsa-circ_0058106-Mut, respectively. HEK293 cells seeded in a 24-well culture plate were co-transfected with GV272-hsa-circ_0058106-Wt or GV272-hsa-circ_0058106-Mut with miR-153 mimics and miR-153 NC. Forty-eight hours later, a Dual-Glo Luciferase Assay System (Promega, Madison, Wisconsin, USA) was employed to measure luciferase activity, in accordance with the manufacturer’s recommendations.

RNA pull-down assay

The RNA pull-down assay was carried out in accordance with a previous report [16]. Whole-cell lysates were incubated with biotin-labeled probes designed and synthesized by Genechem Co., Ltd., at 37 °C overnight. Subsequently, streptavidin magnetic beads (Invitrogen) were added to the mixture, followed by rotation at room temperature for 1 h. The probe-labeled beads were lightly washed, thermally denatured in SDS buffer, and subjected to Western blot analysis for the detection of enriched proteins.

RNA immunoprecipitation (RIP) assay

The RIP assay was conducted using an EZ-Magna RIP™RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) in accordance with the manufacturer’s recommendations. Specifically, cell lysates were prepared using RIP lysis buffer. Next, 5 µg anti-Twist1 antibody (Abcam) and magnetic beads were co-incubated to allow conjugation. Subsequently, 100 µl cell lysate was mixed with the antibody conjugated beads and rotated at 4 °C overnight. Enrichment of RNAs by the Twist1 protein was detected using qRT-PCR.

Western blotting

Total protein was extracted from whole-cell lysates using RIPA Reagent (Invitrogen). Protein concentrations were measured using the bicinchoninic acid (BCA) method, as reported before [17]. Protein samples (50 µg per well) were loaded onto 8 % or 10 % sodium dodecyl sulfate polyacrylamide gels for electrophoretic separation, and next transferred to PVDF membranes. Subsequently, the membranes were blocked with 1 % BSA solution at room temperature for 2 h, followed by incubation with primary antibodies specific for E-cadherin, N-cadherin, Vimentin, Snail1, RUNX2, TGFBR2, ZEB, MTDH, ADAM19 and Twist1 (Abcam) at 1:1000 dilution and 4 °C overnight. After washing three times with TBST buffer, the membranes were incubated with goat anti-rabbit or goat anti-mouse IgG (Abcam) at 1:5000 dilution and 37 °C for 30 min. For protein detection, a chemiluminescence (ECL) method using Enhanced ECL for Western Blotting Kit (Beyotime, Shanghai, China) was applied. Band densities were measured using Image J software.

Statistical analysis

The data in this paper are presented as mean ± standard deviation (SD). All statistical analyses were performed using SSPS 17.0 software. Comparison of two groups was performed by Student’s t-test. When comparing more than two groups, one-way analysis of variance (ANOVA) was applied, followed by multiple comparison analysis using Fisher’s least significant difference test. Statistical significance was set at p < 0.05.

Results

Hsa-circ_0058106 is upregulated in laryngeal cancer

Hsa-circ_0058106 is structured by back-splicing of exons 1, 2 and 3 of FN1 (Fig. 1A) as indicated in the circBase database (http://www.circbase.org/). We found that the level of hsa-circ_0058106 in Hep-2 cells showed no significant change after RNase R treatment, while the level of linear RNA (GAPDH) was remarkably decreased after this treatment (Fig. 1B). In addition, we found that the expression of hsa-circ_0058106 was upregulated in laryngeal cancer tissues compared to matching adjacent normal tissues (Fig. 1C). We also found that a high level of hsa-circ_0058106 expression was associated with lymph node metastasis and advanced clinical stages (Fig. 1D and E).

Fig. 1.

Fig. 1

Open in a new tab

Hsa-circ_0058106 is upregulated in laryngeal cancer. (A) Genomic location of hsa-circ_0058106. (B) Following RNase R treatment, the expression of GAPDH and hsa-circ_0058106 in Hep-2 cells was measured by qRT-PCR. Data were collected from three independent experiments, and are presented as mean ± SD. **, p < 0.01; NS, no significance. (C) Hsa-circ_0058106 expression in laryngeal cancer tissues and matching adjacent normal tissues measured by qRT-PCR (n = 50). (D) Analysis of hsa-circ_0058106 expression in laryngeal cancer tissues with (n = 18) or without (n = 32) lymph node metastasis. (E) Analysis of hsa-circ_0058106 expression in laryngeal cancer tissues in clinical stage I/II (n = 16) and clinical stage III/IV (n = 34) groups. Data are expressed as mean ± SD; *p < 0.05; **p < 0.01

Downregulation of hsa-circ_0058106 inhibits the migration and invasion of laryngeal cancer cells in vitro and in vivo

To explore the role of hsa-circ_0058106 in the migration and invasion of laryngeal cancer, stable knockdown of hsa-circ_0058106 in laryngeal cancer cells was performed using a sh-hsa-circ_0058106 lentiviral system (Fig. 2A). We found that stable knockdown of hsa-circ_0058106 significantly inhibited cell migration (Fig. 2B and C) and invasion (Fig. 2D). To confirm the effect of hsa-circ_0058106 silencing on the migration and invasion in vivo, Hep-2 cells stably transfected with sh-hsa-circ_0058106 or NC were administered to nude mice via the tail vein. The results indicated that mice injected with sh-hsa-circ_0058106 Hep-2 cells displayed lower green fluorescence intensities in the lungs (Fig. 3A), fewer metastases in lung surfaces (Fig. 3B) and smaller metastatic areas (Fig. 3C) compared to those injected with sh-NC Hep-2 cells. Collectively, these results indicate that downregulation of hsa-circ_0058106 inhibits the migration and invasion of laryngeal cancer cells in vitro and in vivo.

Fig. 2.

Fig. 2

Open in a new tab

Downregulation of hsa-circ_0058106 inhibits the migration and invasion of laryngeal cancer cells in vitro. (A) qRT-PCR analysis of hsa-circ_0058106 expression in laryngeal cancer cells transfected with sh-hsa-circ_0058106 (sh-circ) or negative control (sh-NC). The expression of hsa-circ_0058106 is significantly downregulated in the sh-circ group compared with that in the sh-NC group. (B) Wound healing cell migration, (C) Transwell cell migration and (D) Transwell cell invasion assays after hsa-circ_0058106 knockdown in laryngeal cancer cells. Cells in the Transwell cell migration and invasion assays were stained with hematoxylin and eosin. All data were collected from three independent experiments, and are presented as mean ± SD. *p < 0.05; **p < 0.01

Fig. 3.

Fig. 3

Open in a new tab

Hsa-circ_0058106 silencing suppresses laryngeal cancer cell metastasis in vivo. Hep-2 cells with GFP-expressing sh-hsa-circ_0058106 (sh-circ) and negative control (sh-NC) were injected into nude mice via the caudal vein. Six weeks later the lungs were analyzed. (A) Representative images and quantification of luciferase signals in the mice (n = 6 per group). (B) Representative images and quantification of the number of surface metastases in mouse lungs (n = 6 per group). (C) Representative images of HE-stained lung sections and quantification of the number of metastases normalized to lung area. Metastases are indicated with arrows (n = 6 per group). Data are presented as mean ± SD; *p < 0.05

Downregulation of hsa-circ_0058106 inhibits EMT

EMT has been shown to play a key role in tumor invasion and metastasis [18]. Therefore, we next set out to investigate whether hsa-circ_0058106 has an effect on EMT. Using immunohistochemistry we found that E-cadherin expression in laryngeal cancer tissues with a low hsa-circ_0058106 expression was stronger than in those with a high expression, while the opposite was found for N-cadherin and Vimentin expression (Fig. 4A). Moreover, we found that the expression of E-cadherin in metastatic tumors formed after injection of sh-hsa-circ_0058106 Hep-2 cells was stronger and that the expression of N-cadherin and Vimentin was lower than that in subcutaneous xenografts formed after the injection of sh-nc Hep-2 cells (Fig. 4B). In addition, we found that after treatment with TGF-β (EMT inducer) the expression of E-cadherin in laryngeal cancer cells was decreased, and the expression of N-cadherin and Vimentin was increased. Stable knockdown of hsa-circ_0058106 resulted in reverse changes in the above-mentioned EMT marker proteins caused by TGF-β (Fig. 4C). Collectively, these results indicate that downregulation of hsa-circ_0058106 may suppress EMT.

Fig. 4.

Fig. 4

Open in a new tab

Downregulation of hsa-circ_0058106 inhibits epithelial-mesenchymal transition. (A) Immunohistochemical staining of E-cadherin, N-cadherin and Vimentin in laryngeal cancer tissues. The tissues are divided into groups with high hsa-circ_0058106 expression (circ_0058106-H) (fold change ≥ 2) and low hsa-circ_0058106 expression (circ_0058106-L) (fold change < 2) (n = 5). (B) Immunohistochemical staining of E-cadherin, N-cadherin and Vimentin in metastatic tumors of mouse lungs after hsa-circ_0058106 knockdown (n = 5 per group). (C) After hsa-circ_0058106 knockdown laryngeal cancer cells were treated with 10 ng/ml TGF-β for 24 h to induce epithelial-mesenchymal transition. The expression of E-cadherin, N-cadherin and Vimentin was detected by Western blotting. Data were collected from three independent experiments, and are presented as mean ± SD. *p < 0.05

Sub-cellular localization of hsa-circ_0058106 in laryngeal cancer cells

Using RNA-FISH, we found that hsa-circ_0058106 is expressed in both the cytoplasm and nucleus of laryngeal cancer cells (Fig. 5A). Quantitative analysis by qRT-PCR revealed that the expression ratio of hsa-circ_0058106 in the cytoplasm to that in the nucleus of laryngeal cancer cells was close to 7:3 (Fig. 5B).

Fig. 5.

Fig. 5

Open in a new tab

Localization of hsa-circ_0058106 in laryngeal cancer cells. (A) RNA fluorescence in situ hybridization (RNA-FISH) was performed for hsa-circ_0058106. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI); original magnification 400×. (B) hsa-circ_0058106 and GAPDH levels in the nuclear and cytoplasmic extracts were analyzed by qRT-PCR. All data were collected from three independent experiments, and are presented as mean ± SD. *p < 0.05

Hsa-circ_0058106 regulates the expression of Snail1 by functioning as a miR-153 sponge

It has been reported that circRNAs in the cytoplasm may act as “microRNA sponges” to regulate the progression of malignant tumors [19]. Thus, we next examined whether hsa-circ_0058106 regulates EMT by acting as a microRNA sponge. Previously, miR-153 has been shown to regulate EMT in several cancers [20–25], including laryngeal cancer [20]. Using TargetScan prediction, we found that miR-153 has a binding site on the hsa-circ_0058106 transcript (Fig. 6A). Hence, a luciferase reporter assay was employed to confirm specific binding of hsa-circ_0058106 to miR-153. A significant decrease in luciferase activity was observed upon co-transfection of a wild-type hsa-circ_0058106-luciferase reporter vector with miR-153 mimic, while no significant alteration in luciferase activity was noted upon co-transfection of a mutated-type hsa-circ_0058106-luciferase reporter vector with miR-153 mimics, which suggests that hsa-circ_0058106 can indeed bind to miR-153 (Fig. 6A). Moreover, we found that knockdown of hsa-circ_0058106 led to an increase in miR-153 expression in laryngeal cancer cells (Fig. 6B). Conversely, no significant change in the expression of hsa-circ_0058106 after treatment with miR-153 inhibitor was observed (Fig. 6C).

Fig. 6.

Fig. 6

Open in a new tab

Hsa-circ_0058106 regulates Snail1 expression by functioning as a miR-153 sponge. (A) The potential miR-153 binding site on hsa-circ_0058106, as predicted by bioinformatic software, was mutated for luciferase assays. Luciferase activity measured in HEK293 cells co-transfected with luciferase vector hsa-circ_0058106 (circ_0058106-wt) or hsa-circ_0058106 mutant vector (circ_0058106-mut) combined with miRNA mimic. (B) qRT-PCR analysis of miR-153 expression after hsa-circ_0058106 knockdown in laryngeal cancer cells. (C) qRT-PCR analysis of hsa-circ_0058106 expression after transfection of miR-153 inhibitor into laryngeal cancer cells. (D) Western blot analysis of the expression of miR-153 targets after hsa-circ_0058106 knockdown in laryngeal cancer cells. (E) Western blot analysis of Snail1, E-cadherin, N-cadherin and Vimentin expression in hsa-circ_0058106 knockdown laryngeal cancer cells after transfection of a miR-153 inhibitor. All data were collected from three independent experiments, and are presented as mean ± SD. *p < 0.05, NS, no significance

Furthermore, the effect of hsa-circ_0058106 on six known miR-153 target genes (Snail1 [20], RUNX2 [21], TGFBR2 [22], ZEB [23], MTDH [24] and ADAM19 [25]) involved in EMT were examined. We found that the expression of only Snail1 was notably reduced after stable knockdown of hsa-circ_0058106 in laryngeal cancer cells (Fig. 6D). This reduction in Snail1 expression by hsa-circ_0058106 knockdown could be rescued via treatment with a miR-153 inhibitor (Fig. 6E). The downregulation of N-cadherin and Vimentin and the upregulation of E-cadherin by hsa-circ_0058106 knockdown was also rescued by treatment with this miR-153 inhibitor (Fig. 6E). Together, these results suggest that hsa-circ_0058106 regulates the expression of Snail1 by serving as a miR-153 sponge.

Hsa-circ_0058106 interacts with Twist1 and regulates its nuclear translocation

Given that hsa-circ_0058106 was also found in the nucleus, also putative interactions between hsa-circ_0058106 and transcription factors were examined. To this end, proteins that interact with hsa-circ_0058106 in laryngeal cancer cells were pulled down and identified by Western blotting. Among a large number of EMT-related transcription factors, only Twist1 was pulled down by the hsa-circ_0058106 probe (Fig. 7A). Conversely, we found that hsa-circ_0058106 was significantly enriched by Twist1 (Fig. 7B). Interestingly, the mRNA and protein levels of Twist1 were not found to be affected by hsa-circ_0058106 knockdown (Fig. 7C and D). Thus, we next set out to investigate whether hsa-circ_0058106 affects the nuclear translocation of Twist1. We found that the level of Twist1 in the nucleus was significantly reduced after hsa-circ_0058106 knockdown (Fig. 7E), while its level in the cytoplasm was increased (Fig. 7F). This alteration in Twist1 nuclear translocation was also observed in Hep-2 and AMC-HN-8 cells stably transfected with sh-hsa-circ_0058106 (Fig. 7G). Collectively, these results suggest that hsa-circ_0058106 may interact with Twist1 and, by doing so, regulate its nuclear translocation.

Fig. 7.

Fig. 7

Open in a new tab

Hsa-circ_0058106 interacts with Twist1 and regulates its nuclear translocation. (A) Biotin-labeled hsa-circ_0058106 probes were used to pull down interacting proteins in laryngeal cancer cells. Pulled-down proteins were detected by Western blotting. (B) RNA immunoprecipitation (RIP) assay with qRT-PCR showing that hsa-circ_0058106 can be pulled down by an anti-Twist1 antibody in laryngeal cancer cells. (C) qRT-PCR analysis of Twist1 mRNA expression after hsa-circ_0058106 knockdown in laryngeal cancer cells. Twist1 expression in whole-cell lysates (D), nuclei (E) and cytoplasm (F) detected by Western blotting. (G) Twist1 nuclear translocation observed by immunofluorescence. All data were collected from three independent experiments, and are presented as mean ± SD. *p < 0.05; NS, no significance

Discussion

Ample evidence indicates that circRNAs may play important roles in the metastasis of laryngeal cancer [26, 27]. Wang et al. found that circFLNA (hsa_circ_0092012) is associated with lymph node metastases of laryngeal cancer, and that its upregulation can promote the migration of laryngeal cancer cells via enhancing FLNA and MMP2 expression [26]. The authors also revealed that circRNA_100290 is associated with advanced TNM stages and lymph node metastases in laryngeal cancer patients, and that its overexpression enhances the migration and invasion of laryngeal cancer cells [27]. Similarly, we found that a high level of hsa-circ_0058106 expression is positively associated with lymph node metastases and advanced laryngeal cancer clinical stages, suggesting that hsa-circ_0058106 may be related to the metastases of laryngeal cancer. Furthermore, we found that stable knockdown of hsa-circ_0058106 inhibited the migration and invasion of laryngeal cancer cells in vitro and in vivo. Therefore, we suggest that hsa-circ_0058106 may serve as a potential target to prevent laryngeal cancer metastasis.

Epithelial-mesenchymal transition (EMT) refers to a process by which epithelial cells become deprived of their polarity and intercellular adhesion, and gradually transform into mesenchymal cells by gaining the abilities to infiltrate and migrate [28]. This phenotypic transformation allows tumor cells to lose intercellular adhesion, thereby becoming more invasive. Thus, EMT is considered essential for the initiation of cancer cell metastasis [29]. When EMT occurs, epithelial cell markers, such as E-cadherin, will gradually be lost, while at the same time the mesenchymal cell phenotype will be acquired, as underscored by an increased expression of N-cadherin and Vimentin [30, 31]. Recently, it was found that circCORO1C silencing led to E-cadherin upregulation and N-cadherin, Vimentin and Slug downregulation in laryngeal cell cancer, suggesting that circRNAs may serve as EMT regulators in this type of cancer [32]. Hence, we set out to assess whether hsa-circ_0058106 can regulate EMT. As expected, we not only found that laryngeal cancer tissues with high hsa-circ_0058106 expression tended to have a lower E-cadherin expression and higher N-cadherin and Vimentin expression, but also noted that hsa-circ_0058106 downregulation could suppress EMT in vitro and in vivo. These results may not only at least partially explain why hsa-circ_0058106 downregulation suppresses laryngeal cancer metastasis, but may also provide a direction through which to clarify the mechanism underlying the regulation of migration and invasion by hsa-circ_0058106.

It has been found that the functions of circRNAs may be associated with their sub-cellular location [19]. CircRNAs that are predominantly located in the cytoplasm usually function as sponges of microRNAs to sequester the latter from their target mRNAs as competitive endogenous RNAs (ceRNAs) [19]. Given the observation that about 70 % of hsa-circ_0058106 is located in the cytoplasm, we hypothesized that hsa-circ_0058106 may regulate EMT by acting as a microRNA sponge. miR-153 has been found to be a key regulator of EMT in several types of cancer [20–25], including laryngeal cancer [20]. In addition, it has been shown that miR-153 may regulate EMT by targeting SNAIL1 [20], RUNX2 [21], TGFBR2 [22], ZEB [23], MTDH [24] and/or ADAM19 [25],which are important regulatory factors responsible for EMT. In the present study, we revealed specific binding between hsa-circ_0058106 and miR-153, and showed that hsa-circ_0058106 regulates Snail1 expression by functioning as a miR-153 sponge, thereby modulating EMT in laryngeal cancer cells. It should be noted that hsa-circ_0058106 had no effect on the five other targets. This may be explained by the possibility that the alteration in hsa-circ_0058106 expression does not approach the abundance of the respective miRNA targets [33], precluding a detectable effect on gene expression regulation.

Despite the fact that most circRNAs are located in the cytoplasm [34], some of them, such as EIciRNAs [35] and circRHOT1 [36], have been found to be located in the nucleus and to regulate transcription. Given our observation that about 30 % of hsa-circ_0058106 is located in the nucleus, the question arises whether hsa-circ_0058106 may regulate transcription in a similar manner. In the present study, we identified an interaction between hsa-circ_0058106 and Twist1, which is a key transcription factor for the initiation of EMT [37]. Twist1 has been shown to bind to the E-box element within the promoter region of the E-cadherin and N-cadherin genes, leading to inhibition of the E-cadherin promoter and activation of the N-cadherin promoter, thereby downregulating E-cadherin expression and upregulating N-cadherin expression [38, 39]. However, we found no change in the mRNA and protein levels of Twist1 after hsa-circ_0058106 knockdown. Recent studies have shown that circRNAs can regulate the nuclear localization of transcription factors by interacting with them directly [40]. It has been found, for instance, that circ-Amotl1 can induce c-Myc [41] and Stat-3 [42] nuclear translocation by directly interacting with them. Thus, we investigated whether hsa-circ_0058106 can affect the nuclear translocation of Twist1 in the same way. As expected, we found that downregulation of hsa-circ_0058106 inhibited the nuclear translocation of Twist1 by interacting with it. This finding may account for the regulation of metastasis and EMT by hsa-circ_0058106.

In conclusion, our data indicate that hsa-circ_0058106 may induce EMT and metastasis activation in laryngeal cancer cells via sponging miR-153 and inducing Twist1 nuclear translocation (Fig. 8). This finding may provide new insights into the regulatory effects of circRNAs on laryngeal cancer cell metastasis and reveal a novel therapeutic target for treating this condition.

Fig. 8.

Fig. 8

Open in a new tab

Scheme depicting the regulation of laryngeal cancer metastasis by hsa-circ_0058106

Author contributions

Xiaowen Zhang: Conceptualization, investigation, methodology, data curation, validation, funding acquisition, project administration, resources, writing and original draft preparation. Nan Wu: Conceptualization, investigation, methodology, data curation, validation, funding acquisition, project administration, resources, writing and original draft preparation. Jin Wang: Investigation, methodology, data curation, validation and, visualization. All authors read and approved the final manuscript.

Funding

This study was funded by the National Natural Science Foundation of China (Grant nos. 81802698 and 81800232) and the Science Foundation of Liaoning Province (Grant no. 20180551013).

Data availability

All data are available in the article or available from the authors upon request.

Declarations

Conflict of interest

The authors declare that they have no competing interests.

Ethics approval and consent to participate

The use of the patient samples and information was approved by the ethics committee of Shengjing Hospital affiliated to China Medical University. The care and use of animals adhered to the Guide for the Care and Use of Laboratory Animals promulgated by the National Institutes of Health and was approved by the Animal Ethics Committee of Shengjing Hospital of China Medical University.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xiaowen Zhang and Nan Wu contributed equally to this work.

References

  • 1.R.L. Siegel, K.D. Miller, A. Jemal, Cancer Statistics, 2017. CA Cancer J. Clin. 67, 7–30 (2017) [DOI] [PubMed]
  • 2.C.E. Steuer, M. El-Deiry, J.R. Parks, K.A. Higgins, N.F. Saba, An update on larynx cancer. CA Cancer J. Clin. 67, 31–50 (2017) [DOI] [PubMed] [Google Scholar]
  • 3.A.S. Ho, S. Kim, M. Tighiouart, C. Gudino, A. Mita, K.S. Scher, A. Laury, R. Prasad, S.L. Shiao, N. Ali, C. Patio, J. Mallen-St Clair, J.E. Van Eyk, Z.S. Zumsteg, Association of quantitative metastatic lymph node burden with survival in hypopharyngeal and laryngeal cancer. JAMA Oncol. 4, 985–989 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.L.S. Kristensen, M.S. Andersen, L.V.W. Stagsted, K.K. Ebbesen, T.B. Hansen, J. Kjems, The biogenesis, biology and characterization of circular RNAs. Nat. Rev. Genet. 20, 675–691 (2019) [DOI] [PubMed] [Google Scholar]
  • 5.W.R. Jeck, J.A. Sorrentino, K. Wang, M.K. Slevin, C.E. Burd, J. Liu, W.F. Marzluff, N.E. Sharpless, Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA 19, 141–157 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.W.L. Ng, T.B. Mohd Mohidin, K. Shukla, Functional role of circular RNAs in cancer development and progression. RNA Biol. 15, 995–1005 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Y. Shao, B. Lu, The crosstalk between circular RNAs and the tumor microenvironment in cancer metastasis. Cancer Cell Int. 20, 448 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.K.Y. Hsiao, Y.C. Lin, S.K. Gupta, N. Chang, L. Yen, H.S. Sun, S.J. Tsai, Noncoding effects of circular RNA CCDC66 promote colon cancer growth and metastasis. Cancer Res. 77, 2339–2350 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.J. Hu, L. Wang, J. Chen, H. Gao, W. Zhao, Y. Huang, T. Jiang, J. Zhou, Y. Chen, The circular RNA circ-ITCH suppresses ovarian carcinoma progression through targeting miR-145/RASA1 signaling. Biochem. Biophys. Res. Commun. 505, 222–228 (2018) [DOI] [PubMed] [Google Scholar]
  • 10.S. Cao, D. Wei, X. Li, J. Zhou, W. Li, Y. Qian, Z. Wang, G. Li, X. Pan, D. Lei, Novel circular RNA expression profiles reflect progression of patients with hypopharyngeal squamous cell carcinoma. Oncotarget 8, 45367–45379 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.J. Salzman, R.E. Chen, M.N. Olsen, P.L. Wang, P.O. Brown, Cell-type specific features of circular RNA expression. PLoS Genet. 9, e1003777 (2013) [DOI] [PMC free article] [PubMed]
  • 12.X. Zhang, N. Wu, J. Wang, Z. Li, LncRNA MEG3 inhibits cell proliferation and induces apoptosis in laryngeal cancer via miR-23a/APAF-1 axis. J. Cell. Mol. Med. 23, 6708–6719 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408 (2001) [DOI] [PubMed] [Google Scholar]
  • 14.D. Wu, X. Zhang, Z. Liu, H. Yan, J. Mai, Z. Zhao, Q. Zhong, X. Liu, Decreased expression of protein tyrosine kinase 6 contributes to tumor progression and metastasis in laryngeal squamous cell carcinoma. Biochem. Biophys. Res. Commun. 503, 1378–1384 (2018) [DOI] [PubMed] [Google Scholar]
  • 15.A. Zirkel, A. Papantonis, Detecting circular RNAs by RNA fluorescence in situ hybridization. Methods Mol. Biol. 1724, 69–75 (2018) [DOI] [PubMed] [Google Scholar]
  • 16.C. Barnes, A. Kanhere, Identification of RNA-protein interactions through in vitro RNA pull-down assays. Methods Mol. Biol. 1480, 99–113 (2016) [DOI] [PubMed] [Google Scholar]
  • 17.J.M. Walker, The bicinchoninic acid (BCA) assay for protein quantitation. Methods Mol. Biol. 32, 5–8 (1994) [DOI] [PubMed] [Google Scholar]
  • 18.J. Lindsay, S.D. Talbot, P.C. Bhattacharya, Kuo, Epithelial-mesenchymal transition, the tumor microenvironment, and metastatic behavior of epithelial malignancies. Int. J. Biochem. Mol. Biol. 3, 117–136 (2012) [PMC free article] [PubMed] [Google Scholar]
  • 19.X. Li, L. Yang, L.L. Chen, The biogenesis, functions, and challenges of circular RNAs. Mol. Cell 71, 428–442 (2018) [DOI] [PubMed] [Google Scholar]
  • 20.B. hang, T. Fu, L. Zhang, MicroRNA-153 suppresses human laryngeal squamous cell carcinoma migration and invasion by targeting the SNAI1 gene. Oncol. Lett. 16, 5075–5083 (2018) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Z. Zuo, F. Ye, Z. Liu, J. Huang, Y. Gong, MicroRNA-153 inhibits cell proliferation, migration, invasion and epithelial-mesenchymal transition in breast cancer via direct targeting of RUNX2. Exp. Ther. Med. 17, 4693–4702 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.J. Wang, S. Liang, X. Duan, Molecular mechanism of miR-153 inhibiting migration, invasion and epithelial-mesenchymal transition of breast cancer by regulating transforming growth factor beta (TGF-beta) signaling pathway. J. Cell. Biochem. 120, 9539–9546 (2019) [DOI] [PubMed] [Google Scholar]
  • 23.D. Shi, Y. Li, L. Fan, Q. Zhao, B. Tan, G. Cui, Upregulation of miR-153 inhibits triple-negative breast cancer progression by targeting ZEB2-mediated EMT and contributes to better prognosis. OncoTargets Ther. 12, 9611–9625 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.W. Li, L. Zhai, C. Zhao, S. Lv, MiR-153 inhibits epithelial-mesenchymal transition by targeting metadherin in human breast cancer. Breast Cancer Res Treat. 150, 501–509 (2015) [DOI] [PubMed] [Google Scholar]
  • 25.N. Shan, L. Shen, J. Wang, D. He, C. Duan, MiR-153 inhibits migration and invasion of human non-small-cell lung cancer by targeting ADAM19. Biochem. Biophys. Res. Commun. 456, 385–391 (2015) [DOI] [PubMed] [Google Scholar]
  • 26.J.X. Wang, Y. Liu, X.J. Jia, S.X. Liu, J.H. Dong, X.M. Ren, O. Xu, H.Z. Zhang, H.J. Duan, C.G. Shan, Upregulation of circFLNA contributes to laryngeal squamous cell carcinoma migration by circFLNA-miR-486-3p-FLNA axis. Cancer Cell Int. 19, 196 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Z. Wang, C. Huang, A. Zhang, C. Lu, L. Liu, Overexpression of circRNA_100290 promotes the progression of laryngeal squamous cell carcinoma through the miR-136-5p/RAP2C axis. Biomed. Pharmacother. 125, 109874 (2020) [DOI] [PubMed] [Google Scholar]
  • 28.M. Diepenbruck, G. Christofori, Epithelial-mesenchymal transition (EMT) and metastasis: yes, no, maybe? Curr. Opin. Cell Biol. 43, 7–13 (2016) [DOI] [PubMed] [Google Scholar]
  • 29.K.T. Yeung, J. Yang, Epithelial-mesenchymal transition in tumor metastasis. Mol. Oncol. 11, 28–39 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.T.Y. Na, L. Schecterson, A.M. Mendonsa, B.M. Gumbiner. The functional activity of E-cadherin controls tumor cell metastasis at multiple steps. Proc. Natl. Acad. Sci. USA 117, 5931–5937 (2020) [DOI] [PMC free article] [PubMed]
  • 31.K. Vuoriluoto, H. Haugen, S. Kiviluoto, J.P. Mpindi, J. Nevo, C. Gjerdrum, C. Tiron, J.B. Lorens, J. Ivaska, Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer. Oncogene 30, 1436–1448 (2011) [DOI] [PubMed] [Google Scholar]
  • 32.Y. Wu, Y. Zhang, X. Zheng, F. Dai, Y. Lu, L. Dai, M. Niu, H. Guo, W. Li, X. Xue, Y. Bo, Y. Guo, J. Qin, Y. Qin, H. Liu, Y. Zhang, T. Yang, L. Li, L. Zhang, R. Hou, S. Wen, C. An, H. Li, W. Xu, W. Gao, Circular RNA circCORO1C promotes laryngeal squamous cell carcinoma progression by modulating the let-7c-5p/PBX3 axis. Mol. Cancer 19, 99 (2020) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.J. Salzman, C. Gawad, P.L. Wang, N. Lacayo, P.O. Brown, Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types. PLoS One 7, e30733 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.R. Denzler, V. Agarwal, J. Stefano, D.P. Bartel, M. Stoffel, Assessing the ceRNA hypothesis with quantitative measurements of miRNA and target abundance. Mol. Cell 54, 766–776 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Z. Li, C. Huang, C. Bao, L. Chen, M. Lin, X. Wang, G. Zhong, B. Yu, W. Hu, L. Dai, P. Zhu, Z. Chang, Q. Wu, Y. Zhao, Y. Jia, P. Xu, H. Liu, G. Shan, Exon-intron circular RNAs regulate transcription in the nucleus. Nat. Struct. Mol. Biol. 22, 256–264 (2015) [DOI] [PubMed] [Google Scholar]
  • 36.L. Wang, H. Long, Q. Zheng, X. Bo, X. Xiao, B. Li, Circular RNA circRHOT1 promotes hepatocellular carcinoma progression by initiation of NR2F6 expression. Mol. Cancer 18, 119 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.J. Yang, S.A. Mani, J.L. Donaher, S. Ramaswamy, R.A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, R.A. Weinberg, Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117, 927–939 (2004) [DOI] [PubMed] [Google Scholar]
  • 38.F. Vesuna, P. van Diest, J.H. Chen, V. Raman, Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem. Biophys. Res. Commun. 367, 235–241 (2008) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.N.R. Alexander, N.L. Tran, H. Rekapally, C.E. Summers, C. Glackin, R.L. Heimark, N-cadherin gene expression in prostate carcinoma is modulated by integrin-dependent nuclear translocation of Twist1. Cancer Res. 66, 3365–3369 (2006) [DOI] [PubMed] [Google Scholar]
  • 40.J. Luo, H. Liu, S. Luan, Z. Li, Guidance of circular RNAs to proteins’ behavior as binding partners. Cell. Mol. Life Sci. 76, 4233–4243 (2019) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Q. Yang, W.W. Du, N. Wu, W. Yang, F.M. Awan, L. Fang, J. Ma, X. Li, Y. Zeng, Z. Yang, J. Dong, A. Khorshidi, B.B. Yang, A circular RNA promotes tumorigenesis by inducing c-myc nuclear translocation. Cell Death Differ. 24, 1609–1620 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Z.G. Yang, F.M. Awan, W.W. Du, Y. Zeng, J. Lyu, D. Wu, S. Gupta, W. Yang, B.B. Yang, The circular RNA interacts with STAT3, increasing its nuclear translocation and wound repair by modulating Dnmt3a and miR-17 function. Mol. Ther. 25, 2062–2074 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are available in the article or available from the authors upon request.

Articles from Cellular Oncology are provided here courtesy of Springer

RESOURCES