Abstract
The extracellular matrix (ECM) defines the biomechanical and biochemical microenvironment of tissues, directing cell behaviour and phenotype. In the ovary, ECM must dynamically remodel in each cycle under hormonal regulation to control follicle development and produce fertilizable oocytes. Dysregulation of this process may result in aberrant formation of ECM as seen in polycystic ovary syndrome (PCOS) whose pathology includes fibrosis of the ovary and which is a major cause of infertility. PCOS is characterised by hyperandrogenism and, here, we investigate the impact of androgens on fibrosis, cell-ECM interactions and mechanosensing. We report an altered network of gene expression related to the genesis of fibrosis. Preantral follicles from C57BL/6 mice (14–15 days postpartum) were stimulated with dihydrotestosterone (DHT, 10nM) in 24/72 hours culture. Expression of fibrosis-associated genes (Eln; Ctgf; Acta2; Plod2; Hpse) significantly increased with androgen (72 h), as did TGF-β signalling (Tgfb1; Tgfb3). We show a direct connection between androgen and mechanosensing within the ovary, with androgen upregulating the mechanosensitive Hippo pathway (Yap1; Lats1; Lats2; Stk3; Stk4; Frmd6) and downstream targets (Ctgf; Axl; Cyr61). Our results highlight hyperandrogenism as a probable driver of the fibrosis in the polycystic ovary, and emphasise the importance of ECM regulation in follicle development and fertility.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-32927-6.
Keywords: Ovary, ECM, Androgen, PCOS, Fibrosis
Subject terms: Reproductive biology, Reproductive disorders, Endocrine reproductive disorders, Infertility
Introduction
The extracellular matrix (ECM) plays a fundamental role in tissue structure and function, regulating processes including cellular differentiation, migration, proliferation and survival1–5. The ECM itself consists of structural proteins and polysaccharides (e.g. collagens, laminins, hyaluronan)6, as well as matrix structural modifiers (e.g. lysyl oxidase, LOX)7. ECM function is impacted by the expression of molecules that control the bidirectional cellular response, including cell-ECM receptors (e.g. integrins), components of signalling pathways that mediate functions such as adhesion, mechanosensing and cytoskeletal components. The unique combination of ECM components and cellular responses defines the microenvironment, structure and function within each tissue.
Specifically within the ovary, the ECM microenvironment plays a key role in regulating the development of follicles and the oocytes within8. The matrix and components that modify structure, have been shown to participate in a number of key processes, including antrum formation and ovulation, as well as directly structuring the follicle via basal lamina formation9–11. The ovarian ECM shows a unique and complex spatiotemporal structure, with intricate and extensive remodelling across the reproductive cycle. In terms of structure, ovarian matrix components have been characterised across a number of different species including cow12,13 human14–16, mouse17 and sheep18,19. All species demonstrate a controlled dynamic range of expression across all follicular stages. Temporal and spatial ECM regulation is essential in promoting healthy follicle development20,21.
Polycystic Ovary Syndrome (PCOS) is the most common hormonal disorder in women of reproductive age, characterised by the presence of clinical features including oligo/anovulation, hyperandrogenism, associated with an ovarian morphology typified by an excess of follicles and increased stromal tissue. Specifically, histological studies suggest distinct alterations in the matrix and structure of the ovaries of patients with PCOS, highlighting increases in connective tissue, subcortical and cortical stroma and an overall increased stromal volume22,23. Furthermore there are alterations in gene expression, in the ovaries of women with PCOS, in a number of gene pathways related to ECM components involved in the formation and remodelling of the ECM microenvironment24. Increased stromal hyperplasia and collagenous thickening of cortical stroma, may imply altered pathways associated with ECM formation and regulation. Moreover, fibrosis has the potential to alter the mechanics of the tissue environment, having an impact on follicle development. Such an impact is plausible given evidence that follicles alter their behaviour dependent on the stiffness of their environment25–27, with in vitro biomaterial-based cultures indicating matrix stiffness can impact follicle growth, development, oocyte competency, antral cavity formation and relative hormone production levels26,28.
Hyperandrogenism is one of the key clinical features of PCOS and understanding the role that androgens may play, in matrix expression within the ovary, is of key importance. An indication of androgen related regulation of the matrix layout and expression, arises from the study of female to male sex transition patients, who have undergone androgen supplementation during treatment. The ovaries demonstrate similar histological features associated with ovaries from patients with PCOS, with increased hyperplastic collagen and stromal hyperplasia29. Equally, free testosterone and (Dehydroepiandrosterone sulfate) DHEAS levels are correlated to ovarian stromal volume30. Elucidating the changes in ECM-related components upon androgen exposure, would help in the understanding of the pathophysiology of the disorder.
The mechanical properties of tissue microenvironments can impact cell and tissue function31. Matrix-mechanical effects can alter functions across a number of diverse pathways32. Such mechanosensing is mediated by receptors including integrins and Piezo1, as well as signalling molecules including the transcription factor YAP-1 and the associated Hippo pathway. Moreover, follicle growth and survival is associated with signalling through the mechanosensitive Hippo pathway33–36. These results are clearly significant for understanding healthy follicle development, but are also potentially relevant to PCOS, given the likely matrix stiffening that accompanies PCOS-induced fibrosis. In other fibrotic conditions (e.g. in the lung and the heart), it has been proposed that matrix stiffening and the associated cell-mechanosensing response act to reinforce and amplify the fibrotic disease phenotype31,32. This mechanism could also play a role in PCOS, but since hyperandrogenism is such a central feature of the disease, it will be critical to understand the interplay between androgen signalling and mechanosensing, and how these factors work together to control follicle development.
Here we investigate the effect of direct androgen regulation on ECM and mechanosensing pathways in the ovary, using a mouse in vitro model. Specifically, we demonstrate how androgen impacts the regulation of several extracellular matrix components, pathways associated with matrix deposition and the control of components linked with structural features and mechanotransduction. These results provide a fundamental framework to understand the effects of these changes on extracellular matrix and matrix-associated component expression properties within the mouse ovary. Aberrant regulation of ovarian ECM components provides further evidence for the change in the follicular and tissue phenotype observed in women with PCOS.
Results
Selection of target genes and the presence and absence of their expression in the mouse ovary and follicles of different developmental stages
To understand the role that androgens may have on the expression of matrix, matrix-associated genes, and mechanosensing, a selection panel of targets for investigation were selected. Since our aim is to determine how exposure to androgens impacts matrix- and mechanobiology, genes were selected to this end. This was done initially by using RNA-Seq analysis of granulosa-lutein cells (GLCs) collected from patients with/without PCOS, undergoing IVF37,38. Due to hyperandrogenism being a key feature of the disorder, many of these genes are likely to be androgen regulated. From these, we selected a subset of genes that are relevant to the extra-cellular matrix, the cellular cytoskeleton, cell - ECM adhesion, or mechanosensing, based on Reactome pathway and gene ontology analysis (Supplemental Fig. 1). To this, we added a further selection of genes that are not specifically identified from the data as being modified in GLCs of patients with PCOS, but whose importance in matrix biology, or mechanosensing is known: Fibronectin (Fn1), Smooth Muscle Actin (Acta2), Connective Tissue Growth Factor (Ctgf) and Elastin (Eln). Figure 1A shows the selected genes with a schematic illustration of their localisation. Known interactions among these genes were determined using the Protein Interaction Database, showing that most of the genes form a large, connected network (Supplemental Fig. 2).
Fig. 1.
Representation of genes highlighted for further analysis. Representation of the genes selected for analysis, their location and proposed functions.
To elucidate whether these selected genes are present in the mouse ovary, a presence and absence RT-PCR screen was performed for different compartments within the ovary. Looking at follicles, we analysed varying sizes and developmental stages (Fig. 2A). The small-follicle group was defined to range from 86 to 117 μm; medium from 113 to 142 μm and the large-follicle group from 152 to 315 μm (Fig. 2B). Additionally, isolated oocytes and granulosa cells were included, as well as ovarian fragments for an overall picture inclusive of stromal tissue.
Fig. 2.
Presence or absence of matrix associated components within the mouse ovary. (A) Image representation of samples used for presence and absence screen (B) Pooled samples of follicles of various sizes used as small medium and large follicle samples. Box and whisker plots of follicle size; each blue circle represents one follicle measured through ImageJ. Boxes represent the 25th and 75th percentile, the line highlights the median point. Whiskers represent the range. (C) RT-PCR screen of mouse samples tissue highlighting the presence or absence of gene transcripts for matrix components highlighted in figure 1. Small medium and large follicles, ovary fragments, granulosa cells and oocytes were analysed. Equal quantities of input cDNA were loaded with each sample. Negative (–ve) sample contained no cDNA. Gel images were cropped and arranged for clarity. Original gel images are presented in Supplemental Figure 8.
The results show that mouse follicular tissue and cells express the matrix components Fn1, Fbn1, Itga9, Cav1, Lama1, Col4a1, Vcl, Eln, Acta2, Lama3, Palld and Fbln7 (Fig. 2C). Expression is ubiquitous across all sample types across each gene studied, with a few exceptions, results show little to no Cav1 expression in small follicles. Within oocytes, nine out of the twelve components are expressed (Fn1, Fbn1, Itga9, Col4a1, Vcl, Eln, Acta2, Lama3, Fbln7 and Palld), but expression of certain matrix components was undetectable (Cav1, Lama1 and Fbln7) (Fig. 2C). In terms of matrix-modifier genes, again their expression is found within almost all samples and genes analysed. Expression is present for Hpse, Plod2, Lox, Mmp19, Has2 and Ssh1 (Fig. 2C). Lastly, the two genes Ctgf and Rhou, associated with cell signalling and mechanotransduction, are shown to be expressed within all cell and tissue types within the ovary (Fig. 2C). Overall, these results validate our target gene selection and confirm that there is active gene expression, within mouse ovaries, of not only structural matrix components but also matrix modifiers and signalling molecules associated with cell adhesion and mechanotransduction.
Localisation of target proteins within mouse ovarian tissue
We demonstrate a clear expression pattern across several different ECM and ECM-associated components (ACTA2, COL4, Laminin, FN1, CTGF, VCL and LOX) (Fig. 3 and 4), in line with other published data17,39–41. The histological data presented here indicates a clear structural feature within the ovary. Three of the proteins (ACTA2, COL4 and Laminin) form a ring surrounding each follicle (Fig. 3, ACTA2, COL4, Laminin). Expression is localised to a distinct ring of the follicular basal lamina (Laminin and parts of collagen IV) or within the stromal areas in between follicles.
Fig. 3.
Localisation of matrix components in D24 mouse ovarian tissue. Mouse ovarian tissue was labelled with various matrix components (ACTA2, COL4, FN1, Laminin) and counterstained with DAPI (blue). Images represent individual channels and then merged. Dotted line highlights a whole growing follicle. Oo, Oocyte; Gc, Granulosa Cell; Blue triangle, Antral Cavity formation; Str, Stroma.
Fig. 4.
Localisation of matrix modifiers / mechanosensitive component expression in D24 mouse ovarian tissue. Mouse ovarian tissue was labelled with various matrix components (CTGF, LOX, VCL) and counterstained with DAPI (blue). Images represent individual channels and then merged. Dotted line highlights a whole growing follicle. Oo, Oocyte; Gc, Granulosa Cell; Blue triangle, Antral Cavity formation; Str, Stroma.
Considering the localisation of LOX, which crosslinks the ECM, we note it is predominantly expressed within the granulosa cell compartment of the follicle, suggesting a possible role for collagen/elastin stiffening within this region (Fig. 4). Lastly, the expression of CTGF and VCL is shown clearly within the mouse ovary (Fig. 4). Both Ctgf (Connective Tissue Growth Factor) and Vcl (Vinculin) are associated with mechanotransduction within cells and tissues, with vinculin playing a fundamental role in cell adhesion. We show that CTGF is found across the entire ovary, with greater expression found within the granulosa cell layer. Vinculin is found universally across the entire tissue (Fig. 4). Global expression suggests that mechanical signalling can occur throughout the tissue.
Androgen regulated gene expression changes in ECM and ECM-Associated genes within mouse follicles
To understand the effect of androgens on ECM and ECM-Associated components within follicles we performed an isolated follicle culture in the presence of the androgen DHT (10nM). Follicles were isolated from the rest of the ovary and cultured in the presence or absence of DHT for either a 24 or 72-hour timepoint. Follicles in the presence of DHT demonstrate significant increases in growth compared to controls at each timepoint (Fig. 5B, 24 H p ≤ 0.0001 and 48 H p ≤ 0.0001, 72 H p ≤ 0.01).
Fig. 5.
Follicle growth in response to DHT (10nM) of follicles taken from D16/17 mice over a 24/72 hour culture period. Follicles were isolated, using insulin needles, from D16/17 mouse ovaries, before being cultured in 96 well plates in culture medium supplemented with/without DHT. At 24 h half the samples were removed for analysis, the remaining samples continued culture for a total of 72 h. (A) Representative images of follicles grown with or without DHT over a 72-hour period. After 24 h half of the samples were collected for analysis at this timepoint. (B) Percentage change in area of follicles treated with/without DHT (10nM) over 72 h of culture. The area of each follicle was measured using ImageJ. Follicles that were damaged / showing signs of apoptosis were excluded from analysis. n = (24 h) 77, (48 h) 38 and (72 h) 38. Statistical analysis was performed using a Mann-Whitney test where **P < 0.01, ****P < 00001.
We demonstrate that over both timepoints of culture, androgens significantly alter gene expression of several components of the matrix (Fig. 6). The changes in gene expression were also shown to not be an effect of the additional increase in size, due to DHT exposure during culture, and therefore a response to androgens as demonstrated by analysing gene expression from size matched follicles (Supplemental Fig. 3).
Fig. 6.
Log2 fold change in matrix-associated component gene expression of 24- and 72-hour cultured follicles with/without DHT (10nM). Log2 fold change in gene expression of components and associated components of mouse ovarian follicles treated with/without DHT (10nM). Light blue columns denote structural components of the ECM, purple columns denote modifiers of the ECM and green represents signalling pathway components. Normality of the data was calculated using the D’Agostino Pearson test and a Mann-Whitney test was performed. Individual graphs highlighted in Supplemental Figure 4 and 5. Each dot represents a sample where n of samples was between 4 and 8. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 00001. Columns represent mean and SEM.
In the first instance, after 24 h of culture, eleven of the thirteen matrix components are significantly downregulated (Col4a1, Lama1, Lama3, Acta2, Itga9, Fbn1, Fn1, Col11a1, Eln, Cav1 and Fbln7, p ≤ 0.05) with varying degrees of reduction. The results demonstrate downregulation in nearly all structural components at 24 h. At 72 h of culture seven of the thirteen genes see significant changes in expression (Lama3, Acta2, Vcl, Fbn1, Fn1, Col11a1 and Eln p ≤ 0.05), with Eln now upregulated, while Lama3 undergoes a major downregulation. We note that several genes show consistent downregulation at both timepoints, Lama3, Fbn1, Fn1 and Col11a1 (Fig. 6, p ≤ 0.05).
In contrast to these significant changes in expression of matrix structural components, there is little or no androgen-induced change in components that are linked with ECM/matrix modification (Fig. 6).
Androgen induces a reduction in expression genes associated with the basement membrane in follicles
Considering further the changes in expression of structural components: several genes whose expression level changes upon androgen exposure are associated with the follicular basement membrane. This occurs across both timepoints of culture. At 24 h there is a reduction in Col4a1 and both laminins Lama3 and Lama1 (Fig. 6, p ≤ 0.05). Further to this at 72 h there is an over two-fold reduction in Lama3 (Fig. 6, p ≤ 0.01). Moreover Fbn1 (Fibrillin 1), downregulated across both timepoints (Fig. 6, p ≤ 0.05), is known to colocalise with perlecan at the site of basement membranes playing a role in its overall structure42.
Androgen regulation of gene expression indicates increases in genes associated with fibrosis within mouse follicles
We demonstrate an increase in pro-fibrotic gene expression, mediated by androgen treatment within follicles. This includes clear upregulation of a number of genes that contribute to tissue fibrosis, Eln, Rhou, Plod2 and Hpse; including an over two-fold increase in Acta2 and over a six-fold increase in Ctgf at 72 h of culture (Fig. 6, p ≤ 0.05). Moreover, both signalling components Ctgf and Rhou demonstrated significant increases in expression after prolonged culture (Fig. 6, p ≤ 0.05). Additionally, both Plod2 and Hpse genes increase in expression at 72 h (Fig. 6, p ≤ 0.05), and these genes are both are associated the pathogenesis of fibrosis43,44. Specifically, as they are matrix modifiers, they likely play a role in fibrotic remodelling of matrix.
Androgen regulation of gene expression in genes associated with mechanotransduction within mouse follicles
There are several alterations in genes associated with cell adhesion and mechanotransduction pathways (Fig. 6). Both Vcl (Vinculin) and Itga9 (Integrin alpha-9) were differentially expressed in in response to androgen treatment (increase of Vcl at 72 h; decrease of Itga9 at 24 h, p ≤ 0.05). Vinculin is an adhesion protein, associated with focal adhesions, that helps mediate force transmission processes45. Demonstrated within the histological images (Fig. 4), vinculin expression is ubiquitous across the ovary, suggesting an important role in ovarian functioning. Integrins are another component associated with focal adhesion structure and play a role in mechanotransduction within cells and tissues46. Integrin alpha-9 is one of many integrin isoforms and data are limited regarding its expression within the ovary. Gene expression of Itga9 shown here is novel in terms of expression within the mouse ovary.
Genes associated with actin/actin cytoskeleton within mouse follicles are regulated by androgens
Another subset of genes that are differentially regulated by androgen treatment are those associated with actin and the actin cytoskeleton (Fig. 6). Ssh1 (Slingshot Protein Phosphatase 1) is shown to decrease in expression in response to androgens at 24 h of exposure (Fig. 6, p ≤ 0.05). Ssh1 is known to regulate actin filament dynamics by dephosphorylating and activating the actin depolymerising factor cofilin, subsequently binding actin and promoting its disassembly/depolymerisation47,48.
Acta2, another actin component, shows an increased expression in response to androgens at 72 h (Fig. 6, p ≤ 0.001). We note that Acta2, while we have classified it as a cytoskeletal component, can exist in the extracellular space and thus effectively contribute to the mechanical properties of ECM. Here, Acta2 (Fig. 3) forms a ring around the follicle within the outer basement membrane/stromal region. While androgens cause downregulation at 24 h (Fig. 6, p ≤ 0.05), the effect is more than reversed at 72 h with an almost 3-fold increase in expression compared to the control (Fig. 6, p ≤ 0.001).
Increased expression of Hippo and Tgf-β pathways signalling components after treatment with androgens within follicles
Due to the changes observed across a number of ECM and matrix-associated genes, signalling pathways associated with fibrosis and mechanotransduction were analysed to understand their role in mediating this response. These pathways included the Hippo pathway and Tgf-β pathway.
We show here that androgen treated follicles demonstrated clear increased expression of several Hippo pathway genes, Lats1, Lats2, Stk3, Stk4, Yap1 and Frmd6 (Fig. 7A, p ≤ 0.05). It is clear that androgens play a role in the regulation of Hippo pathway components, which could alter Hippo pathway and consequently YAP activity in the follicle.
Fig. 7.
Log2 fold change in Hippo/Tgf-β pathway component gene expression of 72-hour tube cultured follicles with/without DHT (10nM). (A) Log2 fold change in expression of components of the Hippo pathway. (B) Fold change in gene expression of downstream targets of the Hippo pathway. (C) Fold change in expression of components of the Tgf-β pathway. Normality of the data was checked using the D’Agostino Pearson test and an unpaired t-test or Mann-Whitney test was performed. Individual graphs highlighted in Supplemental Fig. 6. Each dot represents a sample where n of samples was between 6 and 9. *P < 0.05, **P < 0.01, ****P < 0.0001 columns represent mean and SEM.
To understand whether the pathway is signalling, beyond an increase in its associated components, downstream targets of Hippo signalling were assessed. These results indicate upregulation, of Ctgf, Axl and Cyr61, key downstream targets of the hippo pathway (Fig. 7B, p ≤ 0.05). Upregulation of downstream targets suggest that YAP signalling is active within the nucleus, which would drive changes in the follicle.
Androgen regulation increases certain TGF-β signalling pathway components within mouse follicles
Another well characterised pathway associated with follicle development, fibrosis and matrix remodelling / deposition is that of the Tgf-β pathway. Androgen regulation of Tgf-β components shown demonstrated significant increases in Tgfb1 (near two-fold, p ≤ 0.01) and Tgfb3 (Over two-fold, p ≤ 0.01) (Fig. 7C).
Discussion
Target gene identification and characterisation
A panel of gene targets were identified which are related to the ECM structure and function. The selected targets were characterised across various cell types and staged follicles. Their expression is expected considering their fundamental role in follicle development49. The expression of oocyte-derived matrix components, has been previously demonstrated50, with the present results adding to data on oocyte expressed factors. Of the components analysed for protein expression there is a clear expression to localised regions. Spatiotemporal variation of ECM protein expression is a feature previously described by Berkholtz et al.17. , who demonstrated a similar effect: localisation of collagen (I and IV), laminin and fibronectin to growing mouse follicles. Structurally, three of the key load-bearing proteins (ACTA2, COL4 and Laminin) are spatially located as a ring (either as a basal lamina or surrounding the follicle), which may have the potential to alter follicle expansion. Controlled expression of these matrix proteins is key in follicle development and aberrant expression has the potential to impact growth and competency of the developing follicle.
Androgen exposure altering gene expression
Firstly, it is clear that androgens promote enhanced follicle growth when cultured with DHT. This phenomena itself has been observed across species including cow51, mouse52 and rhesus monkeys53. Moreover, women with PCOS, for whom hyperandrogenism is a characteristic of the disorder, exhibit a higher proportion of preantral and growing primordial follicles54.
Our data emphasise that several genes are differentially regulated with androgen exposure, with clear upregulation and downregulation, across either timepoints. The impact of these changes is discussed herein.
Various research groups have shown changes in ECM structural and non-structural components within the ovary of women with PCOS55. Changes in structural component expression may permit follicle expansion, a hypothesis put forward by Rodgers et al.10. In the present study, downregulation of numerous structural components does not persist at 72 h. This potentially indicates a feedback mechanism to androgen exposure over time, or that factors associated with tissue remodelling require longer time frames to promote changes.
Our results highlight little to no changes in elements associated with the modification of the ECM. This result is surprising as research by various groups has highlighted that in both follicular fluid and cultured GLCs there are higher levels of MMP-9 and MMP-2, suggesting that greater MMP activity and hence presumably matrix remodelling56 is a feature of PCOS. It may be that such remodelling involves genes not investigated here.
Basal lamina reduction
We demonstrate an androgen dependent reduction in components associated with the basement membrane/basal lamina. The unique structure and phenotype of the basal lamina is well known to play a role in follicle function and can direct follicle and oocyte competency57. Components of the basal lamina have also been shown to be tightly regulated throughout follicle development, indicating their specific role within follicle growth and survival10. Structural characteristics of the basal lamina also permit growth and development. The basal lamina expands in area during follicle growth, and this is accompanied by changes in expression of basal lamina components according to developmental stage13,58. The differences in bonds between laminin and collagen fibers has led to the hypothesis that the switch in composition permits the expansion of the follicle during development10. Here, we demonstrate that decreases in laminin components (alpha 1 and 3) occur after androgen treatment; this could have the potential to lead to disruption in the function of the basal lamina and its growth.
Fibrosis
We demonstrate here androgen dependent changes in gene expression, of a number of fibrosis associated genes. Fibrosis itself is characterised by excessive deposition of matrix proteins, which can ultimately lead to tissue stiffening and impact tissue function. Structural components that contribute to fibrosis include Eln and Acta2 (Elastin and alpha smooth muscle actin); both of these showed increased expression on androgen stimulation, in the present study. Increased expression of elastin is known to be a factor in fibrosis of the liver59, renal tissue60 and lung61. Knockdown of Acta2 is shown to reduce fibrosis within the liver, including a reduction in collagen 1 expression62. Hence the here observed changes in expression of these components could demonstrate alterations towards a more fibrotic state of the ovary.
Aside from structural elements, we show changes in several factors associated with tissue remodelling. Ctgf is a member of the CCN family of proteins and its over-expression is implicated in diseases involving fibrosis63. Evidence highlights its role in the increased deposition of collagen64 as well as fibronectin and α-SMA (Alpha smooth muscle actin (ACTA2))65. In rats, DHEA (dehydroepiandrosterone) treatment induces a significant increase in Ctgf expression in ovarian tissue, mirroring our findings66. Changes in Rhou are less well characterised in terms of its role in fibrosis, however mice under bleomycin treatment to induce lung fibrosis, exhibited a 3.5 fold upregulation67. Moreover, the role of Rho kinases in profibrotic pathways is becoming more evident due to their role in reorganisation and control of the actin cytoskeleton68. We further note that Ctgf can stimulate the upregulation of Acta269, hence the here observed changes in Ctgf and Acta2 expression may be linked.
We further demonstrate upregulation of two enzymes linked with fibrotic progression. Hpse, an enzyme that cleaves heparan sulfate side chains, has been shown to regulate renal fibrosis in mice, while in contrast Hpse inhibition (with Roneparstat) reduced enzyme levels and reducing fibrosis70. Additionally, Plod2, promotes collagen assembly, potentially relevant given that increased collagen deposition is a hallmark of fibrosis43.
Taken together, our results thus support the hypothesis that androgen treatment can be a driver of a fibrotic phenotype within ovarian tissue. Considering PCOS, hyperandrogenism and increased fibrosis are both markers of this condition. Hence our results suggest the idea that the fibrotic phenotype, exhibited by the ovary in PCOS, is at least partially caused by excess levels of androgens. Fibrosis within the ovary has the potential to alter the mechanics of the tissue environment within the ovary itself, potentially having an impact on follicle development, of which anovulation is another hallmark of the disorder.
Alterations in pathways associated with mechanotransduction and fibrosis
To gain a better understanding of dysregulated pathways in the ovary associated with androgen exposure and tissue fibrosis/mechanotransduction, we investigated elements of the Hippo Pathway as well as the TGF-β pathway.
The Hippo signalling pathway is highly conserved and acts to limit organ size, preventing overgrowth as well as mediating mechanical signals into cellular responses71. A number of studies show the importance of the pathway in normal follicle function, e.g., active Yap1 localisation is predominantly located within proliferative granulosa cells, demonstrating its function in the mechanics of follicle growth. In the present study, our results indicate that androgen increases expression of several components of the Hippo pathway. Assessing the activity of the pathway we assessed a number of its downstream targets.
As previously mentioned, we also see increases in Ctgf, a downstream target of the Hippo pathway. Another Hippo pathway downstream target, Cyr61, is also shown to increase in expression to androgen treatment. Cyr61 is another secreted matrix associated signalling molecule as part of the CCN gene family72. In contrast to Ctgf’s profibrotic role, data in cultured human skin fibroblasts indicate a protective / antifibrotic role that CYR61 expression has in reducing the expression of type I procollagen and increases in the matrix enzyme MMP-1, initiating collagen fiber degradation. This anti-fibrotic effect is also shown in fibroblasts from Systemic sclerosis (SSc) patients. Overexpression of CYR61 in SSc fibroblasts results in the reduction of profibrotic genes, such as COL1A1 and ACTA273. Moreover, it increases the expression of MMPs 1 and 3, associated with collagen degradation. The protective role it may play within the androgen treated follicle is less likely to be active as additional results shown demonstrate that Acta2 expression after 72 h is significantly upregulated ~ 3-fold (Fig. 6), in contrast to the data in SSc samples. However, it may contribute to the reduction in Acta2 expression observed at 24 h, prior to perhaps the effect from ever increasing levels in profibrotic genes such as Ctgf throughout the rest of culture. These effects observed may be an interplay between a number of these factors.
The last downstream target of the Hippo pathway we studied highlights increases in Axl. The unique transmembrane receptor (part of the TAM family of tyrosine kinase receptors) has been shown across a number of organs to alter matrix synthesis and the pathogenesis of fibrosis74. Axl has been implicated in fibrosis within various organs including renal fibrosis75 as well as in the liver76. Moreover, inhibitors to the receptor has been shown to significantly inhibit the fibrotic properties of IPF (Idiopathic Pulmonary Fibrosis) fibroblasts77.
Overall, these results suggest increased YAP nuclear localisation and signalling activity, within the ovary after treatment with androgens. This has implications in the matrix environment within the ovaries of PCOS women, particularly due to the fibrotic nature of the pathway and its downstream targets. Moreover, if increased activity is linked with increased granulosa cell proliferation, then androgen regulation of YAP activity potentially could explain increased proportion of early follicular growth observed in women with PCOS. Ultimately, this disruption may then lead to the aberrant follicle development observed within the disorder.
Lastly, the Tgf-β pathways are known mediators of fibrosis. Our results indicate increases in both Tgfb1 and Tgfb3. Tgfb1 is a well characterised gene linked with various fibrotic pathologies78. Its role in the control of matrix expression is shown through its ability to induce the expression of both collagens and fibronectin expression79,80. The role of Tgfb3 in the progression of fibrotic matrix deposition is less clear. A number of studies indicate its function in stimulating a non-fibrotic matrix within human corneal fibroblasts81. Additionally, Tgfb3 was associated with the production of normal matrix when overexpressed within rat lung tissue, highlighting a healthy wound response, in comparison to the fibrotic deposition associated with Tgfb1 overexpression82. In contrast, within in vitro studies of liver tissue, Tgfb3 is indicated to promote fibrosis83. It is likely however, that there are different responses within various tissues. Despite this, what is clear is the role both components have on matrix deposition and remodelling as a process.
Conclusion
The results shown here demonstrate that androgen signalling has a profound impact on gene expression within ovarian follicles. Collectively these genes play a role in several processes associated with fibrosis as well as mechanotransduction, the actin cytoskeleton and components of the basal lamina. Taken together these results indicate that androgen signalling can contribute to matrix remodelling and a fibrotic phenotype within follicles and the ovarian environment. More broadly, the altered expression especially of matrix structural proteins and matrix modifiers will impact the mechanical and biochemical microenvironment of the ovary. Aberrant control of the environment has implications in terms of follicle development as well as the overall mechanical properties of the ovary itself, particularly in reference to fibrotic disorders. Furthermore, these results work towards defining the unique ovarian phenotype seen in women with PCOS, providing a potential explanation for the disordered follicle development associated with the disorder.
Methods and materials
Mouse ovary collection
All mice were housed in accordance with the Animals (Scientific Procedures) Act of 1986 and associated Codes of Practice. All procedures were performed in accordance with the establishment licence number (X32FDCFC1). Animals for this project were sourced from either Charles River (Harlow, UK) or Envigo (Huntingdon, UK). Days 16 and 22–29 post-partum, C57BL/6 mice, were sacrificed by cervical dislocation. Samples were collected in preheated (37 °C) Leibovitz’s LM15 medium (#11415-049; Gibco), supplemented with 1% (w/v) bovine serum albumin (BSA, #A7030, Sigma-Aldrich, Gillingham, UK). Under a dissection microscope, with a heated stage (37 °C), the samples were isolated under L-15 medium and removed of extraneous tissue (fat, oviduct, bursa membrane), using insulin needles (#U-100, Terumo). Samples were then washed with phosphate-buffered saline (PBS) and fixed in 10% neutral buffered formalin solution (#HT5012, Sigma-Aldrich, UK) for immunohistochemistry, or processed for follicle culture described below. This study is reported in accordance with ARRIVE guidelines.
Follicle treatment cultures
For follicle culture experiments, preantral follicles (with 2–3 layers of granulosa cells / ~ 70–125 μm) were isolated mechanically, using insulin needles, from D15-16 mouse ovaries in L-15 medium supplemented with 1% (w/v) BSA. Follicles were assessed for quality, with only samples containing an intact basal lamina and centrally located oocyte were chosen. Isolated preantral follicles were collected from D16/17 mice and individually transferred to single wells of a 96-well plate (#167008, Thermo Scientific). Each well contained 100 µl of MEM-α medium supplemented with 0.1% (w/v) BSA, 100 µg/mL streptomycin sulphate (#S6501, Sigma-Aldrich), 75 µg/mL penicillin (# PENK, Sigma-Aldrich), 5 µg/mL insulin, 5 µg/mL transferrin and 5 ng/mL sodium selenite (ITS, #I1884, Sigma-Aldrich). Culture medium was supplemented with DHT (10nM) or an EtOH vehicle control. The cultures were maintained in humid conditions inside an incubator in 5% CO2 at 37 °C for either 24–72 h. These samples were then imaged at the beginning of culture and every consecutive 24 h using a Nikon digital camera DXM 1200 attached to a Nikon Eclipse TE300 light microscope. The samples were assessed for morphology and were excluded from analysis according to the set criteria: (i) the oocyte had extruded from the follicle, (ii) The oocyte was displaying signs of atresia (darkness), not circular / misshapen (iii) GCs had darkened (become atretic) (iv) The oocyte was not centrally located. Follicle area was measured using Fiji software. Samples were blinded to treatment to ensure no bias. At the end of culture, (24, 72 h) samples were then processed for RNA extraction by snap freezing in dry ice in 10 µl of PBS and storing at -80 °C.
Mouse tube follicle culture
To provide larger amounts of template RNA required for experiments looking at signalling pathways, isolated preantral follicles were collected from D16/17 mice and individually transferred to single 1.5 mL Eppendorf tubes. Each Eppendorf contained 100 µl of MEM-α medium supplemented with 0.1% (w/v) BSA, 100 µg/mL streptomycin sulphate (#S6501, Sigma-Aldrich), 75 µg/mL penicillin (# PENK, Sigma-Aldrich), 5 µg/mL insulin, 5 µg/mL transferrin and 5 ng/mL sodium selenite (ITS, #I1884, Sigma-Aldrich). Culture medium was supplemented with either DHT (10nM) or an EtOH vehicle control). 10 µl of silicone oil (#378356, Sigma-Aldrich) was added atop the medium within each tube to prevent evaporation. The cultures were maintained in humid conditions inside an incubator in 5% CO2 at 37 °C for 72 h. Lids were left open on the Eppendorfs to allow for adequate perfusion of O2 and CO2. At the end of the culture the silicone oil was removed, with the lids sealed and then snap frozen in dry ice in preparation for RNA extraction.
Granulosa cell isolation
Granulosa cells (GCs) were isolated from large preantral follicles in LM15 medium supplemented with 1% (w/v) BSA. These follicles were manually punctured using insulin needles and gently pressed, causing the release of GCs. These were then immediately snap frozen in dry ice for RNA extraction before being stored at -80 °C.
Oocyte isolation
Oocytes were collected from D16 to D22 mouse ovaries during the follicle isolation procedure all in LM15 medium supplemented with 1% (w/v) BSA. Oocytes were then removed of extraneous granulosa cells by pipetting up and down. Samples were imaged immediately then snap frozen within PBS in dry ice for RNA extraction before being stored at -80 °C.
Sized follicle samples
Follicles that were used in experiments focusing on follicle sizing (Supplemental Fig. 3) were isolated from D16 to D22 mice in LM15 medium supplemented with 1% (w/v) BSA using insulin needles. Using the dissection microscope samples were approximately grouped according to size by eye. Follicles grouped together as one sample were then photographed using a Nikon Eclipse TE300 light microscope. After being photographed, follicles were snap frozen within PBS, in dry ice for RNA extraction before being stored at -80 °C. The photographs were measured for size using Fiji84.
RNA extraction procedure
Total RNA was extracted from follicles, granulosa cells and oocytes using the RNeasyMicro Kit (#74004, Qiagen, UK), performed according to the manufacturer’s instructions. Samples that had been snap frozen and stored at -80 °C were thawed gently over ice. 4 µg/µl of Carrier RNA was added to each sample. An on-column DNase digestion was performed using a DNase digestion mix, in order to remove genomic DNA (#79254, Qiagen). Elution of the RNA was performed by adding 14 µl of RNase-free water directly to the column. RNA was then either processed immediately for cDNA synthesis or stored at -80 °C.
Measurement of RNA integrity and concentration
The quality and quantity of RNA extracted was calculated using the Agilent Technologies TapeStation, under manufacturers guidelines (Agilent TapeStation 2200, Agilent Technologies, US). Briefly, samples were combined with high sensitivity sample buffer (#5067–5580, Agilent Technologies) using the high sensitivity RNA ScreenTape (5067–5579, Agilent Technologies). Sample analysis of concentration and RNA integrity (determined RIN values) was produced using the Agilent 2200 TapeStation software (Agilent Technologies).
cDNA synthesis
Extracted RNA was converted to cDNA (Complementary DNA) using the SuperScript IV first strand synthesis kit (#18091050, Invitrogen) following the manufacturers guidelines. Briefly per reaction, the RNA template was combined with random hexamer primers, a dNTP mix and annealed to the template RNA. The reaction mixture was heated to 65 °C for 5 min and cooled on ice for 1 min. Annealed RNA was then added to the reverse transcriptase mix consisting of SSIV Buffer, DTT, RNaseOUT™ Recombinant RNase Inhibitor and SuperScript® IV Reverse Transcriptase. The combined reaction mix was incubated at 23 °C for 10 min, 55 °C for 10 min and 80 °C for 10 min using the TC3000 PCR machine (Techne, UK).
Real-time quantitative polymerase chain reaction (RT-qPCR)
RT-qPCR was performed using a SYBR green detection system used to measure transcript concentrations. To quantify the gene expression the 2−ΔΔCT method was used. A reaction mixture was made consisting of nuclease free H2O, primers and Power SYBR™ Green PCR Master Mix (#4368577, Applied Biosystems). To each of the wells within a 384 well plate (#4309849, Applied Biosystems) the reaction mix was added to template cDNA or nuclease free H2O (negative control). Plates were then sealed using adhesive PCR plate seals (#4311971, Applied Biosystems) followed by centrifugation of the plate at 1500 rpm for 2 min. RT-qPCR was performed on an Applied Biosystems 7900HT Fast machine. Cycling parameters included a 10-minute polymerase activation step at 95 °C followed by 40 cycles of PCR (Denature at 95 °C for 15 s and an extension at 60 °C for 1 min). Each sample was then subjected to a melt curve analysis to confirm correct product specific amplification. The internal reference genes used were Gapdh (Primer Design) and Atp5b (Primer Design) and a geomean calculated. Expression levels were normalised to the geomean of the internal reference genes and calculated as fold change relative to experimental control using the 2−ΔΔCT method (Livak and Schmittgen85. ΔCt values were used for statistical calculation. To ensure correct primer amplicon sizes, PCR products were separated by gel electrophoresis. Primers were analysed for amplification efficiency using LinRegPCR software86,87. Efficiency of between 87 and 110% was considered acceptable.
Primer sequences.
| GeneSym | RefSeq | Forward Sequence | Reverse Sequence | Product Length (bp) | GeneID |
|---|---|---|---|---|---|
| Acta2 | NM_007392 | CATCTTTCATTGGGATGGAG | TTAGCATAGAGATCCTTCCTG | 96 | 11475 |
| Cav1 | NM_007616 | CTCAGTTCTCTTAAATCACAGC | CATACACTTGCTTCTCAGTC | 191 | 12389 |
| Col4a1 | NM_009931 | TTCTCTTCTGCAACATCAAC | GAATCTGAATGGTCTGACTG | 198 | 12826 |
| Col11a1 | NM_007729 | AGAGGCAAATATTGTGGATG | TACAGAATATCCTCGGAAGTG | 185 | 12814 |
| Ctgf | NM_010217 | GAGGAAAACATTAAGAAGGGC | AGAAAGCTCAAACTTGACAG | 74 | 14219 |
| Eln | NM_007925 | TTCTCCCATTTATCCAGGTG | GAAGATCACTTTCTCTTCCG | 146 | 13717 |
| Fbln7 | NM_024237 | ACACGGTTAACAAAATGACC | AGTACTTGCTTCCAAACTTC | 92 | 70370 |
| Fbn1 | NM_007993 | GTGAAGATATTGACGAGTGC | GACATTTGCAGAAGTAGCTG | 89 | 14118 |
| Fn1 | NM_010233 | CCTATAGGATTGGAGACACG | GTTGGTAAATAGCTGTTCGG | 167 | 14268 |
| Frmd6 | NM_028127 | CAAGATGAGGAAATCGAGATG | GTAGATACACATCTCTGGGC | 95 | 319710 |
| Has2 | NM_008216 | GATTATGTACAGGTGTGTGAC | CCTCTAAGACCTTCACCATC | 75 | 15117 |
| Hpse | NM_152803 | AGCCTTTACCTGATTACTGG | GTGACATTATGGAGGTTCAG | 186 | 15442 |
| Itga9 | NM_001113514 | AACATTACTCTCCAGGTCTAC | CTTTGTAGAGAGCAGTTACC | 157 | 104099 |
| Lama1 | NM_008480 | ATTTAGCCAATGGAAAGTGG | TTTTCTTACAAAGACACGGC | 176 | 16772 |
| Lama3 | NM_010680 | GGATACAGACAATAGCTACAC | TTTTCAATTTGTCTGGGACG | 97 | 16774 |
| Lats1 | NM_010690 | TGGATTTCAGTAACGAATGG | TGTATATCCTGTTCGCAGTAG | 166 | 16798 |
| Lats2 | NM_153382 | AAAAAGCTCTCAGGGAAATC | AATATGCATCTGGTCACATC | 130 | 50523 |
| Lox | NM_010728 | CACCGTATTAGAAAGAAGCC | GTCCTTCCTACTTAAGCTAATC | 93 | 16948 |
| Mmp19 | NM_001164197 | TGTTTAAGGGCTCAGGATAC | GTTCCTTGATTGGTTTAGGG | 80 | 58223 |
| Palld | NM_001081390 | CAAGCTCAGAAGAAAACAAC | TCGGCAGAGATATGAAGTAG | 137 | 72333 |
| Plod2 | NM_001142916 | AGCCCTTCAACTCTTTATTC | ATCACACTTTTCATCCTGAC | 180 | 26432 |
| Rhou | NM_133955 | TCAGCTACACCACTAACG | AAACTCATCCTGTCCTGC | 130 | 69581 |
| Ssh1 | NM_198109 | GTGACTTCTAAGGAAATCCG | AAAGATGGTCAAAGATGAGG | 138 | 231637 |
| Stk3 | NM_019635 | GGAAGAAAACTCGGATGAAG | AACATGGTGCTGTTATGTTC | 137 | 56274 |
| Stk4 | NM_021420 | GAAGGAACCATGAAAAGAAGAG | GAGAGCCAGATACATTCTTG | 123 | 58231 |
| Tead1 | NM_001166585 | AGTAGAAAAAGTAGAGACGGAG | TATATTCACACATTGGCGAG | 85 | 21676 |
| Vcl | NM_009502 | ACTGTAGAAAAGATGAGTGC | CTGGTTCAATTTGGAGTCTATG | 140 | 22330 |
| Wwc1 | NM_170779 | CGCTGAAGAAAATTGATGAG | GGTCTTGTTTCTCCTTTTCTC | 131 | 211652 |
| Wwtr1 | NM_001168281 | GGATACAGGTGAAAATTCCG | GATTACAGCCAGGTTAGAAAG | 194 | 97064 |
| Yap1 | NM_001171147 | CAATACGGAATATCAATCCCAG | GATCGGAACTATTGGTTGTC | 164 | 22601 |
| Axl | NM_001190974 | GTGAAGACCATGAAAATTGC | TCAAATTCCTTCATGCAGAC | 82 | 26362 |
| Cyr61 | NM_010516 | AGAGGCTTCCTGTCTTTG | GTTGTCATTGGTAACTCGTG | 148 | 16007 |
| Gli2 | NM_001081125 | AGACTATTACCACCAGATGAC | TGGACTAGAGAATCGTGATG | 141 | 14633 |
| Tgfb1 | NM_011577 | GGATACCAACTATTGCTTCAG | TGTCCAGGCTCCAAATATAG | 160 | 21803 |
| Tgfb2 | NM_009367 | GAGATTTGCAGGTATTGATGG | CAACAACATTAGCAGGAGATG | 114 | 21808 |
| Tgfb3 | NM_009368 | CTCAGTGGAGAAAAATGGAAC | GGTCGAAGTATCTGGAAGAG | 116 | 21809 |
Tissue fixation and processing
Whole ovaries were fixed in 10% neutral buffered formalin solution (#HT5012, Sigma-Aldrich, UK) for 3 h and then transferred to 70% ethanol. Ovaries were then processed for paraffin embedding under standard protocols. Tissue was processed through increased gradients of ethanol, 70% ethanol for 1 h, 90% ethanol for 1 h and 100% ethanol for 3 × 1 h, then placed in Histoclear (# HSM200, National Diagnostics) overnight. The following day samples were incubated for 1 h in fresh Histoclear. Samples were then transferred to clear moulds (#03015, Surgipath) and embedded in paraffin wax (#36107, VWR) for 2 h at 65 °C. Cassettes (#M480-2, Simport) were then placed over the top of the moulds and blocks were allowed to cool. The blocks (containing tissue) were then serially sectioned (5 μm) (Leica RM 2135 microtome) and mounted onto SuperFrost glass slides (#631 − 0108, VWR). Slides were left to dry overnight at 37 °C.
Immunofluorescence
Chosen sectioned tissue were dewaxed in Histoclear (2 × 5 min) and then placed through decreasing concentrations of ethanol (5 min each, 100% 95%, 70%), then placed in distilled H2O for 5 min. An antigen retrieval step was performed using a citrate buffer (pH 6.0). Samples were then washed in PBS (2 × 5 min). Dependent on the secondary antibody species it was raised in, the matching serum was used for blocking, normal goat serum (#120316, SAFC Biosciences) or nomal donkey serum (#D9663, Sigma-Aldrich). To prevent non-specific binding the samples were blocked by incubation with 5 or 10% (v/v) (NDS (10%), NGS (5%)) species specific serum supplemented with 4% (w/v) BSA (#A7030, Sigma-Aldrich) in PBS for 30 min. Slides were then incubated overnight at 4 °C with the primary antibody; brackets display (Manufacturer, Product Code; Concentration used, RRID of antibody obtained from https://www.antibodyregistry.org/). LOX (Abcam, #Ab174316; 1:200, AB_2630343), CTGF (Abcam, #Ab6992; 1:100, AB_305688), VCL (Abcam, #Ab129002; 1:50, AB_11144129), Collagen IV (Millipore, #AB756P; 1:100, AB_2276457), Laminin (Abcam, #Ab11575; 1:100, AB_298179), Fibronectin (Abcam, #Ab2413; 1:100, AB_2262874), ACTA2 (Sigma-Aldrich, #A2547; 1:100, AB_476701) or non-immune immunoglobulin (IgG) control isotype (Sigma-Aldrich, #I814), diluted in 1% or 5% (v/v) serum (1% if blocked with NDS / 5% if blocked with NGS) (demonstrated in Supplemental Fig. 7). After the overnight incubation, slides were washed using PBS for 3 × 10 min. Slides were then incubated with the resulting AlexFluor conjugated secondary antibody (AlexaFluor 488, Invitrogen #A-11008; AlexaFluor 555 Invitrogen #A31572) diluted in PBS (1:200) for 60 min at room temperature. Slides were then washed for 2 × 5 min in PBS before then being counterstained with 1 µg/ml 4’,6 M diamidinoM2Mphenylindole (DAPI, #D8417, Sigma-Aldrich) for 3 min. Sections were then mounted with coverslips using Prolong Gold Antifade reagent containing DAPI (#P36931, Invitrogen) and left to cure for 24 h at room temperature in the dark. Coverslips were then sealed with nail varnish and stored at 4 °C in the dark. Fluorescently stained slides were imaged using a confocal laser-scanning microscope Leica inverted SP5 confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany).
Statistical analysis
All statistical analyses were performed using GraphPad Prism (V 8.0) (Graphpad Inc, San Diego, CA). Data were assessed for normal distribution using a D’Agostino & Pearson normality test. Data not normally distributed were analysed by non-parametric Kruskal-Wallis or Mann-Whitney test. Normally distributed data were analysed by an unpaired t test. Statistical tests are highlighted in the corresponding figure legends. In all cases significance is determined by a p-value less than 0.05.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We acknowledge funding from the EPSRC (Doctoral Training Programme Scholarship to TH). Additional consumable funds were kindly provided by the Genesis Research Trust (GRT).
Author contributions
KH, SF and IED conceived the study; KH, SF and IED supervised the study; TH and AL carried out experiments; TH analysed data; TH, SF, KH and IED wrote and revised the manuscript.
Data availability
Data is available upon request to the corresponding author.
Declarations
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Hynes, R. O. The extracellular matrix: not just pretty fibrils. Sci. (80-). 326 (5957), 1216–1219 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bi, Y. et al. Extracellular matrix proteoglycans control the fate of bone marrow stromal cells. J. Biol. Chem.280 (34), 30481–30489 (2005). [DOI] [PubMed] [Google Scholar]
- 3.Meredith, J. E., Fazeli, B. & Schwartz, M. A. The extracellular matrix as a cell survival factor. Mol. Biol. Cell.4 (9), 953–961 (1993). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chen, C. S., Mrksich, M., Huang, S., Whitesides, G. M. & Ingber, D. E. Geometric control of cell life and death. Science (80-).276(5317), 1425–1428 (1997). [DOI] [PubMed]
- 5.Frantz, C., Stewart, K. M. & Weaver, V. M. The extracellular matrix at a glance. J. Cell. Sci.123 (24), 4195–4200 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yue, B. Biology of the extracellular matrix: an overview. J. Glaucoma. 23 (8), S20–S23 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Baker, A. M., Bird, D., Lang, G., Cox, T. R. & Erler, J. T. Lysyl oxidase enzymatic function increases stiffness to drive colorectal cancer progression through FAK. Oncogene32 (14), 1863–1868 (2013). [DOI] [PubMed] [Google Scholar]
- 8.Woodruff, T. K. & Shea, L. D. The role of the extracellular matrix in ovarian follicle development. Reprod. Sci.14 (8), 6–10 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Irving-Rodgers, H. F., Catanzariti, K. D., Aspden, W. J., D’Occhio, M. J. & Rodgers, R. J. Remodeling of extracellular matrix at ovulation of the bovine ovarian follicle. Mol. Reprod. Dev.73 (10), 1292–1302 (2006). [DOI] [PubMed] [Google Scholar]
- 10.Rodgers, R. J., Irving-Rodgers, H. F. & Russell, D. L. Extracellular matrix of the developing ovarian follicle. Reproduction126 (4), 415–424 (2003). [DOI] [PubMed] [Google Scholar]
- 11.Clarke, H. G., Hope, S. A., Byers, S. & Rodgers, R. J. Formation of ovarian follicular fluid May be due to the osmotic potential of large glycosaminoglycans and proteoglycans. Reproduction132 (1), 119–131 (2006). [DOI] [PubMed] [Google Scholar]
- 12.Zhao, Y. & Luck, M. R. Gene expression and protein distribution of collagen, fibronectin and laminin in bovine follicles and corpora lutea. J. Reprod. Fertil.104 (1), 115–123 (1995). [DOI] [PubMed] [Google Scholar]
- 13.Rodgers, H. F. et al. Distribution of the α1 to α6 chains of type IV collagen in bovine follicles. Biol. Reprod.59 (6), 1334–1341 (1998). [DOI] [PubMed] [Google Scholar]
- 14.Chang, H. M. et al. Activin A-induced increase in LOX activity in human granulosa-lutein cells is mediated by CTGF. Reproduction152 (4), 293–301 (2016). [DOI] [PubMed] [Google Scholar]
- 15.Oksjoki, S., Rahkonen, O., Haarala, M., Vuorio, E. & Anttila, L. Differences in connective tissue gene expression between normally functioning, polycystic and post-menopausal ovaries. Mol. Hum. Reprod.10 (1), 7–14 (2004). [DOI] [PubMed] [Google Scholar]
- 16.Heeren, A. M. et al. Development of the follicular basement membrane during human gametogenesis and early folliculogenesis. BMC Dev. Biol.15 (1), 4 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Berkholtz, C. B., Lai, B. E., Woodruff, T. K. & Shea, L. D. Distribution of extracellular matrix proteins type I collagen, type IV collagen, fibronectin, and laminin in mouse folliculogenesis. Histochem. Cell. Biol.126 (5), 583–592 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Huet, C., Monget, P., Pisselet, C. & Monniaux, D. Changes in extracellular matrix components and steroidogenic enzymes during growth and Atresia of antral ovarian follicles in the sheep. Biol. Reprod.56 (4), 1025–1034 (1997). [DOI] [PubMed] [Google Scholar]
- 19.Huet, C., Pisselet, C., Mandon-Pépin, B., Monget, P. & Monniaux, D. Extracellular matrix regulates ovine granulosa cell survival, proliferation and steroidogenesis: relationships between cell shape and function. J. Endocrinol.169 (2), 347–360 (2001). [DOI] [PubMed] [Google Scholar]
- 20.Bonnet, A., Servin, B., Mulsant, P. & Mandon-Pepin, B. Spatio-Temporal Gene Expression Profiling during In Vivo Early Ovarian Folliculogenesis: Integrated Transcriptomic Study and Molecular Signature of Early Follicular Growth. PLoS One.10(11), e0141482 (2015). [DOI] [PMC free article] [PubMed]
- 21.Shi, Y. et al. A Spatiotemporal gene expression and cell atlases of the developing rat ovary. Cell. Prolif.56(12). (2023). [DOI] [PMC free article] [PubMed]
- 22.Hughesdon, P. E. Morphology and morphogenesis of the stein-leventhal ovary and of so-called hyperthecosis. Obstet. Gynecol. Surv.37 (2), 59–77 (1982). [DOI] [PubMed] [Google Scholar]
- 23.Buckett, W. M., Bouzayen, R., Watkin, K. L., Tulandi, T. & Tan, S. L. Ovarian stromal echogenicity in women with normal and polycystic ovaries. Hum. Reprod.14 (3), 618–621 (1999). [DOI] [PubMed] [Google Scholar]
- 24.Jansen, E. et al. Abnormal gene expression profiles in human ovaries from polycystic ovary syndrome patients. Mol. Endocrinol.18 (12), 3050–3063 (2004). [DOI] [PubMed] [Google Scholar]
- 25.Shikanov, A., Xu, M., Woodruff, T. K. & Shea, L. D. Interpenetrating fibrin-alginate matrices for in vitro ovarian follicle development. Biomaterials30 (29), 5476–5485 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.West, E. R., Xu, M., Woodruff, T. K. & Shea, L. D. Physical properties of alginate hydrogels and their effects on in vitro follicle development. Biomaterials28 (30), 4439–4448 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Hornick, J. E., Duncan, F. E., Shea, L. D. & Woodruff, T. K. Isolated primate primordial follicles require a rigid physical environment to survive and grow in vitro. Hum. Reprod.27 (6), 1801–1810 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jin, S. Y., Lei, L., Shikanov, A., Shea, L. D. & Woodruff, T. K. A novel two-step strategy for in vitro culture of early-stage ovarian follicles in the mouse. Fertil. Steril.93 (8), 2633–2639 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ikeda, K. et al. Excessive androgen exposure in female-to-male transsexual persons of reproductive age induces hyperplasia of the ovarian cortex and stroma but not polycystic ovary morphology. Hum. Reprod.28 (2), 453–461 (2013). [DOI] [PubMed] [Google Scholar]
- 30.Younesi, L., Lima, Z. S., Sene, A. A., Jebelli, Z. H. & Amjad, G. Comparison of uterine and ovarian stromal blood flow in patients with polycystic ovarian syndrome. Endocr. Connect.8 (1), 50–56 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Freeberg, M. A. T. et al. Mechanical Feed-Forward loops contribute to idiopathic pulmonary fibrosis. Am. J. Pathol.191 (1), 18–25 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Coeyman, S. J., Richardson, W. J. & Bradshaw, A. D. Mechanics and matrix: positive feedback loops between fibroblasts and ECM drive interstitial cardiac fibrosis. Curr. Opin. Physiol.28, 100560 (2022). [Google Scholar]
- 33.Plewes, M. R. et al. Yes-associated protein 1 is required for proliferation and function of bovine granulosa cells in vitro. Biol. Reprod.101 (5), 1001–1017 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Sun, T. & Diaz, F. J. Ovulatory signals alter granulosa cell behavior through YAP1 signaling. Reprod. Biol. Endocrinol. ;17(1). (2019). [DOI] [PMC free article] [PubMed]
- 35.Lv, X. et al. Timely expression and activation of YAP1 in granulosa cells is essential for ovarian follicle development. FASEB J.33 (9), 10049–10064 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Sun, T., Pepling, M. E. & Diaz, F. J. Lats1 deletion causes increased germ cell apoptosis and follicular cysts in mouse ovaries. Biol. Reprod. ;93(1). (2015). [DOI] [PubMed]
- 37.Lerner, A. et al. RNA-Sequencing reveals a downregulation of cholesterol metabolism pathways in granulosa cells from women with PCOS. Endocr. Abstr ;50. (2017).
- 38.Hardy, K., Hopkins, T., Lerner, A., Green, O. & Franks, S. Differential expression in granulosa-lutein (GL) cells from polycystic ovaries of genes implicated in assembly and modification of extracellular matrix (ECM). Endocr. Abstr (2019).
- 39.Wei, Y. et al. Single-cell profiling of mouse and primate ovaries identifies high levels of EGFR for stromal cells in ovarian aging. Mol. Ther. - Nucleic Acids. 31, 1–12 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Nagashima, T. et al. Connective tissue growth factor is required for normal follicle development and ovulation. Mol. Endocrinol.25 (10), 1740–1759 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Hayashi, K. et al. Comparative immunocytochemical localization of Lysyl oxidase (LOX) and the Lysyl oxidase-like (LOXL) proteins: changes in the expression of LOXL during development and growth of mouse tissues. J. Mol. Histol.35 (8–9), 845–855 (2004). [DOI] [PubMed] [Google Scholar]
- 42.Tiedemann, K. et al. Microfibrils at basement membrane zones interact with Perlecan via fibrillin-1. J. Biol. Chem.280 (12), 11404–11412 (2005). [DOI] [PubMed] [Google Scholar]
- 43.Van der Slot, A. J. et al. Identification of PLOD2 as telopeptide Lysyl Hydroxylase, an important enzyme in fibrosis. J. Biol. Chem.278 (42), 40967–40972 (2003). [DOI] [PubMed] [Google Scholar]
- 44.Masola, V. et al. Heparanase is a key player in renal fibrosis by regulating TGF-β expression and activity. Biochim. Biophys. Acta - Mol. Cell. Res.1843 (9), 2122–2128 (2014). [DOI] [PubMed] [Google Scholar]
- 45.Omachi, T., Ichikawa, T., Kimura, Y., Ueda, K. & Kioka, N. Vinculin association with actin cytoskeleton is necessary for stiffness-dependent regulation of vinculin behavior. PLoS One ;12(4). (2017). [DOI] [PMC free article] [PubMed]
- 46.Hynes, R. O. Integrins: Bidirectional, allosteric signaling machines. Cell110 (6), 673–687 (2002). [DOI] [PubMed] [Google Scholar]
- 47.Teng, B., Lukasz, A. & Schiffer, M. The ADF/Cofilin-Pathway and actin dynamics in podocyte injury. Int. J. Cell. Biol. ;320531. (2012). [DOI] [PMC free article] [PubMed]
- 48.Song, X. et al. Role of SSH1 in colorectal cancer prognosis and tumor progression. J. Gastroenterol. Hepatol.35 (7), 1180–1188 (2020). [DOI] [PubMed] [Google Scholar]
- 49.Goldman, S. & Shalev, E. MMPS and TIMPS in ovarian physiology and pathophysiology. Front. Biosci.9, 2474–2483 (2004). [DOI] [PubMed] [Google Scholar]
- 50.Fléchon, J. E. et al. The extracellular matrix of Porcine mature oocytes: origin composition and presumptive roles. Reprod. Biol. Endocrinol.1 (1), 124 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Yang, M. Y. & Fortune, J. E. Testosterone stimulates the primary to secondary follicle transition in bovine follicles in vitro. Biol. Reprod.75 (6), 924–932 (2006). [DOI] [PubMed] [Google Scholar]
- 52.Laird, M. et al. Androgen stimulates growth of mouse preantral follicles in vitro: interaction with follicle-stimulating hormone and with growth factors of the TGFβ super family. Endocrinology158 (4), 920–935 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Vendola, K. A., Zhou, J., Adesanya, O. O., Weil, S. J. & Bondy, C. A. Androgens stimulate early stages of follicular growth in the primate ovary. J. Clin. Invest.101 (12), 2622–2629 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Webber, L. J. et al. Formation and early development of follicles in the polycystic ovary. Lancet362 (9389), 1017–1021 (2003). [DOI] [PubMed] [Google Scholar]
- 55.Hassani, F. et al. Downregulation of extracellular matrix and cell adhesion molecules in cumulus cells of infertile polycystic ovary syndrome women with and without insulin resistance. Cell. J.21 (1), 35–42 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Shalev, E., Goldman, S. & Ben-Shlomo, I. The balance between MMP-9 and MMP-2 and their tissue inhibitor (TIMP)-1 in luteinized granulosa cells: comparison between women with PCOS and normal ovulatory women. Mol. Hum. Reprod.7 (4), 325–331 (2001). [DOI] [PubMed] [Google Scholar]
- 57.Irving-Rodgers, H. F. et al. Phenotypes of the ovarian follicular basal lamina predict developmental competence of oocytes. Hum. Reprod.24 (4), 936–944 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Van Wezel, I. L., Rodgers, H. F. & Rodgers, R. J. Differential localization of laminin chains in bovine follicles. J. Reprod. Fertil.112 (2), 267–278 (1998). [DOI] [PubMed] [Google Scholar]
- 59.Chen, W. et al. Dynamics of Elastin in liver fibrosis: accumulates late during progression and degrades slowly in regression. J. Cell. Physiol.234 (12), 22613–22622 (2019). [DOI] [PubMed] [Google Scholar]
- 60.Sun, Q. et al. Elastin imaging enables noninvasive staging and treatment monitoring of kidney fibrosis. Sci. Transl Med.11 (486), 4865 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Hoff, C. R., Perkins, D. R. & Davidson, J. M. Elastin gene expression is upregulated during pulmonary fibrosis. Connect. Tissue Res.40 (2), 145–153 (1999). [DOI] [PubMed] [Google Scholar]
- 62.Rockey, D. C., Du, Q. & Shi, Z. Smooth muscle α-Actin deficiency leads to decreased liver fibrosis via impaired cytoskeletal signaling in hepatic stellate cells. Am. J. Pathol.189 (11), 2209–2220 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Leask, A. & Abraham, D. J. The role of connective tissue growth factor, a multifunctional matricellular protein, in fibroblast biology. Biochem. Cell. Biol.81 (6), 355–363 (2003). [DOI] [PubMed] [Google Scholar]
- 64.Duncan, M. R. et al. Connective tissue growth factor mediates transforming growth factor β-induced collagen synthesis: down‐regulation by cAMP. FASEB J.13 (13), 1774–1786 (1999). [PubMed] [Google Scholar]
- 65.Tsai, C. C., Wu, S. B., Kau, H. C. & Wei, Y. H. Essential role of connective tissue growth factor (CTGF) in transforming growth factor-β1 (TGF-β1)-induced myofibroblast transdifferentiation from graves’ orbital fibroblasts. Sci. Rep.8 (1), 1–10 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Miao, Z. L. et al. The intervention effect of Rosiglitozone in ovarian fibrosis of PCOS rats. Biomed. Environ. Sci.25 (1), 46–52 (2012). [DOI] [PubMed] [Google Scholar]
- 67.Brass, D. M., Tomfohr, J., Yang, I. V. & Schwartz, D. A. Using mouse genomics to understand idiopathic interstitial fibrosis. Proc. Am. Thorac. Soc.4 (1), 92–100 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Knipe, R. S., Tager, A. M. & Liao, J. K. The Rho kinases: critical mediators of multiple profibrotic processes and rational targets for new therapies for pulmonary fibrosis. Pharmacol. Rev.67 (1), 103–117 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Johnson, B. G. et al. Connective tissue growth factor domain 4 amplifies fibrotic kidney disease through activation of LDL Receptor-Related protein 6. J. Am. Soc. Nephrol.28, 1769–1782 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Masola, V. et al. Inhibition of heparanase protects against chronic kidney dysfunction following ischemia/reperfusion injury. Oncotarget9 (90), 36185–36201 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Yu, F. X. & Guan, K. L. The Hippo pathway: regulators and regulations. Genes Dev.27 (4), 355–371 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Quan, T. H. et al. Elevated cysteine-rich 61 mediates aberrant collagen homeostasis in chronologically aged and photoaged human skin. Am. J. Pathol.169 (2), 482–490 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Tsou, P. S., Khanna, D. & Sawalha, A. H. Identification of Cysteine-Rich angiogenic inducer 61 as a potential antifibrotic and proangiogenic mediator in scleroderma. Arthritis Rheumatol.71 (8), 1350–1359 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Landolt, L. et al. AXL targeting reduces fibrosis development in experimental unilateral ureteral obstruction. Physiol. Rep.7 (10), e14091 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Zhen, Y., Lee, I. J., Finkelman, F. D. & Shao, W. H. Targeted Inhibition of Axl receptor tyrosine kinase ameliorates anti-GBM-induced lupus-like nephritis. J. Autoimmun.93, 37–44 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Bárcena, C. et al. Gas6/Axl pathway is activated in chronic liver disease and its targeting reduces fibrosis via hepatic stellate cell inactivation. J. Hepatol.63 (3), 670–678 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Espindola, M. S. et al. Targeting of TAM receptors ameliorates fibrotic mechanisms in idiopathic pulmonary fibrosis. Am. J. Respir Crit. Care Med.197 (11), 1443–1456 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Walton, K. L., Johnson, K. E. & Harrison, C. A. Targeting TGF-β mediated SMAD signaling for the prevention of fibrosis. Front. Pharmacol. ;8. (2017). [DOI] [PMC free article] [PubMed]
- 79.Verrecchia, F., Chu, M. L. & Mauviel, A. Identification of novel TGF-β/Smad gene targets in dermal fibroblasts using a combined cDNA Microarray/Promoter transactivation approach. J. Biol. Chem.276 (20), 17058–17062 (2001). [DOI] [PubMed] [Google Scholar]
- 80.Hocevar, B. A., Brown, T. L. & Howe, P. H. TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4-independent pathway. EMBO J.18 (5), 1345–1356 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Karamichos, D., Hutcheon, A. E. K. & Zieske, J. D. Transforming growth factor-β3 regulates assembly of a non-fibrotic matrix in a 3D corneal model. J. Tissue Eng. Regen Med.5 (8), e228–e238 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Ask, K. et al. Progressive pulmonary fibrosis is mediated by TGF-β isoform 1 but not TGF-β3. Int. J. Biochem. Cell. Biol.40 (3), 484–495 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Guo, J. et al. Tgfb3 and Mmp13 regulated the initiation of liver fibrosis progression as dynamic network biomarkers. J. Cell. Mol. Med.25 (2), 867–879 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 9 (7), 676–682 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods25 (4), 402–408 (2001). [DOI] [PubMed] [Google Scholar]
- 86.Ruijter, J. M. et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res.37 (6), e45–e45 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Ramakers, C., Ruijter, J. M., Deprez, R. H. L. & Moorman, A. F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett.339 (1), 62–66 (2003). [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data is available upon request to the corresponding author.







