MiR-21-5p regulates biological malignancy in esophageal squamous cell carcinoma via targeting CNTFR

Abstract

Esophageal squamous cell carcinoma (ESCA) represents a prevalent, highly aggressive malignancy of the digestive tract. Notably, both its proliferation and metastatic dissemination are facilitated by the tumor microenvironment (TME). One intriguing option for non-invasive biomarkers has been found to be miRNA. MicroRNA-21-5P is an essential regulator of biological processes such as the growth, migration, invasion, and metastasis of some malignancies. The prediction software successfully identified CNTFR as the putative target gene for miR-21-5P. To confirm this interaction, a luciferase reporter gene test was conducted to assess the binding of miR-21-5P to CNTFR. By using quantitative polymerase chain reaction (RT-qPCR), in comparison to normally adjacent tissues, the tumor tissues of patients with ESCA exhibited elevated relative expression amounts of miR-21-5P and decreased relative expression amounts of CNTFR. Furthermore, miR-21-5P mimics were able to drastically lower the CNTFR gene level, as demonstrated by RT-qPCR and western blot. On the other hand, esophageal cancer cells' expression of CNTFR can be markedly elevated by miR-21-5P inhibitors. Within the context of this research, the association between miR-21-5p and CNTFR was established through bioinformatics, luciferase reporter gene, CCK-8, EdU, transwell, flow cytometry, qRT-PCR, and WB analysis. In summary, our work identifies the miR-21-5p suppresses CNTFR expression to promote ESCA cell proliferation, invasion, and migration; these findings highlight the miR-21-5p/CNTFR axis as a promising candidate for non-invasive diagnostic biomarker development and targeted therapeutic strategy optimization in ESCA.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12876-026-04675-y.

Introduction

Esophageal carcinoma (EC) is well recognized as the prevailing invasive malignant tumor affecting the digestive tract, which can be categorized into three distinct pathological types: squamous cell carcinoma, adenocarcinoma and adenosquamous carcinoma [1]. Although a notable increase in the five-year overall survival rate of esophageal cancer has been founded (by roughly 4% compared to 30 years ago), it is still at a low level due to limited advancements in tumor treatment [2, 3]. Nowadays, surgical treatment alone has not proven to be effective as the five-year survival rate range from 10 to 35%, resulting in a severe risk to people's lives and health [4, 5]. Accordingly, unravelling the relevant molecular mechanisms and exploring new therapeutic approaches exerts a vital influence on optimizing the prognosis of patients with this disease.

MicroRNA(miRNA) is the highly conserved molecule ranging from 18 to 25 nucleotides in length, which regulating of gene expression through post-transcriptional mechanisms [6]. Numerous miRNA molecules have been shown to be aberrantly expressed in a variety of illnesses since the first miRNA molecule was discovered [7]. They play a key role in controlling physiological and pathological bodily functions, including immune evasion, tumor growth, cell metabolism, and antiviral invasion [8, 9]. Recent studies have demonstrated that microRNAs (miRNAs) play critical regulatory roles in multiple cellular signaling pathways and exert significant influence on tumor cell proliferation, survival, and metastasis. Owing to their tissue specificity, relative stability, and detectability in tissues and body fluids. Across diverse malignant disorders, miRNAs have risen to prominence as exceptionally promising biomarkers for the purposes of diagnosis, prognosis stratification, and treatment response prediction [10]. miR-21-5p has emerged as a conserved oncogenic microRNA with profound clinical relevance across multiple malignancies, In non-small cell lung cancer (NSCLC), high miR-21-5p expression is consistently associated with poor prognosis [11]. Beyond lung cancer, miR-21-5p mediates immune evasion in microsatellite-stable colorectal cancer by suppressing PTEN/PI3K/AKT signaling, leading to an immune-excluded tumor microenvironment and resistance to immune checkpoint blockade [12]. These cross-cancer findings establish miR-21-5p as a universal therapeutic target and prognostic marker, underscoring the importance of investigating its function in esophageal cancer. With the discovery of differentially expressed miRNAs in tumors and the hunt for novel anti-tumor therapeutic targets, CNTFR might be the miR-21-5P target gene according to the output of precise prediction software (TargetScan, miRwalk). Previous studies have provided evidence indicating that the receptor CNTFR is associated with the ciliary neurotrophic factor (CNTF), resulting in facilitating the formation of a receptor complex involving glycoprotein 130 and Lirβ (leukemia inhibitory factor receptor), which assumes a triangular configuration. Tyrosine phosphorylation resulting from the complexation will provide signaling molecules containing SH2 with a place to bind. The activation of many signaling pathways, including the Jak-STAT pathway, the Erk-MAPK route, and the PI3K-Akt-mTOR circuit, has been observed in response to the aforementioned stimuli [13–16]. ESCA is characterized by frequent genetic alterations (e.g., TP53 mutations, copy number alterations) and hyperactivated JAK-STAT/PI3K-Akt pathways in early carcinogenesis, which are precisely the downstream effectors of CNTFR signaling. This molecular overlap strongly suggests that CNTFR may contribute to ESCA progression. Currently, the investigation of CNTFR has been conducted in the context of lung cancer, melanoma, and various other malignant tumors. In lung adenocarcinoma (LUAD), the CLCF1-CNTFR signaling axis is essential for tumor growth: cancer-associated fibroblasts (CAFs) secrete CLCF1, which binds to CNTFR on tumor cells to promote neoplastic progression. Similarly, there are studies that have proved that CNTFR is carcinogenic in melanoma cell lines, and CNTFR silencing attenuates macrophage recruitment and M2-type polarization [17–21], its expression pattern, biological function, and clinical significance in ESCA remain largely unexplored.

Herein, we adopted cell proliferation experiments, Transwell assays and flow cytometric analysis to assess how miR-21-5p and CNTFR modulate the migratory, proliferative, apoptotic and invasive potentials of ESCA cells. The expression correlation between miR-21-5p and CNTFR was verified via luciferase reporter gene assays. Meanwhile, Western blotting and RT-qPCR were conducted to gauge the link between CNTFR and miR-21-5p expression profiles. Our core aims were to discover new targets for anticancer therapy and to explore the functional mechanism of the miR-21-5p/CNTFR pathway in the regulation of ESCA cell behaviors.

Materials and methods

Data & sample collection and miRNA prediction

Clinical information connected to the RNA sequencing data collection can be obtained from The Cancer Genome Atlas (TCGA, https://portal.gdc.cancer.gov; visit April 19, 2022). After classifying the data and downloading the ESCA HTSeq-Counts and HTSeq-FPKM files, 161 tumor specimens and 11 para-cancer specimens were obtained. In our bioinformatics analysis of differentially expressed gene (DGE) between ESCA tissues and adjacent normal tissues, p-value adjustment for multiple testing was strictly applied to control for false positive findings. Differentially expressed genes were identified using DESeq2 with Benjamini–Hochberg adjustment for multiple testing; significance was defined as ||log2FC|> 1 and p < 0.05.

From January 2017 to December 2019, 30 frozen tissue samples including primary ESCA as well as matched normal esophageal or tumor-adjacent tissues were obtained from the Department of Thoracic Surgery at the Affiliated Tumor Hospital of Xinjiang Medical University. These samples were only utilized to measure CNTFR and miR-21-5p gene expression and gathered and kept at −80˚C for storage.

The potential microRNA combination was predicted using TargetScan (https://www.targetscan.org/vert_80/) and miRWalk (http://mirwalk.umm.uni-heidelberg.de/). As previously mentioned, the following studies only included projected miRNA that are normally present in more than two databases.

UALCAN and functional enrichment analysis

The online UALCAN (http://ualcan.path.uab.edu/analysis-prot.html) is a robust platform that offers a complete means of assessing transcriptome data derived from the Cancer Genome Atlas (TCGA). Utilizing the gene symbol "CNTFR" in the "TCGA gene analysis" segment, we chose "esophageal cancer" and CNTFR expression to determine the correlation with clinical practice.

The GEPIA2 web database (http://gepia2.cancer-pku.cn/#index) provided the top 100 genes that are comparable to CNTFR. The interactive network of CNTFR was built using the online databases STRING (https://cn.string-db.org/) and GeneMANIA (http://www.genemania.org). To analyze pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO), three internet databases were gathered. In this study the top 20 were ordered according to R-value (P < 0.05) in increasing order.

Cell culture and transfection

Eca-109 and KYSE-150 are human ESCA cell lines which supplied by the National Laboratory of Xinjiang Medical University in China (Urumqi, China). The experimental medium comprised RPMI-1640 with an added 10% fetal bovine serum (FBS) concentration (Gibco; Thermo Fisher Scientific, Inc., USA). The temperature was regulated to 37 °C with 5% CO2. A 10% FBS solution, 1% GlutaMAX supplement, and 1% penicillin and streptomycin were added to Gibco's Dulbecco modified Eagle medium (DMEM; Thermo Fisher Scientific, Inc.) in which 293 T cells were cultured.

We obtained Si-CNTFR, miR-21-5p-5P mimics (overexpressed), miR-21-5p-5P inhibitor (down-regulated), and negative control (NC, comprising mimic NC and inhibitor NC) from Shanghai Jima Co., LTD. (Shanghai, China). Transfecting ECA-109 and KYSE-150 cells required Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). Twenty-four hours before transfection, a 6-well plate was seeded with 2.5 × 10⁵ cells. In addition to transfection reagents, the cells were supplemented with Si-CNTFR, miR-21-5p inhibitory compound NC, mimics, and inhibitors. Following a treatment duration of 48 h, the cells were extracted for analysis. Listed below are siRNA sequences of Si- CNTFR (Table 1).

Table 1.

Sequence of CNTFR plasmid

	sense(5'−3')	antisense(5'−3')
Si-CNTFR1	CCUUUGACGAGUUCACCAUTT	AUGGUGAACUCGUCAAAGGTT
Si-CNTFR2	CCACCAUCAAGUACAAGGUTT	ACCUUGUACUUGAUGGUGGTT
Si-CNTFR3	GACAAUGAGAUUGGGACAUTT	AUGUCCCAAUCUCAUUGUCTT
Si-CNTFR4	CCGGGAAGGAGUACAUUAUTT	AUAAUGUACUCCUUCCCGGTT

Double luciferase reporter gene assay

The CNTFR eukaryotic expression vector was designed and constructed. The identification of target genes was accomplished by the utilization of Targetscan, a computational tool accessible at the following URL: https://www.targetscan.org/vert80/, and miR-21-5p target genes were predicted using CNTFR forecast. Consequently, the CNTFR vector was created. Using a PCR apparatus and mature miR-21-5p (MI0000077), the 3' untranslated region (3'UTR) of CNTFR mRNA was amplified (QuantStudioTM Design & Analysis SC Software; Thermo Fisher Scientific, Inc.). To prevent termination signals from developing, the region denoted as "ataagct" was chosen inside the mutant expression vector template and subsequently amplified. The amplification primers used for this purpose are described in Table 2. After being transfected with the pSICHECK2 luciferase plasmid, the aforementioned templates were employed in the double luciferase reporter gene test.

Table 2.

The primer sequence of the genes

Gene	Primer sequence
GAPDH	Forward: 5′-tgacttcaacagcgacaccca-3′ Reverse: 5′-caccctgttgctgtagccaaa-3′
CNTFR	Forward:5′-aatgagattgggacatggagtg-3′ Reverse: 5′-gtcacagatcttcgtggtagg-3′
miR-21-5p	Forward: 5′-TAGCTTATCAGACTGATGTTGA-3′ Reverse: 5′-TAGCTTATCAGACTGATGTTGA-3′
U6	Forward: 5′-GGAACGATACAGAGAGATTAGC-3′ Reverse: 5′-TGGAACGCTTCACGAATTTGC-3′
LT-h-CNTFR-3UTR-wt-F	CGAGCAGTAATTCTAGGCGATCGCTCGAGATTTGTGGAGACCCCGGCGG
LT-h-CNTFR-3UTR-wt-R	AAAGATATTTTATTGCGGCCAGCGGCCGCACGTTTAATGAGAACCGCCC

Amplification of the CNTFR gene's 3'UTR fragment was followed by transfection and cloning into the psiCHECK2 luciferase miRNA expression reporter vector. Prior to transfection, 293 T cells and target plasmids were divided into 96-well plates, resulting in a cell density of 50%–70%. Solution A involved thoroughly mixed 10ul of DMEM with 0.16ug of the h-CNTFR-3UTR target plasmid and 5 pmol of hsa-miR-21-5p (N.C) at room temperature. Solution B involved transfecting DMEM with Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 5 min in compliance with the manufacturer's guidelines. Mix solution A and solution B well and leave them at room temperature for 20 min. The double luciferase reporter assay technique was used to measure luciferase activity 48 h after transfection.

Cell proliferation, invasion and migration assay

The Cell Counting Kit 8 (CCK8) was used to ascertain the potential of proliferation. Three duplicates of the 96-well plate were set up and 1000 cells were injected into each well for proliferation experiment. At the enzyme marker, the measurement of absorbance at a wavelength of 450 nm was conducted at four different time points: 0, 12, 24, and 48 h after the inoculation process. For the Edu experiment, a total of 2 × 10⁵ cells were cultivated in each well and incubated for 48 h. Subsequently, they were treated with EdU solution and fixed with a 4% paraformaldehyde solution for 30 min. Cell proliferation was examined using a fluorescent microscope after nucleus staining with DAPI.

The cell invasion was assessed with a matrix gel coating (Corning, Inc., USA). A total of 2.5 × 10⁵ cells were introduced into the upper chamber for the inoculation after resuspension in serum-free media. Twenty percent of the medium in the bottom compartment contains serum. The invading cells were dyed and pictures were captured with a microscope following a period of 24 h of incubation. For every chamber, three different holes were examined. Utilizing a matrix gel-filled chamber, cell invasion was quantified. Resuspension of 2.5 × 10⁵ cells in serum-free media was followed by the same procedures as before.

Quantitative real-time PCR and Western blot

By utilizing the TRIzol reagent, total RNA was isolated from ESCA tissues, and further assessed the quality of the extracted RNA to ensure suitability for downstream assays. Using the PrimeScript RT reagent Kit(RR047A, TaKaRa Bio Inc.), we reverse-transcribed the purified total RNA into first-strand cDNA. RT-qPCR reactions were carried out with the aid of SYBR Premix and TB Green™ Premix Ex Taq™ Ⅱ (Tli RNaseH Plus, RR820A, TaKaRa Bio Inc.). All experimental manipulations were implemented following the standardized instructions provided by the reagent manufacturers. For miR-21-5p and CNTFR, the U6 and GAPDH genes were utilized as endogenous reference controls respectively. To estimate the relative levels of gene expression, we utilized the 2^−ΔΔCT technique (Table 2 lists certain PCR sequences).

Following transfection, each group's 48 h ESCA cells were grown, and the total protein was collected. Take the same protein sample (60 µg/well) for electrophoresis following the BCA-based determination of protein content. 5% skim milk powder was used to seal the protein after being transferred to the NC membrane using a wet transfer technique. The primary antibodies, CNTFR (1:1000) and GAPDH (1:1000) from Proteintech were incubated with the protein for an entire night. As the primary antibody was removed, the secondary antibody was added (1: 5000). As the secondary antibody was removed, the color of the chemiluminescent reagent (ECL) developed.

Flow cytometry

The medium from the 6-well plate was transferred to the centrifuge tube, and pancreatic enzyme without EDTA was introduced. The preceding medium was introduced and rinsed with ice-cold PBS. Following the cell count, centrifugation was conducted. Resuspend the cells in a solution containing 1 × Annexin V. The suspension was supplemented with 5 µl of Annexin FITC dye and gently agitated. Then it was incubated at a temperature range of 2–8 °C in the absence of light for 15 min. Following the addition of the PI dye solution, the sample should be incubated at a temperature range of 2–8 °C while avoiding exposure to light for 2–5 min. Subsequently, the sample can be tested using a machine.

Data analysis

All data were processed and statistically analyzed using Excel and SPSS software, Version 27.0 (SPSS Inc., Chicago, IL, USA). A two-tailed P-value of less than 0.05 was considered indicative of a statistically significant difference.

Result

For corresponding studies, we gathered a large number of patients with ESCA and a normal control group. Significantly higher level of miRNA-21 expression was found in the tissues and cell lines of ESCA patients. Further analysis was performed to predict potential downstream mRNAs. Differentially expressed mRNAs (DEq mRNA) specific to esophageal cancer were screened out by means of R software (Fig. 1A). The distinct genes were analyzed using the Xiantao online tool to create a volcano map, and the websites miRWalk and Targetscan were utilized to identify and filter potential miR-21-5p target genes. Combining the genetic variations of the intersection with the 21 targeted gene, the final selection was discussed along with the gene expression levels of TNS1, XKR4, CNTFR, SOX5, ROBO2, and BNC2 in esophageal cancer, as well as the published literature (Fig. 1B). By constructing miR-21-5p overexpression and knockdown models in ESCA cell lines ECA109 and KYSE150, RT-qPCR was employed to quantify the expression profile of CNTFR. Subsequent data analysis demonstrated a statistically significant negative correlation between miR-21-5p and CNTFR expression levels, implying that a potential regulatory interaction may exist between these two molecules. Using the GEPIA database, the expression levels of CNTFR in various cancer types were examined.

Fig. 1.

Concerning CNTFR screening and its expression in the clinical manifestations of esophageal cancer. A Differentially expressed genes in esophageal carcinoma (Deq); B Intersection of esophageal cancer differential genes and miRNA targeting databases; C CNTFR expression in pan-cancers; D Expression of CNTFR; E CNTFR expression in subtypes of esophageal cancer; F Expression pf CNTFR in esophageal cancer at the central location of the tumor

Genetic characterization of CNTFR in cancer

CNTFR was considerably under expressed in ESCA (P < 0.05) and significantly differently expressed in all malignancies, according to the GEPIA database (Fig. 1C). In comparison to normal samples, the tumor tissues of TCGA ESCA patients had a decreased expression level of CNTFR (P < 0.001, Fig. 1D). The substantial connection between tumor subtypes and CNTFR expression was also examined using the UALCAN database (Fig. 1E). Furthermore, the position of the tumor center in ESCA was connected with the expression of CNTFR (Fig. 1F). These results imply that decreased expression of CNTFR may serve as a key regulator involved in the initiation and progression of esophageal cancer.

To evaluate the diagnostic efficacy of CNTFR in ESCA, a ROC curve analysis was performed. As depicted in Fig. 2A, ROC curve modeling demonstrated that CNTFR possessed moderate diagnostic value for ESCA (AUC = 0.745, CI: 0.584–0.905). To further elucidate the mechanistic relevance of CNTFR expression and its prognostic significance in ESCA, we conducted overall survival (OS) analysis of CNTFR in esophageal cancer utilizing the GEPIA database. As illustrated in Fig. 2B, decreased CNTFR expression was significantly correlated with unfavorable OS in ESCA patients (HR = 0.51, 95% CI: 0.31–0.85, p = 0.01). This observation validated that downregulated CNTFR expression was positively associated with poor prognostic outcomes in ESCA. Furthermore, we constructed a nomogram integrating CNTFR expression and other independent clinical risk factors to establish a quantitative tool for predicting survival outcomes in ESCA patients. As shown in Fig. 2C, a representative ESCA patient with low CNTFR expression (15 points), M0 stage (0 points), male sex (38 points), T3 stage (20 points), N1 stage (55 points) and age ≤ 60 years (0 points) attained a total score of 128 points, corresponding to 1, 3and 5 year survival rates of 78.0%, 30% and < 10%, respectively. Collectively, these findings indicated that CNTFR could serve as a valuable biomarker for distinguishing esophageal cancer from adjacent normal tissues.

Fig. 2.

Diagnostic ability and survival prediction of CNTFR in esophageal cancer. A In patients with ESCA, the ROC diagnosis of CNTFR; B Overall survival of CNTFR in esophageal cancer; C Prognostic line graph associated with reduced CNTFR expression in ESCA patients

To further understand CNTFR's role in cancer, the creation of a protein–protein interaction (PPI) network of CNTFR was accomplished with the assistance of a STRING database. IL6, CNTF, CTF1, CLCF1, etc. are listed in Fig. 3A. Between CNTFR and related genes, Gene MANIA built a network of gene–gene interactions. The findings demonstrated a tight relationship between CNTFR and the twenty most often changed genes (Fig. 3B). The GEPIA2 dataset yielded the top 100 genes related to CNTFR. To delineate the functional implications of the candidate molecules, KEGG pathway enrichment and GO term enrichment analyses were conducted across three curated datasets.

Fig. 3.

Functional enrichment analysis of CNTFR. A MANIA constructed CNTFR-related genes; B The STRING database generates a PPI network for the CNTFR; C-F CNTFR-associated enrichment analysis; G CNTFR correlation of the 15 chord diagrams; H Heatmap of CNTFR-associated top 15 co-expression

According to GO analysis, there was a strong correlation (P < 0.05) between CNTFR and soluble cytokine receptors, presynaptic membrane, and synaptic structure (Fig. 3C-F). KEGG analysis indicated that CNTFR is involved in tumor pathogenesis through the mediation of cytokine receptor interaction and JAK-STAT signaling pathway (Fig. 3G). The association between CNTFR expression and ESCA co-expressed genes, analyzed using TCGA cohort data, is depicted in Fig. 3H.

miR-21-5p's function in esophageal cancer cells

To elucidate the regulatory mechanism through which the miR-21-5p/CNTFR axis modulates the biological behaviors of ESCA, RT-qPCR was performed on 30 ESCA tumor-normal tissue pairs. As shown in Fig. 4A, miR-21-5p was significantly upregulated in tumor tissues, while CNTFR expression was markedly reduced (Fig. 4B).

Fig. 4.

MiR-21-5p and CNTFR relative expression in esophageal cancer tissues. A, B RT-qPCR results showing relative expression of miR-21-5p, relative expression of CNTFR; C, D In esophageal cancer tissues, RT-qPCR reveals that the relative expression of CNTFR after overexpression or knockdown of miR-21-5p; E, F the result of WB showed the relative expression of CNTFR after overexpression or knockdown of miR-21-5p, the values on the graphs represent are mean ± SD

Gain- and loss-of-function assays in ECA109 and KYSE150 cells revealed that miR-21-5p mimic transfection decreased CNTFR mRNA levels relative to the mimic NC group (P < 0.05), whereas inhibitor transfection induced a prominent increase in CNTFR transcription (P < 0.05, Fig. 4C, D), indicating transcriptional repression of CNTFR by miR-21-5p.

Consistently, protein-level analysis showed that miR-21-5p mimics downregulated CNTFR expression, while its inhibitor enhanced CNTFR expression relative to respective NC groups (Fig. 4E, F), verifying that miR-21-5p also exerts translational suppression on CNTFR.

Our study investigated the associations between the expression levels of CNTFR and miR-21-5p and clinicopathological characteristics in a cohort of 30 patients with esophageal carcinoma. Statistical analyses(Fisher’s exact test), revealed that CNTFR expression was significantly associated with tumor differentiation degree (p = 0.031) and overall survival (OS; p = 0.021). Also, these finding elevated miR-21-5p expression was significantly correlated with pathological stage (p = 0.030), N stage(p = 0.023), and OS (p = 0.021). No statistically significant associations were observed between either CNTFR or miR-21-5p expression and other clinicopathological variables—including patient gender, smoking, T stage and M stage(all p > 0.050). These findings indicate that elevated CNTFR expression may serve as a favorable prognostic biomarker in esophageal cancer patients, whereas upregulated miR-21-5p expression is associated with poorer prognosis. Collectively, both molecules hold promise as novel, clinically relevant molecular markers for prognostic stratification in esophageal cancer.These findings are summarized in Table 3.

Table 3.

Relationship between miR-21-5P and CNTFR expression and clinical factors

	Total No	CNTFR		P-value	miR-21-5p		P-value
		Low	High		Low	High
Gender				1			0.427
Male	21	10	11		9	12
Female	9	5	4		6	3
Pathologic stage				1			0.03
I + Ⅱ	11	5	6		9	2
Ⅲ	13	7	6		5	8
Ⅳ	6	3	3		1	5
smoker				0.466			0.466
No	15	9	6		9	6
Yes	15	6	9		6	9
Differentiation -degree				0.031			0.240
Well	10	6	4		7	3
Moderate	16	5	11		7	9
Poor	4	4	0		1	3
T.Stage				0.477			0.182
T1 + T2	5	2	3		4	1
T3	23	13	10		11	12
T4	2	0	2		0	2
N.Stage				0.504			0.023
N0	12	6	6		9	3
N1	11	4	7		2	9
N2	6	4	2		4	2
N3	1	1	0		0	1
M.Stage				1			0.169
M0	24	12	12		14	10
M1	6	3	3		1	5
OS_event				0.021			0.021
Dead	19	13	6		6	13
Alive	11	2	9		9	2

To investigate the influence of miR-21-5p on the proliferative, invasive, and migratory capabilities of ESCA cells, we conducted additional in vitro experiments involving overexpression and knockdown techniques.

Transfected into esophageal cancer cells ECA-109 and KYSE150, we confirmed using the CCK8 and Edu experiment that overexpression of miR-21-5p could improve the ability of esophageal cancer cells to proliferate (Fig. 5A-C).

Fig. 5.

Cell proliferation experiment of miR-21-5p in esophageal carcinoma cells. A The CCK8 experiment was conducted to confirm the ability of esophageal cancer cells to proliferate following the transfection of miR-21-5p into ECA109 and KYSE150 cells; B, C The image of EdU-labeled cells in esophageal carcinoma after 24 h post-transfection and statistical analysis., the values on the graphs represent are mean ± SD

As depicted in the Figure, the analysis of the ECA-109 and KYSE150 cell lines revealed a notable disparity in the quantity of invasion cells between the inhibitor miR-21-5p group and the inhibitor NC group, with the former exhibiting a considerably lower count (P < 0.05). In contrast, the group treated with miR-21-5p mimics exhibited a significantly greater cell count compared to the group treated with mimics NC (P < 0.05). Moreover, the migration experiment revealed similar results, as depicted in Fig. 6A-C.

Fig. 6.

Experimental study on cell invasion and migration of miR-21-5P in esophageal carcinoma cells. A, B Microscopical observation of esophageal cancer cell migration and invasion in the down-regulated or overexpressed miR-21-5p and its NC group 24 h after transfection with KYSE150 and ECA109; C The amount of migration and invasion cells in each group was determined by data analysis (P < 0.05). Data are presented as mean ± SD (n = 3 independent experiments). Statistical significance was determined by Unpaired two-tailed Student’s t-test

Downregulation of CNTFR Rescued the Inhibition of ESCA Cells Induced by miR-21-5p Inhibitor

To investigate the impact of miR-21-5p/CNTFR on the biological processes of esophageal cancer cells, we developed a cell rescue model. We used two small interfering RNAs (siRNAs) that efficiently suppress the expression of CNTFR in EC109 and KYSE150 cells. Both types of SiRNA had notable impacts on ESCA expression, with Si-CNTFR2 demonstrating a more pronounced effect (Fig. 7A). Consequently, we employed Si-CNTFR2 to conduct the subsequent cell function assessments. To confirm the role of CNTFR in promoting cell proliferation, migration, and invasion through miR-21-5p, we introduced Si-CNTFR into ECA109 and KYSE150 cells that were also treated with a miR-21-5p inhibitor. Results from CCK-8 and EdU assays demonstrated that, in comparison with the negative control (NC) group, CNTFR knockdown markedly enhanced the viability and proliferative capacity of EC109 and KYSE150 cells. Nevertheless, the increased cellular survival and proliferation rates induced by the Si-CNTFR group could be reversed by the combined treatment with miR-21-5p inhibitor and Si-CNTFR(Fig. 7B-D). The Transwell experiment demonstrated a drop in OD value in the miR-21-5p inhibitor + Si-CNTFR experimental group compared to the Si-CNTFR experimental group. This indicated a reduction in the number of cells that were able to penetrate the membrane. The difference was statistically significant as shown in Fig. 7E (P < 0.05). This implied that miR-21-5p suppressed the expression of CNTFR, which in turn regulated the invasion and migration of esophageal cancer cells.

Fig. 7.

It was established that esophageal cancer cells repressed by miR-21-5p might be rescued by CNTFR knockdown. A The knockdown efficiency of CNTFR gene in ECA109 and KYSE150 cells was detected by WB; B The proliferation of esophageal cancer cells in the Si-CNTFR group and the Si-CNTFR + miR-21-5P inhibitor group was assessed using the CCK-8 technique at 0, 12, 24, and 48 h in comparison to the NC group; C, D The proliferative activity index of the NC group, CNTFR knockout group, and Si-CNTFR + miR-21-5P inhibitor group in esophageal cancer was confirmed 24 h after transfection stained with EdU/DAPI and data analysis; E The rescue was confirmed by the Transwell experiment, the values on the graphs represent are mean ± SD

To dissect the biological function of miR-21-5p in esophageal cancer cells and clarify its regulatory mode on cell apoptosis via the downstream target gene CNTFR, flow cytometry was employed for functional verification.

Using flow cytometric analysis, we found that transfection with miR-21-5p mimics led to a conspicuous decline in the apoptotic rate of esophageal cancer cells when compared with the NC group. On the contrary, treatment with a miR-21-5p inhibitor triggered a marked induction of apoptosis, where the apoptotic rate in the inhibitor-treated group was significantly elevated relative to the NC group (P < 0.05). Collectively, these observations explicitly confirm that miR-21-5p upregulation exerts a robust anti-apoptotic function in esophageal cancer cells.

Additionally, we noticed that apoptosis rate in Si-CNTFR group was substantially lower than that of the NC group following the transfection of ECA109 and KYSE150 cells (P < 0.05). This implied that CNTFR stimulated esophageal cancer cells to undergo apoptosis. Upon conducting the rescue experiment, the findings of flow cytometry demonstrated that, following co-transfection with esophageal cancer cells, the cell death rate in the miR-21-5p inhibitor + Si-CNTFR group was higher than that of the Si-CNTFR group (P < 0.05). This implied that the inhibitory effect of the miR-21-5p inhibitor on cell apoptosis was reversed by interference with CNTFR expression. Put another way, miR-21-5p targeted the downstream gene CNTFR, which in turn caused esophageal cancer cells to undergo apoptosis (Fig. 8A-D).

Fig. 8.

MiR-21-5P and CNTFR's apoptosis and rescue experiments in esophageal cancer cells were investigated. A-B.The apoptosis of esophageal carcinoma cells after overexpression and knockdown of miR-21-5P was verified by flow cytometry. C-D Following transfection of esophageal cancer cells ECA109 and KYSE150, flow cytometry verified that miR-21-5p, which targets CNTFR, regulates esophageal cancer cell apoptosis and rescue experiments, We analyzed the results with GraphPad and SPSS

Double luciferase reporter gene assay

The research was executed utilizing vectors that carried either mutant or wild-type CNTFR. This vector was generated through the amplification of the CNTFR 3'UTR region linked to miR-21-5p, as depicted in Fig. 9A, B. The results of the twofold luciferase reporter gene experiment showed that transfecting the miR-21-5p group with the CNTFR wild-type vector led to a significant decrease (P < 0.05) in luciferase activity compared to the NC group. Additionally, luciferase activity was significantly inhibited (P < 0.05) in the miR-21-5p group transfected with the CNTFR wild-type vector when compared to the NC group. The mutant vector CNTFR, when introduced with miR-21-5p, did not demonstrate a statistical alteration in activity (P > 0.05), as shown in Fig. 9C.

Fig. 9.

Interaction between miR-21-5p and CNTFR is detected by luciferase assay. A The construction of the vector; B The combined site of CNTFR and miR-21-5p; C The luciferase activity of the miR-21-5p group transfected with the CNTFR wild-type vector was significantly inhibited compared to the NC group, whereas the activity of the miR-21-5p group transfected with the CNTFR mutant vector was not significantly altered compared to the NC group, The MUT vector acted as a specificity control to exclude off-target effects, with reduced luciferase activity restricted to the WT group confirming direct miR-21-5p–CNTFR binding

Discussion

The main reasons of the low survival rate in ESCA patients include tumor cell resistance to chemotherapy and/or radiation therapy, metastasis, and aggressiveness [22]. In light of this, efforts have been made to develop new non-invasive biomarkers, with miRNAs emerging as a promising option. The structural stability and cycle richness are primarily to blame for it [23]. As a result, numerous researches have looked into the diagnostic potential of miRNAs in a range of malignancies, including ESCA [24–26]. On the basis of previous studies, individuals with ESCA and other malignancies have elevated expression of miR-21, which may develop into a novel biomarker for tumor identification [27, 28]. Luo et al. [29] clarified miR-21 overexpression was a separate factor that affected prognosis in EC patients belonging to the Kazakh ethnic group. Researchers started concentrating on the function of miR-21 in tumor invasion, migration, and metastasis after realizing how important miR-21 is for diagnosis. In the recent study, patients with esophageal drug resistance (ESCA) who have higher expression of exosome pd-l1 are more likely to have squamous cell carcinoma, a worse prognosis, and an earlier clinical stage. Exosome pd-l1 upregulates STAT3/mir-21, which causes esophageal cancer cells to become more resistant to chemicals and to develop tumor-causing characteristics [30]. As previously indicated, miR-21 is anticipated to be a novel target for cancer treatment [31–33]. Thus, the goal of the present study is to elucidate the function of the miR-21-5P/CNTFR axis in ESCA. Patients with esophageal cancer may benefit from research into the molecular underpinnings of ESCA development and the identification of useful biomarkers for early detection and treatment.

The present study employed a range of bioinformatic and statistical techniques to assess the expression of CNTFR and prognosis correlation, the possible role of CNTFR in ESCA, and the impact of miR-21-5p and CNTFR in ESCA patients with diverse clinicopathological features. To investigate the impact of miR-21-5p on the development, migration, apoptosis, and invasion of ESCA cells, we conducted additional experiments involving the overexpression and knockdown of this microRNA in an in vitro setting. The target genes are negatively regulated when miRNA attaches to the 3'utr of the target mRNA, causing mRNA degradation and blocking translation [34, 35] (Fig. 10). After looking into potential downstream mRNA predictions, we found that overexpressing miR-21-5p dramatically decreased the expression of CNTFR in our study. To clarify the connection between CNTFR and miR-21-5p, we constructed an mRNA vector that facilitated the binding of CNTFR to miR-21-5p. Reporter gene analysis was performed utilizing luciferase. The identification provided evidence of the binding of CNTFR to miR-21-5p. According to the findings from PCR and WB, the relative gene expression of CNTFR was substantially impacted by the upregulation or downregulation of miR-21-5p. Furthermore, by inhibiting cell migration, invasion, and apoptosis brought on by the miR-21-5p inhibitor, CNTFR downregulation may be able to resume cell function. These findings imply that the invasion, migration, apoptosis, and proliferation of ESCA cells are regulated by miR-21-5p and its target gene CNTFR.

Fig. 10.

Biogenesis of miRNA

As the specific receptor for CLCF1, reduced CNTFR expression abrogates CLCF1 binding, thereby blocking anti-proliferative and pro-apoptotic signaling cascades; concurrently, this disruption impairs the paracrine crosstalk between tumor cells and stromal components in the microenvironment, removing an important barrier to uncontrolled tumor growth [18]. Our in vitro data showing accelerated cell proliferation and invasion after CNTFR suppression aligns with this mechanism.Emerging studies have demonstrated that CNTFR expression in tumor cells modulates the infiltration and polarization of immune cells in the tumor microenvironment. This immunosuppressive microenvironment not only allows ESCA cells to escape immune surveillance but also provides a permissive niche for tumor cell dissemination and distant metastasis. The miR-21-5p/CNTFR axis thus represents a multifaceted regulator of ESCA progression, with potential implications for the development of targeted therapies that simultaneously disrupt oncogenic signaling and restore anti-tumor immunity [36].

Although this study has systematically demonstrated that miR-21-5p targets and regulates CNTFR in esophageal squamous cell carcinoma (ESCA), several limitations remain. First, the functional validation was not extended to animal models; the conclusions were primarily based on PCR, Western blotting (WB), cellular assays, and bioinformatics analyses, which warrant further experimental confirmation. Furthermore, the downstream signaling pathway mediated by CNTFR in ESCA has not yet been elucidated. The downregulation of CNTFR may perturb the equilibrium of established oncogenic signaling cascades, thereby driving the malignant phenotypes observed; however, the precise molecular mechanisms require more comprehensive investigation. These aspects will be systematically evaluated in our future studies to better define the functional and clinical significance of this regulatory axis in ESCA.

Conclusions

In summary, our study investigated the impact of miR-21-5P, a tumor-promoting factor, on the proliferation, apoptosis, invasion, and migration of esophageal cancer by targeting CNTFR, revealing its potential as a candidate therapeutic target for esophageal cancer. To determine the cause of esophageal cancer, exploring pertinent molecular biomarkers with high sensitivity, specificity and correctly is crucial nowadays.

Authors’ contributions

**Yuhan Deng:** Investigation, Original manuscript preparation, Study design, Data collecting. **Yixiao Cui:** In vitro experiments, Bioinformatics analysis. **Zhenhua Wu:** Data collecting, Manuscript writing. **Yi Zhu：** Data collecting. **Shabahaiti·Wusiman:** Data collecting. **Keming Xu:** Data collecting, Manuscript writing. **Xiaohong Sun:** Conceptualization, Supervision, Validation, Writing-Reviewing and Editing, Methodology. **Changqi Luo:** Conceptualization, Supervision, Validation, Data curation, Visualization, Writing-Reviewing.

Funding

This project was supported by the Science and Technology Department of Xinjiang Uygur Autonomous Region (#2021D01C397 and #2016D01C369) and Health Commission of Sichuan Province Medical Science and Technology Program (#24QNMP047).

Data availability

The present study mined the original sequencing datasets from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/) and the Gene Expression Omnibus (GEO) repository (https://www.ncbi.nlm.nih.gov/geo/). All data generated and analytically processed in the course of this research have been incorporated into the current manuscript.

Declarations

Ethics approval and consent to participate

The Affiliated Cancer Hospital Ethics Committee of Xinjiang Medical University (Xinjiang Uygur Autonomous Region, China) gave its approval for this study (NO. K-2023064). Informed consent was given by each patient who consented to take part in the research,Research studies involving human participants are carried out in strict adherence to the principles outlined in the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.