Skip to main content
Cellular Oncology logoLink to Cellular Oncology
. 2017 Oct 9;41(1):13–24. doi: 10.1007/s13402-017-0353-5

Lithocholic bile acid inhibits lipogenesis and induces apoptosis in breast cancer cells

Trang H Luu 1, Jean-Marie Bard 1,2, Delphine Carbonnelle 1, Chloé Chaillou 1, Jean-Michel Huvelin 1, Christine Bobin-Dubigeon 1,2, Hassan Nazih 1,
PMCID: PMC12995252  PMID: 28993998

Abstract

Background

It has amply been documented that mammary tumor cells may exhibit an increased lipogenesis. Biliary acids are currently recognized as signaling molecules in the intestine, in addition to their classical roles in the digestion and absorption of lipids. The aim of our study was to evaluate the impact of lithocholic acid (LCA) on the lipogenesis of breast cancer cells. The putative cytotoxic effects of LCA on these cells were also examined.

Methods

The effects of LCA on breast cancer-derived MCF-7 and MDA-MB-231 cells were studied using MTT viability assays, Annexin-FITC and Akt phosphorylation assays to evaluate anti-proliferative and pro-apoptotic properties, qRT-PCR and Western blotting assays to assess the expression of the bile acid receptor TGR5 and the estrogen receptor ERα, and genes and proteins involved in apoptosis (Bax, Bcl-2, p53) and lipogenesis (SREBP-1c, FASN, ACACA). Intracellular lipid droplets were visualized using Oil Red O staining.

Results

We found that LCA induces TGR5 expression and exhibits anti-proliferative and pro-apoptotic effects in MCF-7 and MDA-MB-231 cells. Also, an increase in pro-apoptotic p53 protein expression and a decrease in anti-apoptotic Bcl-2 protein expression were observed after LCA treatment of MCF-7 cells. In addition, we found that LCA reduced Akt phosphorylation in MCF-7 cells, but not in MDA-MB-231 cells. We also noted that LCA reduced the expression of SREBP-1c, FASN and ACACA in both breast cancer-derived cell lines and that cells treated with LCA contained low numbers of lipid droplets compared to untreated control cells. Finally, a decrease in ERα expression was observed in MCF-7 cells treated with LCA.

Conclusions

Our data suggest a potential therapeutic role of lithocholic acid in breast cancer cells through a reversion of lipid metabolism deregulation.

Keywords: Lithocholic acid, MCF-7 cells, MDA-MB-231 cells, TGR5 activation, Lipogenesis, Breast cancer, Gut microbiota

Introduction

Breast cancer is the most frequently diagnosed cancer type and a notable cause of cancer-related death in women worldwide [1, 2]. Improving our knowledge on the etiology of breast cancer is crucial for the design of prevention strategies and for gaining insight into its pathology. The deregulation of lipid metabolism has recently been recognized as an important hallmark of cancer. To attain their high demands for membrane and energy production, cancer cells exhibit a strong lipid and cholesterol avidity. An increased uptake of exogenous lipids, as well as an increased endogenous synthesis (lipogenesis process) have been noted [3]. Indeed, overexpression and elevated activity of key lipogenic enzymes, such as acetyl-CoA carboxylase (ACACA) and fatty acid synthase (FASN), have been observed in many human epithelial cancers, including breast cancer [4]. Also, FASN has recently been reported to regulate estrogen receptor alpha (ERα) signaling, which occurs in ~75% of all breast cancers [5, 6].

Primary bile acids (BAs), chenodeoxycholic acid and cholic acid are synthetized from cholesterol in the liver and subsequently discharged into the intestinal lumen. Gut microflora further converts these primary BAs to the secondary BAs deoxycholic acid and lithocholic acid, originating from cholic acid and chenodeoxycholic acid, respectively. The important role of BAs is to facilitate the absorption of dietary lipids and fat-soluble vitamins [7]. Recent studies have shown that BAs may act not only as detergents, but also as important signaling molecules that may exert various biological effects via activation of specific nuclear receptors such as the farnesoid X receptor (FXR), the pregnane X receptor (PXR) and the vitamin D receptor, as also the membrane G protein coupled BA receptor TGR5 (TGR5) [8]. Therefore, bile acids have the potential to modulate lipid, glucose and drug metabolism.

Among two principal secondary BAs that are produced by intestinal bacteria, lithocholic acid (LCA), which is the most hydrophobic BA, has been reported to have anticancer effects. It has for example been found that LCA may efficiently affect the in vitro behavior of cancer cells derived from different organs, such as colon cancer cells [9], neuroblastoma cells [10] and prostate cancer cells [11]. In addition, LCA has been shown to act as an anti-aging molecule based on its capacity to increase the chronological lifespan of yeast cells [12]. In addition, Goldberg et al. [10] found that LCA may have an effect on the proliferation of MCF-7 breast cancer-derived cells, but only at a high concentration (500 μM).

The purpose of the present study was to investigate the capacity of LCA to inhibit lipogenesis in two breast cancer-derived cell lines, MCF-7 (ER-positive and p53 wild-type) and MDA-MB-231 (ER-negative and p53 mutated). We also evaluated more extensively the cytotoxic effect of LCA using cell viability and apoptosis assays, in conjunction with mRNA/protein expression and activation assays. Our results suggest that LCA can be used as an anti-proliferative and pro-apoptotic agent targeting lipid metabolism in breast cancer cells.

Materials and methods

Materials

In this study we used lithocholic acid (LCA), 5β cholanoic acid (5βCA), cerulenin, Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), glutamine, penicillin-streptomycin, fatty acid-free bovine serum albumin (BSA), 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT), Dimethyl sulfoxide (DMSO), PCR primers and other chemicals that were not specifically indicated, from Sigma Aldrich (Lyon, France). FITC Annexin V-Propidium iodide (PI) Apoptosis Kit, secondary antibody Alexa Fluor®488 and TRIzol reagent for RNA isolation were purchased from Invitrogen (Cergy Pontoise, France). iSript™ Reverse Transcription Supermix for qRT-PCR and an iQ™ SYBR Green Supermix were purchased from Bio-Rad (Marnes-la-Coquette, France). We also purchased primary antibodies from Santa Cruz Biotechnology (Heidelberg, Germany) [p53], from Novus Biological [SREBP-1c and ACACA], from Cell Signaling [phospho-Akt] and from Sigma Aldrich [Bax, Bcl-2, ERα, FASN, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin]. The IRDye whole IgG secondary antibodies were purchased from LI-COR Biosciences (Bad Homburg, Germany).

Cell culture and treatment

The human breast cancer-derived cell lines MCF-7 and MDA-MB-231 were obtained from the European Collection of Animal Cell Cultures (ECACC, Salisbury, UK). The MCF-7 and MDA-MB-231 cells were cultured in DMEM supplemented with 10% FBS, 1% glutamine and 1% penicillin-streptomycin. The cells were maintained in a humidified incubator at 37 °C in an atmosphere of 5% CO2.

LCA was dissolved in absolute ethanol at a stock concentration of 50 mM. Stock solutions of 5βCA and cerulenin were also prepared in DMSO at concentrations of 50 mM and 20 mM, respectively. For the treatment of cultured MCF-7 and MDA-MB-231 cells, the stock solutions were diluted with serum-free medium containing 0.1% BSA to the indicated final concentrations of LCA, 5βCA and cerulenin. Cells treated with 0.4% EtOH or 0.4% EtOH/0.01% DMSO (v/v) were used as negative controls for the assays with LCA and LCA/5βCA, respectively, whereas 0.25% DMSO (v/v) was used as a negative control for the assays with cerulenin.

Cell viability assay

MCF-7 and MDA-MB-231 cells were seeded in 96-well plates at a density of 104 cells/well in 200 μl culture medium and allowed to adhere overnight. Next, the medium was removed and the cells were incubated with 20, 50, 75, 100, 150 and 200 μM LCA alone or in combination with 6 μM 5βCA for 24 h. For the cerulenin experiments the cells were incubated with 50 μM for 24 h. To assess the cell viability, MTT solution (50 μl of 2.5 mg/ml) was added to each well to get formazan crystals. After 4 h of incubation, the liquid in the wells was removed and the formazan deposits were solubilized in 200 μl DMSO after which the absorbance was measured at 570 nm using SpectraMax 190 equipment. Cell viability was calculated as percentage of the untreated control.

Cell proliferation assay

MCF-7 and MDA-MB-231 cells were grown in 6-well plates at a density of 3 × 105 cells/well and treated with 75, 100, 150 and 200 μM LCA alone or in combination with 6 μM 5βCA for 24 h at 37 °C. For the cerulenin assays cells were incubated at 50 μM for 24 h. Next, the cells were harvested and subjected to Annexin-FITC assays using a FITC Annexin V-PI Apoptosis Kit according to the manufacturer’s instructions. The cells were labeled with Annexin V (50 μg/ml) and propidium iodide (100 μg/ml) and analyzed using flow cytometry (BD Accuri™ C6).

Akt phosphorylation assays

MCF-7 and MDA-MB-231 cells were cultured and treated with LCA alone as described in section 2.4. After harvesting, the cells were fixed with 4% paraformaldehyde (PAF), permeabilized in 90% MeOH and incubated with a primary antibody directed against phospho-Akt (Thr308) for 1 h at room temperature. Next, the cells were incubated for 1 h at room temperature with the fluorescent secondary Alexa Fluor 488 antibody and analyzed using flow cytometry (BD Accuri™ C6).

In addition, MCF-7 cells were grown on coverslips, treated with 75, 100 or 150 μM LCA, fixed with 4% PAF, blocked and permeabilized in 3% BSA/0.3% Triton X100. Next, the cells were incubated overnight at 4 °C with a primary antibody directed against phospho-Akt (Thr308) and a fluorescent secondary Alexa Fluor 488 antibody for an additional 1 h at room temperature. The nuclei were stained with 4, 6-diamido-2-phenylindole (DAPI) for 5 min, after which the cells were evaluated using an Axio Imager M2 m microscope (Carl Zeiss, Jena, Germany) equipped with an AxioCam 503 mono at 40× magnification. Negative controls with secondary antibody alone were included in all experiments.

Quantitative real time PCR (qRT-PCR)

MCF-7 and MDA-MB-231 cells were seeded at a density of 5 × 105 cells/well in 6-well plates. After 24 h, the cells were treated with 50, 75, 100, 150 and 200 μM LCA for another 24 h at 37 °C, after which total RNA was isolated using TriZol Reagent, and cDNA was prepared using an iScript™ Reverse Transcription Supermix according to the manufacturer’s instructions. An initial priming step of 5 min at 25 °C was followed by reserve transcription for 30 min at 42 °C and a RT inactivation step of 5 min at 85 °C. Quantitative PCR was performed on a MyiQ2 Real-Time PCR Detection System (Bio-Rad) using an iQ™ SYBR Green Supermix. PCR was carried out using 45 cycles of 95 °C for 30 s and 60 °C for 30 s. TGR5, SREBP-1c, FASN, ACACA, Bax, Bcl-2, p53 and ERα gene expression levels were calculated relative to that of the reference 18S gene using the ΔΔCT method. The sequences of the primers used are listed in Table 1.

Table 1.

Primer sequences used in this study

Gene name Sequences (5′-3′)
18S

F- GATGCGGCGGCGTTATTCC

R- CTCCTGGTGGTGCCCTTCC

TGR5

F- ACCAGACATGGTCCAAAC

R- GATTCATGTTCGATGGCTG

SREBP-1c

F- AATCTGGGTTTTGTGTCTTC

R- AAAAGTTGTGTACCTTGTGG

FASN

F-ACAGGGACAACCTGGAGTTCT

R-CTGTGGTCCCACTTGATGAGT

ACACA

F- TCGCTTTGGGGGAAATAAAGTG

R- ACCACCTACGGATAGACCGC

Bcl-2- associated X protein (Bax)

F- CAGGGTGGTTGGGACGGCCT

R- CTGGGGGCCTCAGCCCATCT

B-cell lymphoma 2 (Bcl-2)

F- GATTGTGGCCTTCTTTGAG

R- GTTCCACAAAGGCATCC

P53

F- ACCTATGGAAACTACTTCCTG

R- ACCATTGTTCAATATCGTCC

Estrogen receptor α (ERα)

F- GGAGTGTACACATTTCTGTC

R- CAAAGTGTCTGTGATCTTGTC

Western blotting

MCF-7 and MDA-MB-231 cells were seeded and treated with LCA in 6-well plates as described in section 2.6. After washing with fresh PBS, the cells were lysed in 200 μl RIPA buffer [50 mM Tris-HCl pH 8, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% Sodium Dodecyl Sulfate (SDS)], supplemented with the protease inhibitors aprotinin (2 μg/ml) and phenylmethylsulfonyl fluoride (PMSF) (1 mM). The lysates were harvested and agitated at 4 °C for 30 min. After centrifugation at 4 °C for 30 min at 12000 rpm, the supernatants containing total cellular protein extracts were collected. After the protein concentrations were determined using a BCA Protein Assay, they were separated using 4–15% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. Next, the membranes were blocked for 2 h with 5% milk Tris-buffered saline (TBS)-0.1% Tween 20 solution at room temperature and incubated overnight at 4 °C with primary antibodies directed against SREBP-1c, FASN, ACACA, p53, Bax, Bcl-2, ERα, β-actin and GAPDH. Finally, protein bands were detected by incubation with IRDye whole IgG secondary antibodies and visualized using a Licor Odyssey Scanner. β-actin or GAPDH were used as loading controls.

Lipid staining (oil red O)

MCF-7 cells were seeded and treated with LCA in 96-well plates as described section 2.4. The lipid droplets in cells were stained using a Lipid (Oil Red O) Staining kit (Sigma). Briefly, cells were washed carefully with PBS and fixed with formalin (10%) for 1 h. After removing the formalin, 60% isopropanol was added to each well for 5 min. Next, the cells were incubated in 60% Oil Red O staining solution for 30 min, followed by incubation with Hematoxylin for 1 min. Finally, the cells were washed 3 times with water after which cell morphologies and lipid droplets were evaluated using confocal microscopy (Nikon A1RSi) at 20× magnification.

Data analysis

Results were obtained from triplicate experiments and the values presented correspond to the means of at least three independent experiments. IC50 values were determined from dose-response curves using the Table Curve 2D v5.01 tool (Systat Software, Inc). Comparisons were made using the Student’s t-test and p-values of < 0.05 were considered as being statistically significant.

Results

LCA stimulates TGR5 expression in breast cancer cells

In order to verify the mechanism by which LCA interacts with breast cancer cells, we assessed the expression of its membrane receptor TGR5 in two breast cancer-derived cell lines, MCF-7 and MDA-MB-231, after exposure to LCA. By doing so, we found that LCA significantly stimulated TGR5 mRNA expression in both cell lines at all tested concentrations in a dose-dependent manner (Fig. 1).

Fig. 1.

Fig. 1

LCA increases TGR5 mRNA expression in MCF-7 and MDA-MB-231 cells at different concentrations (50 μM, 75 μM, 100 μM, 150 μM and 200 μM) for 24 h. * p < 0.05 versus control

LCA decreases cell proliferation and induces apoptosis in breast cancer cells

The breast cancer-derived cell lines MCF-7 and MDA-MB-231 were exposed to increasing concentrations of LCA (20–200 μM) without or with 6 μM 5βCA, a TGR5 antagonist [13], for 24 h after which cell viabilities were determined using a MTT assay. We found that LCA significantly reduced cell viability in a concentration-dependent manner in both cell lines (Fig. 2). The IC50 values of LCA in the MCF-7 and MDA-MB-231 cells were 104.9 ± 2 μM and 144.8 ± 1 μM, respectively. Moreover, we found that the anti-viability (anti-proliferative) effect of LCA decreased significantly when the cells were co-exposed to LCA and 5βCA.

Fig. 2.

Fig. 2

Effect of LCA on the viability of MCF-7 (a) and MDA-MB-231 (b) cells assessed by MTT assay. The percentages of MCF-7 and MDA-MB-231 cells alive after 24 h LCA treatment alone or in combination with 6 μM 5βCA are depicted. Each point represents the mean ± SD of three different experiments. *p < 0.05 versus control, ** p < 0.05 versus LCA alone at the same concentration

Flow cytometric analysis of Annexin-V FITC allows assessment of apoptosis induction by LCA in breast cancer-derived cells. The apoptosis inducing capacity of LCA was determined by comparing the number of early apoptotic (Q2), late apoptotic (Q3) and necrotic (Q4) cells with those of control cells. By doing so, we found that after treatment of MCF-7 cells with LCA (100, 150 and 200 μM) for 24 h, the percentage of late apoptotic cells (Q3) was 10.7, 9.8 and 11.5%, and that of necrotic cells (Q4) 1.7, 8.5 and 8.4%, respectively (Fig. 3a). In MDA-MB-231 cells, LCA only induced apoptosis when used at high concentrations (150 and 200 μM) (Fig. 3b). In accordance with the cell viability results, we found that after LCA treatment the percentage of early apoptotic, late apoptotic and necrotic cells decreased in the presence of 5βCA (Fig. 3a and b). From these data we conclude that TGR5 activation may play a role in the anti-carcinogenic activity of LCA in breast cancer cells.

Fig. 3.

Fig. 3

Detection of apoptosis in MCF-7 (a) and MDA-MB-231 (b) cells after 24 h treatment with LCA alone or in combination with 6 μM 5βCA using an Annexin V/ Propidium iodide (PI) apoptosis kit (X axis - Annexin V and Y axis - PI fluorescence intensities). Representative figures showing population of viable (Q1/annexin V- PI-), early apoptotic (Q2/annexin V+ PI-), late apoptotic (Q3/annexin V+ PI+) and necrotic (Q4/annexin VPI+) cells. Inserted numbers indicate percentages of cells in each area

Next, we set out to unravel the molecular mechanism underlying this apoptotic response. To this end, we used qRT-PCR to assess alterations in the relative mRNA levels of pro-apoptotic (Bax, p53) and anti-apoptotic (Bcl-2) proteins in MCF-7 and MDA-MB-231 cells. Importantly, we found that LCA (100, 150 and 200 μM) significantly enhanced the expression of p53 in MCF-7 cells, but not in MDA-MB-231 cells (Fig. 4a). In MCF-7 cells we also found profound decreases in Bcl-2 expression (9 ± 1-fold, 37 ± 5-fold and 50 ± 8-fold) at LCA concentrations of 100, 150 and 200 μM, respectively. In MDA-MB-231 cells the decrease in Bcl-2 expression was significant only when LCA was used at high concentrations (150 and 200 μM) causing anti-proliferative and pro-apoptotic effects. These qRT-PCR results were subsequently confirmed by Western blotting. We found that MCF-7 cells exposed to LCA expressed lower Bcl-2 and higher p53 protein levels compared to unexposed control cells (Fig. 4b). In MDA-MB-231 cells treated with LCA we did not observe any change in the p53 protein level and a reduction in the Bcl-2 protein level only at LCA concentrations of 150 and 200 μM.

Fig. 4.

Fig. 4

Expression of anti- and pro-apoptotic proteins in MCF-7 and MDA-MB-231 cells treated with LCA at different concentrations (50 μM, 75 μM, 100 μM, 150 μM and 200 μM) for 24 h. a Relative p53, Bax and Bcl-2 mRNA expression levels in MCF-7 and MDA-MB-231 cells. b Western Blot analysis of p53, Bax and Bcl-2 proteins in MCF-7 and MDA-MB-231 cells. Each point represents the mean ± SD of three different experiments. * p < 0.05 versus control

Labeling of MCF-7 and MDA-MB-231 cells with an antibody directed against phospho-Akt allows the assessment of Akt phosphorylation in these cells after LCA treatment. By doing so, we found that the level of Akt protein phosphorylation (activation) was decreased in LCA treated MCF-7 cells. The percentage of MCF-7 labeled cells gradually decreased, being 62, 46, 34 and 31% at LCA concentrations of 75, 100, 150 and 200 μM, respectively, compared to untreated control cells (Fig. 5a). Subsequent immunofluorescence analyses revealed a high level of phosphorylated Akt in the membranes of untreated cells. In contrast, we found that LCA treated cells exhibited a low abundance of phosphorylated Akt in their membranes (Fig. 5b). In contrast, no changes in phosphorylated Akt levels were observed in MDA-MB-231 cells exposed to LCA at the used concentrations compared to untreated control cells (Fig. 5c).

Fig. 5.

Fig. 5

LCA reduces Akt phosphorylation in MCF-7 cells but not in MDA-MB-231 cells after 24 h treatment. a Flow cytometry analysis of Akt phosphorylation in MCF-7 cells. b Immunofluorescence analysis of MCF-7 cells stained with an antibody directed against Phospho-Akt. c Flow cytometry analysis of Akt phosphorylation in MDA-MB-231 cells. Each point represents the mean ± SD of three different experiments. * p < 0.05 versus control

LCA inhibits lipogenesis in breast cancer cells

In order to investigate the impact of LCA on lipogenesis in MCF-7 and MDA-MB-231 cells, we examined the expression of a few genes involved in this process. We found that the mRNA expression of the sterol regulatory element-binding protein (SREBP)-1c was decreased in both cell lines after treatment with LCA (100, 150 and 200 μM; Fig. 6a). Based on this observation, we next set out to analyze the expression of key lipogenic enzymes that are regulated by SREBP-1c, including FASN and ACACA. We found that LCA (100, 150 and 200 μM) significantly decreased the mRNA expression of FASN and ACACA in both MCF-7 and MDA-MB-231 cells (Fig. 6b). These results were subsequently confirmed at the protein level, i.e., reduced SREBP-1c, FASN and ACACA protein levels were observed in LCA-treated MCF-7 cells (Fig. 6c).

Fig. 6.

Fig. 6

Reduction of lipogenesis in MCF-7 and MDA-MB-231 cells treated with LCA at different concentrations (50 μM, 75 μM, 100 μM, 150 μM and 200 μM) for 24 h. a, b Relative SREBP-1c, FASN and ACACA mRNA expression levels in both cell lines. c Western Blot analysis of SREBP-1, FASN and ACACA proteins in MCF-7 cells. Each point represents the mean ± SD of three different experiments. * p < 0.05 versus control

We next decided to investigate lipid accumulation in MCF-7 cells after LCA treatment using Oil Red O staining, which allows the visualization of lipid droplets. We found that the number of stained lipid droplets decreased after LCA treatment (75, 100, 150 and 200 μM) compared to those in untreated cells (Fig. 7). To show that lipogenic activity is necessary for the proliferation and survival of breast cancer cells, we treated MCF-7 cells with cerulenin, a specific FASN enzyme inhibitor [14]. We found that cerulenin at a concentration of 50 μM caused a significant reduction in proliferation and an increase in apoptosis of MCF-7 cells after 24 h treatment (Fig. 8).

Fig. 7.

Fig. 7

LCA decreases the accumulation of lipid droplets (LDs). MCF-7 cells were treated with LCA at different concentrations (50 μM, 75 μM, 100 μM, 150 μM and 200 μM) for 24 h and stained with Oil Red O. The LDs appear in untreated cells and in cells treated with LCA at a concentration of 50 μM (arrows), but not in cells treated with LCA at a concentration of 75 μM and above

Fig. 8.

Fig. 8

Anti-proliferative and pro-apoptotic effects of cerulenin on MCF-7 cells. a Percentage of MCF-7 cells alive after 24 h of cerulenin treatment assessed by MTT assay. Each point represents the mean ± SD of three different experiments, * p < 0.05 versus control. b Cerulenin-induced late apoptosis (Q3) in MCF-7 cells after 24h treatment detected by Annexin V/ PI apoptosis kit. Inserted numbers indicate percentage of cells in each area

LCA reduces ERα expression in MCF-7 cells

Finally, we examined the expression of the estrogen receptor α (ERα) in ERα positive MCF-7 cells after LCA treatment. We found that LCA caused a major decrease in ERα expression at both the mRNA and protein levels (Fig. 9).

Fig. 9.

Fig. 9

Reduction of ERα in MCF-7 cells treated with LCA at different concentrations (50 μM, 75 μM, 100 μM, 150 μM and 200 μM) for 24 h. (a) Relative ERα mRNA expression. (b) Western Blot analysis for ERα protein expression. Each point represents the mean ± SD of three different experiments. * p < 0.05 versus control

Discussion

Previous studies have reported cytotoxic activities of LCA against various cancer cells, including colon cancer cells, neuroblastoma cells and prostate cancer cells. The G-protein coupled bile acid receptor Gpbar1 (also named TGR5) is a specific cell surface receptor for bile acids and a member of the G-protein-coupled receptor (GPCR) family. It has been found that TGR5 gene expression is widely distributed in endocrine glands, adipocytes, muscles, immune organs, the gallbladder and the enteric nervous system [15]. Among biliary acids, LCA possesses the strongest agonistic interaction with the TGR5 receptor due to its hydrophobicity, with a reported EC50 value of 0.58 μM [16]. TGR5 activation after treatment with LCA has been documented in neuroblastoma and prostate cancer cells [10, 11]. In the present study, we sought to assess whether LCA exhibits anti-proliferative and/or pro-apoptotic effects, while attenuating its lipogenic activity, on breast cancer-derived MCF-7 cells (ER-positive and p53 wild-type) and MDA-MB-231 cells (ER-negative and p53 mutated) via TGR5 activation. We found that TGR5 is expressed in both MCF-7 and MDA-MB-231 cells and that LCA stimulates its expression in these cells. Moreover, we found that the cytotoxic activity of LCA in the breast cancer-derived cells decreased in the presence of a TGR5 antagonist. It is, therefore, conceivable that the effects of LCA on breast cancer cells is due to their response to TGR5 stimulation. In conformity with this notion, it has been reported that bile acid binding to TGR5 activates adenylyl cyclase leading to cAMP production and activation of protein kinase A (PKA), which induces further downstream signaling cascades [17, 18].

We found that LCA reduces proliferation and induces apoptosis (programed cell death) in both MCF-7 and MDA-MB-231 cells. We also found that LCA induces over-expression of the tumor suppressor p53 in MCF-7 cells, but not in MDA-MB-231 (mutant p53) cells. It has been reported that in response to intracellular and extracellular stimuli p53 may become actively involved in various key cellular processes, including gene transcription, DNA repair, cell cycle progression and apoptosis [19, 20]. LCA-activated p53 in MCF-7 cells may be related with cAMP/PKA pathway induction through TGR5 activation. Stimulation of the intracellular cAMP pathway, which leads to PKA-mediated phosphorylation of the cAMP-responsive element-binding protein (CREB), has been reported to strongly up-regulate both p53-dependent transcription activation and p53-dependent apoptosis induction [21, 22]. In addition, an important role of p53 has been described for the transcription regulation of PUMA and NOXA, two BH3-only Bcl-2 family members, that inactivate Bcl-2 and trigger the cAMP/PKA-induced apoptotic pathway [23, 24]. We suggest that these cellular reactions may occur in MCF-7 cells exposed to LCA, resulting in a reduction in proliferation and an induction of apoptosis. Also, other mechanisms that may explain the effect of LCA have been reported, such as endogenous inhibition of MDM2 and MDM4, two key negative regulators of p53 in colon cancer-derived HCT116 cells [25]. In MDA-MB-231 cells, mutant TP53 results in a non-functional p53 protein. Thus, the mechanism underlying Bcl-2 protein inactivation in MDA-MB-231 cells, which leads to p53-independent apoptosis, remains to be clarified.

Since apoptotic and survival pathways normally act in balance to ensure tissue homeostasis, we next investigated the effect of LCA on the PI3K/Akt survival pathway, which is often up-regulated in tumor cells [26]. The two breast cancer-derived cell lines included in this study also differ by a lower level of activated-Akt in LCA treated MCF-7 cells compared to that in LCA treated MDA-MB-231 cells. Our observations are consistent with a recent study that reported a correlation between mutant p53 and high Akt phosphorylation levels in breast cancer cells [27]. Moreover, it has been reported that an increase in functional p53 may negatively regulate PI3K-dependent Akt phosphorylation in MCF-7 and ovarian cancer-derived cells [28, 29]. In our work, it is conceivable that p53 activation, as well as LCA-reduced Akt phosphorylation, may explain the higher efficacy exhibited by LCA in MCF-7 cells compared to that in MDA-MB-231 cells (i.e., IC50 values for cytotoxicity and concentrations causing apoptosis).

As previously reported, cancer cells may show lipid metabolism reprogramming, specifically high lipogenic activities. Concordantly, lipogenesis pathway inhibition has been found to result in limited cancer cell proliferation and an induction of cancer cell apoptosis [3032]. The observed anti-survival effect of cerulenin, a specific FASN inhibitor, on breast cancer cells supports this hypothesis. We found that LCA reduces lipid synthesis by reducing SREBP-1c expression in the two breast cancer-derived cell lines tested. As a consequence, down-regulation of two key lipogenic enzymes, ACACA and FASN, was observed in LCA treated cells, thereby affecting the lipogenesis process. Others have shown that the cAMP/PKA pathway negatively regulates SREBP-1c through its phosphorylation at Serine 314 or via modulation of the activity of the Liver X receptor α (LXRα), a dominant activator of SREBP-1c expression. Activation of PKA represses SREBP-1c expression, thereby impairing its lipogenic effect [33, 34]. Our work also provides evidence for the notion that LCA reduces the synthesis and storage of lipids in cancer cells through the disappearance of lipid droplets after treatment. It has been reported that lipid droplets are the sites where cells store excessive lipids for their diverse biological functions, such as energy storage and membrane synthesis [35], and high lipid droplet levels in cancer cells have been found to be related with an increased aggressiveness [3638].

Over-expression/activation of Akt and ERα in breast cancer has been found to be associated with a poor prognosis and resistance to endocrine therapy [3941]. It is also recognized that Akt can directly phosphorylate ERα at Serine 167, thereby promoting estrogen-independent transcriptional activity [42]. In addition, it has recently been reported that 17β-estradiol can induce SREBP-1 expression and activation in ERα-positive breast carcinoma MCF-7 cells, while siRNA-based ERα silencing prevented 17β-estradiol-induced SCD-1 expression, an enzyme involved in the lipogenesis pathway that is under transcriptional control of SREBP-1 [43]. This link between PI3K/Akt, SREBP-1 and ERα prompted us to investigate the effect of LCA on ERα expression. We found that LCA treatment of MCF-7 cells led to a reduction in ERα expression, suggesting that LCA-reduced pAkt may trigger the decrease in ERα expression of MCF-7 cells, whose high expression is a biomarker for cell proliferation and in vivo tumor formation in hormone responsive breast cancers [44]. Taken together, we conclude that the effects of LCA on breast cancer cells may result from TGR5 stimulation. A scheme illustrating the cellular responses to LCA is depicted in Fig. 10.

Fig. 10.

Fig. 10

Model for LCA inhibited lipogenesis and apoptosis induction in breast cancer cells. Abbreviations: adenylyl cyclase (AC); adenosine triphosphate (ATP); acetyl-CoA carboxylase (ACACA); protein kinase B (PKB/Akt); cyclic adenosine monophosphate (cAMP); cAMP-response element binding protein (CREB); estrogen receptor α (ERα); fatty acid synthase (FASN); a G-protein (Gαs); protein kinase A (PKA); lithocholic acid (LCA); Liver X receptor α (LXRα); BH3-only Bcl-2 family members (PUMA and NOVA); sterol regulatory element-binding protein -1c (SREBP-1c); phosphorylated-LXRα, SREBP-1c, CREB and Akt (pLXRα, pSREBP-1c, pCREB and pAkt); G-protein coupled bile acid receptor (TGR5)

Conclusion

Here, we show that LCA reduces the synthesis and storage of lipids in breast cancer-derived MCF-7 and MDA-MB-231 cells via down-regulation of SREBP-1c target genes, resulting in a profound inhibitory effect on their survival. This observation turns LCA into a promising agent for the therapy of breast cancer, as well as for other diseases related to alterations in lipid metabolism. Pre-clinical animal studies are warranted to evaluate the in vivo anti-tumorigenic potential of LCA. Since LCA is a metabolic product of intestinal bacteria, we might also envisage the modulation of bile acid profiles in breast cancer patients using probiotics and/or prebiotics.

Acknowledgements

This study was funded by a grant from La Ligue Contre le Cancer de la Charente et de Loire Atlantique. Trang H. Luu was also funded by a research fellowship from the Vietnam Ministry of Education and Training and the Phu Tho Pharmacy College.

Compliance with ethical standards

Conflict of interest

The authors declare that there is no conflict of interest.

References

  • 1.E. Robles-Escajeda, U. Das, N.M. Ortega, K. Parra, G. Francia, J.R. Dimmock, A. Varela-Ramirez, R.J. Aguilera, A novel curcumin-like dienone induces apoptosis in triple-negative breast cancer cells. Cell. Oncol. 39, 265–277 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.R. Sharma, R. Sharma, T.P. Khaket, C. Dutta, B. Chakraborty, T.K. Mukherjee, Breast cancer metastasis: Putative therapeutic role of vascular cell adhesion molecule-1. Cell. Oncol. 40, 199–208 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.S. Beloribi-Djefaflia, S. Vasseur, F. Guillaumond, Lipid metabolic reprogramming in cancer cells. Oncogenesis 5, 1–10 (2016) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.J.A. Menendez, R. Lupu, Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis. Nat. Rev. Cancer 7, 763–777 (2007) [DOI] [PubMed] [Google Scholar]
  • 5.J.A. Menendez, R. Lupu, Fatty acid synthase regulates estrogen receptor-α signaling in breast cancer cells. Oncogenesis 6, 1–11 (2017) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.J.M. Harvey, G.M. Clark, C.K. Osborne, D.C. Allred, Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant endocrine therapy in breast cancer. J. Clin. Oncol. 17, 1474–1481 (1999) [DOI] [PubMed] [Google Scholar]
  • 7.P. Lefebvre, B. Cariou, F. Lien, F. Kuipers, B. Staels, Role of bile acids and bile acid receptors in metabolic regulation. Physiol. Rev. 89, 147–191 (2009) [DOI] [PubMed] [Google Scholar]
  • 8.P.B. Hylemon, H. Zhou, W.M. Pandak, S. Ren, G. Gil, P. Dent, Bile acids as regulatory molecules. J. Lipid. Res. 50, 1509–1520 (2009) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.B.W. Katona, S. Anant, D.F. Covey, W.F. Stenson, Characterization of enantiomeric bile acid-induced apoptosis in colon cancer cell lines. J. Biol. Chem. 284, 3354–3564 (2009) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.A.A. Goldberg, A. Beach, G.F. Davies, T.A. Harkness, A. Leblanc, V.I. Titorenko, Lithocholic bile acid selectively kills neuroblastoma cells, while sparing normal neuronal cells. Oncotarget 2, 761–782 (2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.A.A. Goldberg, V.I. Titorenko, A. Beach, J.T. Sanderson, Bile acids induce apoptosis selectively in androgen-dependent and -independent prostate cancer cells. Peer J. 1, e122 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.A.A. Goldberg, V.R. Richard, P. Kyryakov, S.D. Bourque, A. Beach, M.T. Burstein, A. Glebov, O. Koupaki, T. Boukh-Viner, C. Gregg, M. Juneau, A.M. English, D.Y. Thomas, V.I. Titorenko, Chemical genetic screen identifies lithocholic acid as an anti-aging compound that extends yeast chronological life span in a TOR-independent manner, by modulating housekeeping longevity assurance processes. Aging 2, 393–414 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.V. Sepe, B. Renga, C. Festa, C. Finamore, D. Masullo, A. Carino, S. Cipriani, E. Distrutti, S. Fiorucci, A. Zampella, Investigation on bile acid receptor regulators. Discovery of cholanoic acid derivatives with dual G-protein coupled bile acid receptor 1 (GPBAR1) antagonistic and farnesoid X receptor (FXR) modulatory activity. Steroids 105, 59–67 (2015) [DOI] [PubMed] [Google Scholar]
  • 14.A. Kawaguchi, H. Tomoda, S. Nozoe, S. Omura, S. Okuda, Mechanism of action of cerulenin on fatty acid synthetase. Effect of cerulenin on iodoacetamide-induced malonyl-CoA decarboxylase activity. J. Biochem. 92, 7–12 (1982) [DOI] [PubMed] [Google Scholar]
  • 15.H. Duboc, Y. Taché, A.F. Hofmann, The bile acid TGR5 membrane receptor: From basic research to clinical application. Dig. Liver Dis. 46, 302–312 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.H. Sato, A. Macchiarulo, C. Thomas, A. Gioiello, M. Une, A.F. Hofmann, R. Saladin, K. Schoonjans, R. Pellicciari, J. Auwerx, Novel potent and selective bile acid derivatives as TGR5 agonists: Biological screening, structure−activity relationships, and molecular modeling studies. J. Med. Chem. 51, 1831–1841 (2008) [DOI] [PubMed] [Google Scholar]
  • 17.Y. Kawamata, R. Fujii, M. Hosoya, M. Harada, H. Yoshida, M. Miwa, S. Fukusumi, Y. Habata, T. Itoh, Y. Shintani, S. Hinuma, Y. Fujisawa, M. Fujino, A G protein-coupled receptor responsive to bile acids. J. Biol. Chem. 278, 9435–9440 (2003) [DOI] [PubMed] [Google Scholar]
  • 18.T.W. Pols, L.G. Noriega, M. Nomura, J. Auwerx, K. Schoonjans, The bile acid membrane receptor TGR5 as an emerging target in metabolism and inflammation. J Hepatol. 54, 1263–1272 (2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.J.S. Fridman, S.W. Lowe, Control of apoptosis by p53. Oncogene 22, 9030–9040 (2003) [DOI] [PubMed] [Google Scholar]
  • 20.C.C. Harris, Structure and function of the p53 tumor suppressor gene: Clues for rational cancer therapeutic strategies. J Natl. Cancer Inst. 88, 1442–1455 (1996) [DOI] [PubMed] [Google Scholar]
  • 21.H.A. Giebler, I. Lemasson, J.K. Nyborg, p53 recruitment of CREB binding protein mediated through phosphorylated CREB: a novel pathway of tumor suppressor regulation. Mol. Cell Biol. 20, 4849–4858 (2000) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.T. Arnould, S. Vankoningsloo, P. Renard, A. Houbion, N. Ninane, C. Demazy, J. Remacle, M. Raes, CREB activation induced by mitochondrial dysfunction is a new signaling pathway that impairs cell proliferation. EMBO J. 21, 53–63 (2002) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.S. Cory, D.C.S. Huang, J.M. Adams, The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22, 8590–8607 (2003) [DOI] [PubMed] [Google Scholar]
  • 24.Rahimi A, Lee YY, Abdella H, Doerflinger M, Gangoda L, Srivastava R, Xiao K, Ekert PG, Puthalakath H. Role of p53 in cAMP/PKA pathway mediated apoptosis. Apoptosis 18, 1492–1499 (2013) [DOI] [PubMed]
  • 25.S.M. Vogel, M.R. Bauer, A.C. Joerger, R. Wilcken, T. Brandt, D.B. Veprintsev, T.J. Rutherford, A.R. Fersht, F.M. Boeckler, Lithocholic acid is an endogenous inhibitor of MDM4 and MDM2. Proc. Natl. Acad. Sci. USA 109, 16906–16910 (2012) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.M. Yoeli-Lerner, A. Toker, Akt/PKB signaling in cancer: A function in cell motility and invasion. Cell Cycle 5, 603–605 (2006) [DOI] [PubMed] [Google Scholar]
  • 27.B.S. Tan, K.H. Tiong, H.L. Choo, F.F. Chung, L.W. Hii, S.H. Tan, I.K. Yap, S. Pani, N.T. Khor, S.F. Wong, R. Rosli, S.K. Cheong, C.O. Leong, Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF). Cell Death Dis. 6, e1826 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.C.R. Loehberg, P.L. Strissel, R. Dittrich, R. Strick, J. Dittmer, A. Dittmer, B. Fabry, W.A. Kalender, T. Koch, D.L. Wachter, N. Groh, A. Polier, I. Brandt, L. Lotz, I. Hoffmann, F. Koppitz, S. Oeser, A. Mueller, P.A. Fasching, M.P. Lux, M.W. Beckmann, M.G. Schrauder, Akt and p53 are potential mediators of reduced mammary tumor growth by cloroquine and the mTOR inhibitor RAD001. Biochem. Pharmacol. 83, 480–488 (2012) [DOI] [PubMed] [Google Scholar]
  • 29.A. Astanehe, D. Arenillas, W.W. Wasserman, P.C. Leung, S.E. Dunn, B.R. Davies, G.B. Mills, N. Auersperg, Mechanisms underlying p53 regulation of PIK3CA transcription in ovarian surface epithelium and in ovarian cancer. J. Cell Sci. 121, 664–674 (2008) [DOI] [PubMed] [Google Scholar]
  • 30.M. Agostini, L.Y. Almeida, D.C. Bastos, R.M. Ortega, F.S. Moreira, F. Seguin, K.G. Zecchin, H.F. Raposo, H.C. Oliveira, N.D. Amoêdo, T. Salo, R.D. Coletta, E. Graner, The fatty acid synthase inhibitor orlistat reduces the growth and metastasis of orthotopic tongue oral squamous cell carcinomas. Mol. Cancer Ther. 13, 585–595 (2014) [DOI] [PubMed] [Google Scholar]
  • 31.B. Corominas-Faja, E. Cuyàs, J. Gumuzio, J. Bosch-Barrera, O. Leis, Á.G. Martin, J.A. Menendez, Chemical inhibition of acetyl-CoA carboxylase suppresses self-renewal growth of cancer stem cells. Oncotarget 5, 8306–8316 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.R. Singh, V. Yadav, S. Kumar, N. Saini, MicroRNA-195 inhibits proliferation, invasion and metastasis in breast cancer cells by targeting FASN, HMGCR, ACACA and CYP27B1. Sci. Rep. 5, 1–15 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.M. Lu, J.Y. Shyy, Sterol regulatory element-binding protein 1 is negatively modulated by PKA phosphorylation. Am. J. Physiol. Cell Physiol. 290, C1477–C1486 (2006) [DOI] [PubMed] [Google Scholar]
  • 34.T. Yamamoto, H. Shimano, N. Inoue, Y. Nakagawa, T. Matsuzaka, A. Takahashi, N. Yahagi, H. Sone, H. Suzuki, H. Toyoshima, N. Yamada, Protein kinase A suppresses sterol regulatory element-binding protein-1C expression via phosphorylation of liver X receptor in the liver. J. Biol. Chem. 282, 11687–11695 (2007) [DOI] [PubMed] [Google Scholar]
  • 35.M.A. Welte, Expanding roles for lipid droplets. Curr. Biol. 25, R470–R481 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.P.T. Bozza, J.P. Viola, Lipid droplets in inflammation and cancer. Prostaglandins Leukot. Essent. Fatty Acids 82, 243–250 (2010) [DOI] [PubMed] [Google Scholar]
  • 37.L. Tirinato, C. Liberale, S. Di Franco, P. Candeloro, A. Benfante, R. La Rocca, L. Potze, R. Marotta, R. Ruffilli, V.P. Rajamanickam, M. Malerba, F. De Angelis, A. Falqui, E. Carbone, M. Todaro, J.P. Medema, G. Stassi, E. Di Fabrizio, Lipid droplets: a new player in colorectal cancer stem cells unveiled by spectroscopic imaging. Stem Cells 33, 35–44 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.H. Abramczyk, J. Surmacki, M. Kopec, A.K. Olejnik, K. Lubecka-Pietruszewska, K. Fabianowska-Majewska, The role of lipid droplets and adipocytes in cancer. Raman imaging of cell cultures: MCF10A, MCF7, and MDA-MB-231 compared to adipocytes in cancerous human breast tissue. Analyst 140, 2224–2235 (2015) [DOI] [PubMed] [Google Scholar]
  • 39.G. Pérez-Tenorio, O. Stal, Activation of AKT/PKB in breast cancer predicts a worse outcome among endocrine treated patients. Brit. J. Cancer 86, 540–545 (2002) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.O. Stal, G. Pérez-Tenorio, L. Akerberg, B. Olsson, B. Nordenskjöld, L. Skoog, L.E. Rutqvist, Akt kinases in breast cancer and the results of adjuvant therapy. Breast Cancer Res 5, R37–R44 (2003) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.J. Bostner, E. Karlsson, M.J. Pandiyan, H. Westman, L. Skoog, T. Fornander, B. Nordenskjöld, O. Stal, Activation of Akt, mTOR, and the estrogen receptor as a signature to predict tamoxifen treatment benefit. Breast Cancer Res. Treat. 137, 397–406 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.R.A. Campbell, P. Bhat-Nakshatri, N.M. Patel, D. Constantinidou, S. Ali, H. Nakshatri, Phosphatidylinositol 3-Kinase/AKT-mediated activation of estrogen receptor α: a new model for anti-estrogen resistance. J. Biol. Chem. 276, 9817–9824 (2001) [DOI] [PubMed] [Google Scholar]
  • 43.A. Belkaid, S.R. Duguay, R.J. Ouellette, M.E. Surette, 17β-estradiol induces stearoyl-CoA desaturase-1 expression in estrogen receptor-positive breast cancer cells. BMC Cancer 15, 1–14 (2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.M.J. Duffy, Estrogen receptors: Role in breast cancer. Crit. Rev. Clin. Lab. Sci. 43, 325–347 (2006) [DOI] [PubMed] [Google Scholar]

Articles from Cellular Oncology are provided here courtesy of Springer

RESOURCES