Generation of induced pluripotent stem cells from a patient with CHARGE syndrome with athymia, harboring a heterozygous mutation in CHD7

Abstract

CHARGE syndrome is a rare, complex congenital disorder affecting multiple organ systems, with CHD7 identified as its primary causative gene. Individuals with CHARGE syndrome can exhibit T cell immunodeficiency, which compromises adaptive immunity and increases susceptibility to infections. T cell immunodeficiency in CHARGE syndrome is largely attributed to thymic hypo/aplasia. In this study, we generated an induced pluripotent stem cell (iPSC) line from the blood of a 21-month-old female with CHARGE syndrome and athymia who carries a de novo CHD7 pathogenic variant, c.1366C > T (p.Q456*). This iPSC line provides a valuable model for investigating the pathogenesis of CHARGE-associated T cell immunodeficiency.

1. Resource Table

Unique stem cell line identifier	UCONNi001-A; https://hpscreg.eu/cell-line/UCONNi001-A
Alternative name(s) of stem cell line	LL237
Institution	University of Connecticut
Contact information of distributor	Name of contact person and email to request more information on the cell line
Type of cell line	iPSC
Origin	human
Additional origin info	Age: 21-month-oldSex: femaleEthnicity if known: white
Cell Source	Peripheral Blood Mononuclear Cells
Method of reprogramming	Sendai virus
Associated disease	CHARGE Syndrome
Gene/locus	CHD7, c.1366C > T p.(Q456*)
Method of modification	N/A
Gene correction	No
Name of transgene or resistance	N/A
Inducible/constitutive system	e.g. TET, ROSA, AAV
Date archived/stock date	4/1/2025
Cell line repository/bank	N/A
Ethical approval	University of Connecticut Stem Cell Research Oversight Committee (SCRO #2023–2) and University of Michigan IRB MED: HUM00032360

2. Resource utility

CHARGE syndrome is a complex congenital disorder (van Ravenswaaij-Arts and Martin, 2017). T cell immunodeficiency can form an important symptom in CHARGE syndrome (Wong et al., 2015; Jyonouchi et al., 2009; Writzl et al., 2007). This iPSC line was generated from a female individual with CHARGE syndrome and athymia, which provides a valuable resource for studying the pathogenesis and treatment for T cell immunodeficiency in this disorder.

3. Resource Details

Although “CHARGE” represents the acronym for Coloboma, Heart defects, Atresia of the choanae, Retardation of growth and development, Genital hypoplasia, and Ear anomalies, the clinical presentation of CHARGE syndrome extends beyond these defining features and often includes abnormalities in additional organ systems, including the immune system (van Ravenswaaij-Arts and Martin, 2017; Wong et al., 2015; Jyonouchi et al., 2009; Writzl et al., 2007). Individuals with CHARGE syndrome frequently exhibit T cell lymphopenia, and this immunological phenotype is primarily attributed to thymic hypoplasia or aplasia (Wong et al., 2015; Jyonouchi et al., 2009; Writzl et al., 2007). Chromodomain Helicase DNA-Binding 7 (CHD7) has been identified as the major causative gene in this disorder (van Ravenswaaij-Arts and Martin, 2017). CHD7 is an ATP-dependent chromatin-remodeling protein that regulates nucleosome positioning and chromatin accessibility. The CHD7 gene is located on chromosome 8q12.1, contains 38 exons, and encodes a 2,997-amino-acid protein.

To generate a reliable cellular resource for studying T cell immunodeficiency associated with CHARGE syndrome, we established an induced pluripotent stem cell (iPSC) line from a 21-month-old female individual with athymia carrying a de novo heterozygous CHD7 nonsense pathogenic variant, c.1366C > T (p.Q456*). The girl exhibited severe T cell immunodeficiency prior to receiving a thymic transplant.

Peripheral blood mononuclear cells (PBMCs) were reprogrammed using the non-integrating CytoTune-Sendai viral vector system (Thermo Fisher Scientific), which delivers OCT3/4, KLF4, SOX2, and C-MYC. A single clone (LL237) displaying typical pluripotent stem cell morphology (passage 6) was expanded for characterization (Fig. 1A). Immunofluorescence and flow cytometry confirmed expression of undifferentiated hPSC state markers OCT4, SSEA4, NANOG, TRA-1–60, and SOX2 (passage 7), with α-tubulin included as a cytoskeletal reference (Fig. 1B–E). Quantitative RT-PCR (qRT-PCR) further demonstrated that OCT4, NANOG, and SOX2 expression levels at passage 7 were comparable to those of the human embryonic stem cell (hESC) line H9 (Fig. 1F).

Fig. 1.

G-banding karyotype analysis showed a normal 46,XX karyotype at passage 10, with no clonal abnormalities detected (Supplementary Fig. 1). A pericentric inversion of chromosome 9 was observed but is recognized as a common population variant. The heterozygous CHD7 variant c.1366C > T (p.Q456*) at passage 6 was confirmed by Sanger sequencing (Fig. 1G). Short tandem repeat (STR) profiling verified identical allelic patterns between the iPSC line (passage 3) and the patient’s PBMCs (Submitted in archive with journal). Mycoplasma testing (passage 6) was negative (Supplementary Table S1). Clearance of the Sendai virus vector (Sev) was confirmed by qRT-PCR using vector-specific primers after multiple passages (Supplementary Fig. 2).

Undifferentiated hPSC state (at passage 7) was further validated by teratoma formation, demonstrating differentiation into tissues representing all three germ layers—ectoderm, mesoderm, and endoderm (Fig. 1H). Together, these results confirm that this patient-derived iPSC line is a high-quality, genetically validated resource suitable for investigating T cell immunodeficiency in CHARGE syndrome. The details of characterization are listed in Table 1.

Table 1.

Classification	Test	Result	Data
Morphology	Photography	Normal	Fig. 1 panel A
Phenotype	Immunocytochemisty	Assess staining/expression of pluripotency markers: TRA-1–60, Oct4, Sox2, SSEA4, NANOG	Fig. 1 panel B-D
	Flow cytometry	Assess antigen levels & cell surface/nuclear markers: Oct3/4: 97.7 %, TRA-1–60: 98.6 % SSEA-4: 99.6 %, SOX2: 99.4 %, NANOG:99 %	Fig. 1 panel E
Genotype	Karyotype (G-banding) and resolution	46,XX Resolution: 350–450 bands	Supplementary Fig. 1
Identity	Microsatellite PCR (mPCR)	DNA Profiling not performed	N/A
	STR analysis	18 loci tested: all matched	Submitted in archive with journal
Mutation analysis (IF APPLICABLE)	Sequencing	Heterozygous, for CHD7 c.1366C > T p. (Q456*)	Fig. 1 panel G
	Southern Blot OR WGS	Not performed	N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence. Negative	Supplementary Table 1
Differentiation potential	Teratoma formation	Differentiation to all three germ layers confirmed by H&E staining	Fig. 1 panel H
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

4. Materials and Methods

4.1. Reprogramming of PBMCs

Peripheral blood was collected from the patient using BD Vacutainer glass blood collection tubes containing K3 EDTA (BD, Cat# 366450). Peripheral blood mononuclear cells (PBMCs) were isolated using SepMate-50 tubes (STEMCELL Technologies, Cat# 85450) according to the manufacturer’s instructions. PBMCs were cultured in StemSpan SFEM II medium (STEMCELL Technologies, Cat# 09655) supplemented with cytokines and growth factors and then transduced with Sendai virus carrying the four Yamanaka reprogramming factors using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Invitrogen, Cat# A16517). Approximately 48 h after transduction, the cells were transferred to Mitomycin C-treated CF1 mouse embryonic fibroblasts. The medium was replaced with a 1:1 mixture of StemSpan SFEM medium and iPSC medium on day 5 and with iPSC medium only on day 6. After colonies became evident, individual colonies were manually selected and transferred to a separate well of a 24-well plate for further expansion.

4.2. Immunofluorescence

Cells were fixed with 4 % paraformaldehyde, permeabilized with 0.1 % Triton^™ X-100, and blocked in 2 % BSA. Cells were stained using the Human Embryonic Stem Cell Marker Panel containing antibodies against OCT4, NANOG, TRA-1–60R, SSEA4, and SOX2 (Abcam, Cambridge, UK). Alexa Fluor^® 488- or 546-conjugated goat anti-rabbit and goat anti-mouse IgG H&L antibodies, or Alexa Fluor^® 546–labeled goat anti-mouse IgM μ-chain (Invitrogen), were used as secondary antibodies. Nuclei were counterstained with DAPI. Images were acquired using a Keyence fluorescence microscope (KEYENCE, USA).

4.3. Flow cytometry

Single-cell suspensions were prepared using Accutase Cell Dissociation Reagent (Gibco). Cells were stained with fluorochrome-conjugated antibodies against OCT4, TRA-1–60-R, SSEA4, SOX2, and NANOG. Samples were analyzed on an LSR II flow cytometer (BD Biosciences), and data were processed using FlowJo software (Tree Star, Ashland, OR) (Zhao et al., 2024).

4.4. qRT-PCR

Total RNA was extracted, and cDNA synthesis and qRT-PCR were performed as previously described (Zhao et al., 2024). Gene expression levels were normalized to GAPDH and presented relative to expression in the human embryonic stem cell line H9. Primer sequences are listed in Table 2.

Table 2.

Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat # and RRID
Pluripotency Markers	Rabbit anti-OCT4	1:250	Abcam, Cat# ab19857, RRID: AB_445175
	Mouse anti-SSEA4	1:250	Abcam, Cat# ab16287, RRID: AB_778073
	Mouse anti-TRA-1–60	1:500	Abcam, Cat# ab16288, RRID: AB_778563
	Rabbit anti-Nanog	1:500	Abcam, Cat# ab109250, RRID: AB_10,863,442
	Rabbit anti-SOX2	1:500	Abcam, Cat# ab97959, RRID: AB_2341193
	Mouse anti-Tubulin-α	1:250	BioLegend, Cat# 627901, RRID: AB_439760
	PE anti-Oct4 (Oct3)	1:20	BioLegend, Cat# 653703, RRID: AB_2562017
	Alexa Fluor 488 mouse anti-human TRA-1–60-R	1:20	BioLegend, Cat# 330613, RRID: AB_2295395
	Alexa Fluor 488 mouse anti-SOX2	1:20	BioLegend, Cat# 656109, RRID: AB_2563956
	APC mouse anti-human SSEA-4	1:20	BioLegend, Cat# 330417, RRID: AB_2616818
	Alexa Fluor 647 mouse anti-Nanog	1:20	BioLegend, Cat# 674010, RRID: AB_2632605
Secondary antibodies	Alexa Fluor 546 goat anti-rabbit IgG	1:1000	Invitrogen, Cat# A-11035, RRID: AB_2534093
	Alexa Fluor 488 goat anti-mouse IgG	1:1000	Invitrogen, Cat# A-11029, RRID: AB_2534088
	Alexa Fluor 546 goat anti-mouse IgM (Heavy chain)	1:1000	Invitrogen, Cat# A-21045, RRID:AB_2535714
	Alexa Fluor 488 goat anti-Mouse IgG, IgM (H + L)	1:1000	Invitrogen, Cat#A-10680, RRID: AB_2534062
Primers
	Target	Forward/Reverse primer (5–3)
Pluripotency Markers (qRT-PCR)	OCT4	GTGGAGGAAGCTGACAACAA / ATTCTCCAGGTTGCCTCTCA
	NANOG	TGAACCTCAGCTACAAACAG / TGGTGGTAGGAAGAGTAAAG
	SOX2	AGCTACAGCATGATGCAGGA / GGTCATGGAGTTGTACTGCA
	SeV	GGATCACTAGGTGATATCGAGC / ACCAGACAAGAGTTTAAGAGATATGTATC
House-Keeping Genes (qRT-PCR)	GAPDH	GTCTCCTCTGACTTCAACAGCG / ACCACCCTGTTGCTGTAGCCAA
Targeted mutation analysis/sequencing	CHD7	AAAGCAATGAGTAATCCAGCAG / ATGAGGGTGTGGAGGTGAAG

4.5. Karyotype analysis

G-banding karyotyping was performed by Creative Biolabs Inc.

4.6. Mycoplasma Detection

Mycoplasma contamination was assessed using the MycoAlert^™ PLUS Mycoplasma Detection Kit (Lonza, Cat# LT07–701).

4.7. Short tandem repeat (STR) analysis

STR profiling of the iPSC line and the patient’s PBMCs was performed by the American Type Culture Collection (ATCC).

4.8. Sequencing analysis

Genomic DNA was isolated from blood and iPSCs at passage 5 using the Genomic DNA Purification Kit (Promega). PCR amplification was performed using the Veriti 96-Well Thermal Cycler (Applied Biosystems). Sanger sequencing was used to confirm the CHD7 pathogenic variant c.1366C > T (p.Q456*), using primers listed in Table 2.

4.9. Teratoma formation

The trilineage differentiation potential of the iPSC line was evaluated by teratoma formation in vivo. Approximately 2 × 10⁶ iPSCs at passage 6 were resuspended in 20 μL Matrigel and injected subcutaneously into immunodeficient NOD/SCID mice. After 8 weeks, teratomas were harvested, fixed in 4 % paraformaldehyde for 12–24 h, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E) to assess differentiation into ectoderm, mesoderm, and endoderm.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2026.103912.

Data availability

Data will be made available on request.