Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Mar 19.
Published in final edited form as: J Med Virol. 2026 Feb;98(2):e70852. doi: 10.1002/jmv.70852

Vaccinia Virus Capping Enzyme Subunit D12 Is Differentially Required for Viral Replication in Different Cell Lines and Gastrointestinal Organoids

Yining Deng 1, Anil Pant 1, Zeinab R Aboezz 1, Tibor Farkas 1, Zhilong Yang 1,*
PMCID: PMC12997272  NIHMSID: NIHMS2151617  PMID: 41717905

Abstract

Vaccinia virus (VACV) encodes a heterodimeric mRNA capping enzyme consisting of the catalytic large subunit D1 and the stimulatory small subunit D12. This is different from many other nucleocytoplasmic large DNA viruses, which encode the tripartite capping activities in one protein. In vitro studies indicate that while D12 lacks catalytic activity, it enhances D1’s methyltransferase function. To define the functional requirement of D12 in VACV replication in infected cells, we generated a D12L (ORF encoding the D12 gene)-deleted virus (vΔD12) using rabbit RK13 cells stably expressing D12. While vΔD12 replication was reduced and associated with impaired viral intermediate and late gene expression and altered plaque morphology, it remained permissive in RK13 cells even without D12 complementation. We further revealed that viral early gene expression was preserved in vΔD12-infected cells, whereas viral DNA replication, intermediate and late gene expression was reduced. Interestingly, vΔD12 infection was unpermissive in monkey BS-C-1 cells, with little intermediate and late gene expression. Furthermore, vΔD12 was unpermissive in rhesus macaque gastrointestinal organoids (enteroids), but remained permissive in human enteroids. These findings reveal differential requirements of D12 for VACV replication in host-specific cells and enteroids.

Keywords: poxvirus, vaccinia virus, capping enzyme, D12, organoids, enteroids

1. Introduction

Poxviruses are large, double-stranded DNA viruses that replicate exclusively in the cytoplasm of infected cells (1). Their transcription and mRNA processing occur in the cytoplasm. Due to lacking access to host nuclear transcription and RNA processing machinery, poxviruses express their own enzymatic systems to carry out essential mRNA maturation steps, including 5′ capping, polyadenylation, and transcription termination (2). Relevant to this study, the addition of a 5′ methylguanosine (m7G) cap protects mRNAs from exonucleolytic degradation and promotes efficient translation by recruiting host cap-binding proteins (3, 4).

Poxviruses encode a heterodimeric capping enzyme (5). In vaccinia virus (VACV), the prototype poxvirus, this complex comprises the large catalytic subunit D1, which is responsible for triphosphatase, guanylyltransferase, and methyltransferase reactions, and a small stimulatory subunit D12 (5). Previous in vitro characterizations indicate that although D12 is catalytically inactive, it plays an allosteric role in enhancing the methyltransferase activity of D1 and is required for efficient transcription termination during early gene expression (6, 7). The two-subunit arrangement distinguishes poxviruses from many other nucleocytoplasmic large DNA viruses (NCLDV) such as mimivirus, baculovirus, and chlorella virus, whose capping activities are encoded in one single protein (8-11). The difference raises the question of why VACV maintains a dedicated stimulatory subunit like D12 during infection.

Here, we generated a D12L (ORF encoding D12 gene)-deleted virus (vΔD12) using a rabbit RK13 cell line that stably expresses D12. Remarkably, although D12 deletion reduced VACV replication and gene expression in RK13 cells, vΔD12 still replicated in the RK13 cells. Interestingly, while partially permissive in RK13 cells and several other cells, vΔD12 replication was severely impaired in BS-C-1 cells (an African Green monkey kidney cell line), with essentially no intermediate or late gene expression. Moreover, vD12 was not able to complete its replication in rhesus macaque gastrointestinal organoids (enteroids), but is able to replicate in human enteroids. These observations reveal that D12 is differentially required for VACV replication across different cell types and species, although the mechanisms are yet to be determined.

2. Results

2.1. Generation and validation of D12L-deleted VACV (vΔD12)

To generate a recombinant VACV with D12L gene deleted (vΔD12), we first generated a rabbit RK13 cell line stably expressing codon-optimized VACV D12 with a C-terminal 3xFlag tag (RK13-D12-3F) for complementing D12 deletion in VACV (Figure 1A). The recombinant virus vΔD12 (Figure 1B) was selected by plaque purification with the expression of GFP, whose ORF replaced the D12L locus (Figure 1C). Western blotting analysis detected D12-3F within purified virions (Figure 1D), consistent with D12 being a virion protein.

Figure 1. Generation and validation of D12L-deleted VACV, vΔD12.

Figure 1.

(A) Establishment of a RK13 cell line stably expressing codon-optimized D12 gene with a C-terminal 3xFlag tag (RK13-D12-3F). Expression of D12-3F was confirmed by Western blotting analysis using an anti-Flag antibody. (B) Schematic representation of the vΔD12 genome, in which the D12L gene was replaced with the GFP gene. (C) GFP expression of vΔD12 in RK13-D12-3F cells during plaque purification. (D) D12-3F incorporation into VACV virions. RK13 cells infected with WT-VACV or vΔD12 (MOI = 2) were harvested at 4 hpi. Western blotting analysis of cell lysates and purified virions confirmed the incorporation of D12-3F. GAPDH was used as the loading control. The images shown are representatives of results obtained from at least three independent biological replicates.

2.2. Characterization of vΔD12 replication in RK13 and RK13-D12-3F cells

We compared the replication kinetics of vΔD12 in RK13-D12-3F and WT-RK13 cells. At 24 hours post-infection (hpi), vΔD12 exhibited significantly higher replication in RK13-D12-3F cells than WT-RK13 cells, while at 48 hpi, the plaque numbers appeared similar in both cell types (Figure 2A). However, the plaque morphologies differed significantly with large and compact plaques in RK13-D12-3F cells, whereas smaller, diffuse, and scattered plaques in WT-RK13 cells based on GFP expression (Figure 2B), reflecting more efficient viral replication and cell-to-cell spread, possibly due to variations present in cells at different differentiation stages. Another possibility contributing to the similar titers is the titration method used for vΔD12, as we titrated vΔD12 by counting GFP-positive foci under fluorescence microscopy as described in the method, but not crystal violet staining. While this method ensures consistent quantification of infection despite the absence of visible plaques by crystal violet staining, it may somehow overestimate the titers, as small GFP-positive cell clusters were counted in place of well-defined plaques.

Figure 2. D12 is required for efficient VACV replication, but the absence of D12 does not completely block VACV replication in RK13 cells.

Figure 2.

(A) vΔD12 replication kinetics of in WT-RK13 and RK13-D12-3F cells (MOI = 0.01). Viral titers were measured using RK13-D12-3F cells at the indicated times post-infection. (B) vΔD12 plaque morphologies in WT-RK13 and RK13-D12-3F cells visualized by GFP expression (20× magnification). (C) Comparison of WT-VACV and vΔD12 replication kinetics in WT-RK13 and RK13-D12-3F cells (MOI = 0.01). Data are mean ± SD from at least three biological replicates; statistical significance assessed by two-way ANOVA. *, p≤0.05, ***, p≤0.001, ****, p≤0.0001, ns, non-significant.

We next compared replication of vΔD12 and WT-VACV in RK13-D12-3F and WT-RK13 cells, respectively. As shown in Figure 2C, while vΔD12 replication was attenuated in both cell lines, some level of viral replication was still observed in WT-RK13 cells at an MOI of 0.01. Together, these results demonstrate that D12 is needed for optimal VACV replication and efficient viral dissemination, but its absence still allows moderate VACV replication in RK13 cells.

2.3. Characterization of viral protein synthesis and DNA replication invΔD12-infected RK13 and RK13-D12-3F cells

Western blotting analysis using anti-VACV serum revealed that viral proteins were detectable as early as 2 hpi in vΔD12-infected RK13 cells (MOI = 1), whereas viral proteins could be detected around 8 hpi in WT-VACV-infected cells. The overall vΔD12 protein expression profile remained relatively stable between 2 and 24 hpi, in contrast to the continuous accumulation and diversification over time in WT-VACV-infected cells (Figure 3A). The viral protein expression pattern in vΔD12 infected cells slightly altered compared with WT-VACV infection, particularly the absence of high-molecular-weight species and the presence of distinct intermediate-sized bands, suggesting differences in transition from early to post-replicative protein synthesis. Given that VACV intermediate and late gene expression begin after 2 hpi, the early appearance and altered pattern of viral proteins in vΔD12 infected cells suggests that virion-packaged D12 transiently supports early gene expression and/or partial functional compensation by a cellular factor occurs in the absence of D12. To minimize the contribution of virion-associated D12, we infected cells at low MOI (0.01) and examined viral protein expression. vΔD12-infected cells displayed higher levels of early protein E3 compared to WT-VACV (Figure 3B), indicating robust early protein expression in vΔD12-infected cells. The intermediate (D13) and late (A17) proteins continued to accumulate modestly after 8 hpi, but their overall expression levels were reduced compared with WT-VACV, consistent with slower or less efficient progression into the post-replicative stage. Protein expression in vΔD12-infected RK13-D12-3F cells was higher than in WT-RK13 cells (Figure 3C). Although only low levels of viral proteins were detectable at later time points, the loss of D12 did not completely abolish viral intermediate and protein synthesis (Figure 3B, 3C). To evaluate whether the reduced replication was associated with less viral DNA synthesis, we quantified VACV genome replication by qPCR. In RK13-D12-3F cells, vΔD12 supported robust viral DNA accumulation comparable to WT-VACV, consistent with restoration of D12 expression by the complementing cell line (Figure 3D). In contrast, DNA replication in WT-RK13 and BS-C-1 cells was reduced, indicating that D12 is needed for optimal viral DNA replication, with yet to be determined mechanisms. Together, these data indicate that D12 is required for optimal viral DNA and post-replicative protein accumulation.

Figure 3. D12 is needed for optimal VACV DNA and post-replicative protein expression.

Figure 3.

(A) Protein synthesis in RK13 cells infected with WT-VACV or vΔD12 (MOI = 1). Total proteins harvested at indicated times post-infection were analyzed by Western blotting using anti-VACV and anti-Flag (D12-3F) antibodies. (B, C) Expression of early (E3), intermediate (D13), and late (A17) VACV proteins in WT-VACV or vΔD12 infected (MOI = 0.01) RK13 cells (B) and vΔD12 infected (MOI = 0.01) RK13 or RK13-D12-3F cells (C). Proteins were analyzed by Western blotting analyses, with GAPDH used as a loading control. The images presented are representatives of results from at least three independent biological replicates. (D) qPCR of VACV DNA levels in BS-C-1, RK13, or RK13-D12-3F cells (MOI = 2). Cells were collected at 4, 8, and 16 hpi, viral DNA was quantified using C11R primers and normalized to celullar genome DNA encoding 18S rRNA. The values represent fold change relative to WT-VACV. Data are mean ±SD from at least three biological replicates; statistical significance assessed by two-way ANOVA. ***, p≤0.001, ****, p≤0.0001, ns, non-significant.

2.4. Less 5’-capped RNAs in vD12-infected cells than in WT-VACV-infected cells

Given that D12 enhances the methyltransferase activity of D1 in vitro (12, 13), we next examined whether its loss affects m7G-cap accumulation in VACV-infected cells. WT-RK13 cells were infected with WT-VACV or vΔD12 and fixed at 8 hpi for immunostaining with an anti-m7G-cap antibody. As shown in Figure 4A, vΔD12-infected cells showed weaker cytoplasmic m7G fluorescence signals than that in WT-VACV-infected cells. Quantification confirmed a significant reduction in m7G-cap intensity in vΔD12-infected cells compared with WT-VACV (Figure 4B), indicating fewer total mRNAs or fewer mRNAs with intact 5’-methylated cap in the absence of D12.

Figure 4. Less 5’-capped RNAs in vD12-infected cells than in WT-VACV-infected cells.

Figure 4.

(A) Immunofluorescence of WT-RK13 cells infected with WT-VACV or vΔD12 (MOI = 2, 8 hpi) stained with anti-m7G-cap antibody (green) and DAPI (blue). Same parameters were applied when taking the images of different samples (B) Quantification of m7G-cap signal. For each condition, fluorescence intensity was measured on a per-cell basis by selecting individual cell regions (n = 50 randomly chosen cells per condition) and calculating the ratio of m7G-cap signal (green channel) to nuclear DAPI intensity. Statistical significance was determined by Student’s t-test. *, p≤0.05; ****, p≤0.0001; ns, non-significant.

2.5. D12 is differentially required in different types of cells

We next assessed vD12 permissiveness in multiple mammalian cell lines of diverse species and tissue origins. These included rabbit kidney epithelial cells (RK13), human lung epithelial cells (A549), human cervical cancer cells (HeLa), human fetal kidney-derived HEK293-FT cells (293FT), primary human foreskin fibroblasts (HFFs), baby hamster kidney fibroblasts (BHK21), and African green monkey kidney epithelial cells (BS-C-1 and Vero). We infected each of these cell lines with vΔD12 and monitored the GFP expression, which is driven by a late viral promoter, as a proxy for replication. Bright, extensive green fluorescence was observed in RK13, HeLa, A549, 293FT, and HFF cells, whereas moderate GFP signals were observed in BHK21 cells. In contrast, BS-C-1 and Vero cells exhibited no or minimal detectable GFP fluorescence (Figure 5A).

Figure 5. D12L knockout results in little VACV replication in BS-C-1 cells .

Figure 5.

(A) GFP fluorescence in indicated cell lines infected with vΔD12 (MOI = 1, 24 hpi). Images were acquired at 10× magnification. (B) VACV protein expression in BS-C-1 cells infected with WT-VACV or vΔD12 (MOI = 0.01) analyzed by Western blotting. (C) VACV protein expression in BS-C-1 cells infected with WT-VACV or vΔD12 (MOI = 3) analyzed by Western blotting. Lysates were collected at the indicated times post infection and analyzed by Western blotting using antibodies against representative early, intermediate, and late proteins. GAPDH served as a loading control. Blots shown are representative of at least three independent experiments.

Consistent with the absence of GFP signal, Western blotting analysis of BS-C-1 cells infected with vΔD12 revealed a substantial reduction in viral protein expression. At a low MOI (0.01), only very low levels of the early protein E3 were detected, while intermediate and late proteins were absent (Figure 5B). Increasing the inoculum to an MOI of 3 restored E3 protein synthesis but did not restore intermediate (D13) or late protein (A17) accumulation (Figure 5C). In particular, the late structural protein A17 did not increase at later times, and the weak A17 expression observed at early time points likely originated from virion-incorporated protein rather than de novo synthesis. Consistently, viral DNA replication was also significantly impaired in BS-C-1 cells in the absence of D12 (Figure 3D). These findings indicate that D12 is indispensable for productive VACV replication in BS-C-1 and Vero cells.

2.6. vΔD12 exhibits differential permissivenesses in human and rhesus macaque gastrointestinal organoids

To further investigate the more stringent dependence of VACV replication on D12 in non-human primate cells, we tested vΔD12 replication in more complex three-dimensional gastrointestinal (GI) organoids (enteroids) derived from rhesus macaque and human intestinal stem cells. We infected human jejunum (J2) and rhesus macaque ileum (M1I) and duodenum (NC67D) derived enteroids with vΔD12 and a VACV with no genes deleted but expressing GFP (VACV-GFP), respectively. Organoids were collected at 2 days post-infection (dpi), and viral replication was assessed by GFP expression and titration using a plaque assay.

VACV-GFP produced robust GFP signal in all enteroids, indicating efficient viral gene expression (Figure 6A). In contrast, vΔD12 exhibited strikingly reduced GFP fluorescence, if any, in both rhesus macaque enteroid lines, while green signal was still relatively strong in the human enteroid. To quantify infection efficiency, we calculated the percentage of GFP-positive enteroids among the total number of enteroids per imaging field (Figure 6B). VACV-GFP infection yielded consistently high percentages of GFP-positive enteroids. In contrast, vΔD12 infection led to a pronounced reduction (greater than 95%) in GFP-positive enteroids in the rhesus macaque enteroid lines, whereas the GFP signal in human enteroids remained comparable to that observed with WT-VACV infection. Consistent with these findings, viral titers of infected enteroids (Figure 6C) showed robust VACV-GFP production in all enteroids, while vΔD12 titers were markedly reduced in rhesus macaque enteroids. Interestingly, vΔD12 replicated efficiently in human J2 organoids with comparable titers to that of WT-VACV, presumably due to an overestimation of vΔD12 titers by counting the GFP foci as discussed in Section 2.2 for Figure 2A . Together, these results indicate the stringent requirement of D12 for VACV replication in rhesus macaque enteroids or the lack of a compensatory cellular factor in non-human primate cells.

Figure 6. vΔD12 exhibits severely impaired replication in rhesus macaque enteroids.

Figure 6.

(A) Representative fluorescence images of J2 (human jejunum), M1I (rhesus macaque ileum), and NC67D (rhesus macaque duodenum) enteroids infected with VACV-GFP or vΔD12 (10,000 PFU/well in a 24-well plate, 2 dpi). GFP expression, driven by a late viral promoter, indicates productive infection. Images were captured at 10× magnification. (B) Enteroids were harvested at 2 dpi and viral titers were measured by plaque assay using BS-C-1 cells (VACV-GFP) or RK13-D12-3F cells (vΔD12). (C) Quantification of infection rates in enteroids, calculated as the percentage of GFP-positive organoids per field. Data are mean ±SD from at least three biological replicates; statistical significance assessed by Student’s t-test. ****, p≤0.0001; ns, non-significant.

3. Discussion

Poxvirus mRNAs are capped by their own heterodimeric capping enzyme. The enzyme comprises a large subunit (D1) that performs the catalytic reactions and the small subunit (D12) allosterically enhances D1’s methyltransferase activity (12). Previous in vitro studies have shown that D12 is required for optimal methyltransferase activity, acting as a stimulatory subunit that enhances the catalytic activity of D1, but lacking intrinsic catalytic capability in cap formation (13). Conceivably, in cells, D12 absence can decrease the methylation efficiency of VACV mRNA m7G cap, that can contribute to a less efficient RNA translation during infection, which can partially contribute to our finding that m7G-cap staining intensities are lower in vD12-infected cells than in WT-VACV-infected cells (Figure 5). Another mechanism contributing to the reduced m7G signal may be decreased viral RNA synthesis due to the reduced viral DNA replication (Figure 3D), as well as the decreased intermediate and late protein expression.

Our findings reveal that VACV with D12 knockout is still permissive in several cell types. The replication of VACV in the absence of D12 raises the possibility that VACV mRNA translation may not require a complete m7G cap, which is consistent with our previous finding that VACV mRNA can be translated in a cap-independent manner (14, 15). Another possibility is that the D12 function may be partially compensated by a host protein. D12 may also play a role in supporting appropriate transition of VACV temporal cascade of early, intermediate, and late gene expression, which is supported by the altered protein expression pattern in vΔD12-infected cells. While viral early proteins accumulate rapidly and reach detectable levels earlier in vΔD12- than in WT-VACV-infected cells, the intermediate and late protein levels are reduced (Figures 3 and 5). This pattern is consistent with a scenario in which virion-packaged D12 transiently supports early gene expression, but the absence of newly synthesized D12 limits the subsequent amplification of intermediate and late gene expression. The missing high-molecular-weight species likely correspond to structural proteins expressed from late promoters. Overall, these findings suggest that D12 contributes to coordinating the transition of the viral gene-expression program.

Interestingly, our study extends these findings by showing that the replication defect is cell-type and possibly species-specific. The loss of permissiveness in BS-C-1 cells, where vΔD12 fails to synthesize detectable intermediate or late proteins even at high MOI, suggests that some cells lack host factors capable of compensating for D12 function. The differential requirements of D12 among cell types are particularly interesting because VACV typically displays broad cell tropism (16). The inability of vΔD12 to replicate in BS-C-1 and Vero cells, in contrast to its permissiveness in other cell types, suggests that specific cellular factors such as translation initiation machinery, RNA-binding proteins, or innate immune sensors may modulate the requirement for D12. Importantly, the cell-type specific differences were recapitulated in a more complex culture system, intestinal stem cell-derived enteroids. Here, we demonstrated that while VACV replicates efficiently in both human and rhesus macaque enteroids, vΔD12 showed a marked replication defect in rhesus macaque-derived enteroids but retained replication capacity in human-derived enteroids. These findings suggest possible species-specific restriction of vΔD12 in non-human primates or the lack of a compensatory cellular protein that was lost during the evolution of non-human primates. However, whether the species-specific phenotype applies to all non-human primate species, including both New and Old World primates, needs additional investigation.

In summary, our study indicates that the small subunit of the VACV capping enzyme, D12, is differentially required for efficient VACV replication in different cell types and possibly different species. Further studies are needed to dissect the underlying mechanisms and possible host species evolutionary differences.

4. Materials and Methods

4.1. Cell culture and stable cell line construction

RK13 (ATCC CCL-37), A549 (ATCC CCL-185), BS-C-1 (ATCC CCL-26), HeLa cells (ATCC CCL-2), HEK293-FT (293FT, ATCC R70007), human foreskin fibroblasts (HFFs, kindly provided by Dr. Nicholas Wallace, Kansas State University), Vero (ATCC CCL-81) and BHK-21 cells (ATCC C-13) were cultured in Dulbecco’s minimal essential medium (DMEM) supplemented with 10 % fetal bovine serum (FBS), 2 mM glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin. Cells were grown in an incubator at 37°C with 5% CO2.

To establish an RK13 cell line stably expressing VACV D12 (RK13-D12-3F cell line), a sequence coding a codon-optimized D12 with a C-terminal 3×Flag tag was cloned into pcDNA3.1-Hygro (−) plasmid, generating the recombinant construct pcDNA3.1-Hygro (−)-D12L-3×Flag. RK13 cells were then transfected with this recombinant plasmid using jetPRIME reagent (Polyplus, 101000027) according to manufacturer’s instructions. At 24 hours post-transfection, cells were cultured in complete DMEM supplemented with 50 μg/ml Hygromycin B (Thermo Fisher, 10687010), and subjected to at least three passages to enrich for stably transfected populations. Subsequently, resistant cells were seeded into 96-well plates at a density of one cell per well to isolate monoclonal populations under 50 μg/ml Hygromycin B selection. Stable expression of D12-3F in these selected clones was confirmed through Western blotting using an anti-Flag antibody.

4.2. VACV preparation and purification

Virus preparation and purification were performed as previously described (17). VACV-ΔD12-GFP (vΔD12) was derived from the Western Reserve (WR) strain of VACV (ATCC VR-1354) by homologous recombination using green fluorescent reporter genes (GFP) for plaque selection. Around 500 bp of genomic sequences flanking the D12L gene locus were amplified and engineered to flank a GFP open reading frame (ORF), which was placed under the transcriptional control of VACV P11 promoter. The deletion of the D12L gene was confirmed by PCR amplification followed by sequencing analysis. VACV-GFP contains WT-D12L gene and a GFP gene under a VACV late promoter.

4.3. VACV infection and plaque assay

Virus was sonicated and diluted according to the desired multiplicity of infection (MOI) using DMEM containing 2.5% FBS, 2mM glutamine, 100U/ml penicillin and 100 μg/ml streptomycin. Medium containing viruses was added to the cultured cells and incubated at 37°C for 1 h and replaced with fresh medium. Low MOI infections (0.01) were used to minimize the effects of virion-associated D12, whereas higher MOIs (1-3) were used to enhance detection of early viral proteins. For plaque assay, virus-containing samples were 10-fold serially diluted and added to BS-C-1 cells, WT-RK13 cells or RK13-D12-3F cells in 12-well plates. After 1 h of incubation at 37°C, the medium was replaced with fresh medium containing 0.5% methylcellulose. Plaques were visualized by staining the infected cells in 12-well plates with 0.1% (wt/vol) crystal violet in 20% ethanol for 5 min. Because vΔD12 failed to form distinct large plaques even in RK13-D12-3F cells by crystal violet staining, vΔD12 titers were determined by counting GFP-positive foci under fluorescence microscopy. This approach ensured consistent quantification of infection despite the absence of visible plaques by crystal violet staining, but may overestimate vΔD12 titers, as small GFP-positive clusters were counted in place of well-defined plaques.

4.4. Antibodies and Western blotting analysis

Flag antibody was purchased from Sigma-Aldrich (F3165). VACV, VACV E3, and VACV D13 antibodies were kindly provided by Dr. Yan Xiang, University of Texas HSC at San Antonio (18). VACV A17 antibody was kindly provided by Dr. Bernard Moss (NIH) (19). GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibodies conjugated to HRP were purchased from Santa Cruz Biotechnology (sc-365062). HRP linked rabbit and mouse secondary antibodies were purchased from Cell Signaling Technology. Western blotting was performed as described previously using specific antibodies as indicated in the figures (14).

4.5. Real time quantitative PCR (RT-qPCR)

Cells were washed with Phosphate Buffered Saline (PBS, pH 7.4) and total DNA was extracted using the E.Z.N.A. Blood DNA Kit (Omega Bio-tek, D3392-02) according to the manufacturer’s instructions. Equal amounts of DNA from each sample were subjected to quantitative PCR using the CFX96 Real-Time PCR Detection System (Bio-Rad) with All-in-One 2 qPCR mix (GeneCopoeia, QP001). The VACV C11R gene was used to quantify viral genomic DNA, and cellular genomic sequence corresponding to 18S rRNA encoding gene served as an internal control for normalization across samples. The primer sequences were as follows: C11R (5’ AAACACACACTGAGAAACAGCATAAA 3’; 5’ ACTATCGGCGAATGATCTGATTATC 3’); 18S rRNA (5′ CGATGCTCTTAGCTGAGTGT 3′; 5′ GGTCCAAGAATTTCACCTCT 3′).

4.6. Organoid culture and infection

The intestinal stem cell derived human enteroids (J2) used in this study were obtained from Dr. Mary Estes (Baylor College of Medicine) while the rhesus macaque ileum (M1I) and duodenum (NC67D) derived enteroids were developed in our laboratories. Enteroid lines were stored in liquid nitrogen in Recovery Cell Culture Freezing Medium (Gibco). Recovered enteroids were grown in 3D Matrigel domes and passaged every 7-10 days according to previously established protocols (20, 21). For viral infection, 20 μL Matrigel domes containing approximately 500 enteroids in 24 well tissue culture plates at 3-7 days after replating were infected by adding 10,000 PFU of the indicated VACV strains directly into the medium overlaying the Matrigel domes. Following a 6-hour adsorption period, the medium was replaced with fresh complete medium with growth factors (CMGF+) after washing with PBS. At 2 days post-infection (dpi), organoids were imaged for GFP expression and harvested for virus titration. WT-VACV-infected organoid lysates were titrated on BS-C-1 cells, while vΔD12-infected samples were quantified on RK13-D12-3F cells.

4.7. Statistical analysis

Data are presented as the mean of a minimum of three biological replicates, unless otherwise specified. Error bars represent the standard deviation observed across the experimental replicates. A Student’s t-test was conducted to assess any significant differences between the two means, and a two-way ANOVA was used to compare significant differences between multiple groups. The following symbols were used to indicate statistical significance: ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001, ****, P ≤ 0.0001. Figures were prepared using GraphPad 10.2.3.

Acknowledgement

We thank Dr. Bernard Moss, Dr. Yan Xiang, Dr. Nicholas Wallace for providing other materials.The human J2 enteroid line was obtained from Dr. Mary Estes.

Funding

Research reported in this publication was supported, in part, by National Institute of Allergy and Infectious Diseases of the National Institutes of Health under award number R01 AI143709 to ZY and R01 AI139137 to TF. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Conflict of interest statement

No conflict of interest declared.

Data Availability Statement

The data that support the findings of this study are available upon reasonable request.

References

  • 1.Moss B. 2013. Poxvirus DNA replication. Cold Spring Harb Perspect Biol 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Broyles SS, Moss B. 1987. Sedimentation of an RNA polymerase complex from vaccinia virus that specifically initiates and terminates transcription. Mol Cell Biol 7:7–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Niles EG, Christen L. 1993. Identification of the vaccinia virus mRNA guanyltransferase active site lysine. J Biol Chem 268:24986–9. [PubMed] [Google Scholar]
  • 4.Furuichi Y, Shatkin AJ. 2000. Viral and cellular mRNA capping: past and prospects. Adv Virus Res 55:135–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cong P, Shuman S. 1992. Methyltransferase and subunit association domains of vaccinia virus mRNA capping enzyme. J Biol Chem 267:16424–9. [PubMed] [Google Scholar]
  • 6.Mao X, Shuman S. 1994. Intrinsic RNA (guanine-7) methyltransferase activity of the vaccinia virus capping enzyme D1 subunit is stimulated by the D12 subunit. Identification of amino acid residues in the D1 protein required for subunit association and methyl group transfer. J Biol Chem 269:24472–9. [PubMed] [Google Scholar]
  • 7.Luo Y, Mao X, Deng L, Cong P, Shuman S. 1995. The D1 and D12 subunits are both essential for the transcription termination factor activity of vaccinia virus capping enzyme. J Virol 69:3852–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Benarroch D, Smith P, Shuman S. 2008. Characterization of a trifunctional mimivirus mRNA capping enzyme and crystal structure of the RNA triphosphatase domain. Structure 16:501–12. [DOI] [PubMed] [Google Scholar]
  • 9.Gross CH, Shuman S. 1998. RNA 5'-triphosphatase, nucleoside triphosphatase, and guanylyltransferase activities of baculovirus LEF-4 protein. J Virol 72:10020–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Håkansson K, Doherty AJ, Shuman S, Wigley DB. 1997. X-ray crystallography reveals a large conformational change during guanyl transfer by mRNA capping enzymes. Cell 89:545–53. [DOI] [PubMed] [Google Scholar]
  • 11.Gong C, Shuman S. 2002. Chlorella virus RNA triphosphatase. Mutational analysis and mechanism of inhibition by tripolyphosphate. J Biol Chem 277:15317–24. [DOI] [PubMed] [Google Scholar]
  • 12.Higman MA, Bourgeois N, Niles EG. 1992. The vaccinia virus mRNA (guanine-N7-)-methyltransferase requires both subunits of the mRNA capping enzyme for activity. J Biol Chem 267:16430–7. [PubMed] [Google Scholar]
  • 13.De la Peña M, Kyrieleis OJ, Cusack S. 2007. Structural insights into the mechanism and evolution of the vaccinia virus mRNA cap N7 methyl-transferase. Embo j 26:4913–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dhungel P, Cao S, Yang Z. 2017. The 5'-poly(A) leader of poxvirus mRNA confers a translational advantage that can be achieved in cells with impaired cap-dependent translation. PLoS Pathog 13:e1006602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cantu F, Cao S, Hernandez C, Dhungel P, Spradlin J, Yang Z. 2020. Poxvirus-encoded decapping enzymes promote selective translation of viral mRNAs. PLoS Pathog 16:e1008926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.McFadden G. 2005. Poxvirus tropism. Nat Rev Microbiol 3:201–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Earl PL, Cooper N, Wyatt LS, Moss B, Carroll MW. 2001. Preparation of cell cultures and vaccinia virus stocks. Curr Protoc Mol Biol Chapter 16:Unit16.16. [DOI] [PubMed] [Google Scholar]
  • 18.Meng X, Xiang Y. 2012. Generation and characterization of monoclonal antibodies specific for vaccinia virus. Methods Mol Biol 890:219–32. [DOI] [PubMed] [Google Scholar]
  • 19.Wolffe EJ, Moore DM, Peters PJ, Moss B. 1996. Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis. J Virol 70:2797–808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ettayebi K, Kaur G, Patil K, Dave J, Ayyar BV, Tenge VR, Neill FH, Zeng XL, Speer AL, Di Rienzi SC, Britton RA, Blutt SE, Crawford SE, Ramani S, Atmar RL, Estes MK. 2024. Insights into human norovirus cultivation in human intestinal enteroids. mSphere 9:e0044824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ettayebi K, Crawford SE, Murakami K, Broughman JR, Karandikar U, Tenge VR, Neill FH, Blutt SE, Zeng XL, Qu L, Kou B, Opekun AR, Burrin D, Graham DY, Ramani S, Atmar RL, Estes MK. 2016. Replication of human noroviruses in stem cell-derived human enteroids. Science 353:1387–1393. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available upon reasonable request.

RESOURCES