Skip to main content
The Journal of Veterinary Medical Science logoLink to The Journal of Veterinary Medical Science
. 2025 Dec 31;88(3):471–481. doi: 10.1292/jvms.25-0507

Effect of fuzapladib sodium hydrate on adhesion molecule expression in canine endothelial cells and neutrophils

Kanittha DARAWIROJ 1, Takafumi SUNAGA 1, Ryo OWAKI 1, Nomsa Mulenga HANDONDO 1, Masahiro OKUMURA 1,*
PMCID: PMC13000429  PMID: 41485945

Abstract

Neutrophil recruitment to inflamed tissue is mediated by adhesion molecules and chemokine signaling. Fuzapladib sodium hydrate (FZP) has been reported to reduce neutrophil infiltration, but its broader effect on adhesion molecules in dogs remains unclear. This study investigated the influence of FZP on canine aortic endothelial cells (CnAOEC) and primary neutrophils under cytokine stimulation. CnAOEC were treated with recombinant canine tumor necrosis factor alpha (rh-cTNFα) or lipopolysaccharide together with FZP, while neutrophils isolated from healthy dogs were preincubated with FZP before rh-cTNFα stimulation for gene and protein expression analyses. Expression of endothelial E-selectin, P-selectin, and intercellular adhesion molecule-1 (ICAM-1) was quantified by qPCR. Neutrophil C-X-C motif chemokine receptor 2, P-selectin glycoprotein ligand-1 (PSGL-1), and L-selectin were also analyzed using qPCR. In addition, C-X-C motif chemokine ligand 1 and leukocyte function-associated antigen-1 (LFA-1) were determined using ELISA and flow cytometry, respectively. Neutrophil adhesion to FZP-treated endothelial monolayers was evaluated under static conditions. FZP significantly downregulated endothelial P-selectin at the highest dose, whereas ICAM-1 was upregulated. In neutrophils, FZP decreased L-selectin and PSGL-1 expression at the highest concentration. These findings suggest that FZP selectively modulates early adhesion through suppression of P-selectin, L-selectin, and PSGL-1, which may weaken rolling and tethering interactions between cells. Although functional adhesion effects were limited, these molecular responses provide further insight into the anti-inflammatory effect of FZP.

Keywords: C-X-C motif chemokine ligand 1, fuzapladib, L-selectin, P-selectin, P-selectin glycoprotein ligand-1

INTRODUCTION

Inflammation is a fundamental defense mechanism triggered by harmful stimuli, including pathogens, damaged cells, toxins, and irritants, and is characterized by increased vascular permeability, neutrophil recruitment, and the release of pro-inflammatory mediators. Collectively, these characteristics contribute to the major clinical signs of inflammation, including redness, swelling, heat, pain, and impaired tissue function [5]. A key component of inflammation is the interaction between adhesion molecules on leukocytes and endothelial cells, which facilitates leukocyte extravasation into inflamed tissue. This interaction is mediated by selectins, integrins, and members of the immunoglobulin superfamily, regulating neutrophil rolling, firm adhesion, and transendothelial migration [8].

Neutrophils, as the primary responders in the early phase of acute inflammation, are rapidly recruited from the circulation to inflamed tissues, where they contribute to pathogen clearance and modulation of the immune response. However, under certain pathological conditions, neutrophils may undergo reverse migration. This phenomenon has been associated with systemic inflammation and the development of complications such as acute lung injury, renal injury, encephalomyelitis, colitis, and endotoxemia [10].

Neutrophil recruitment and transmigration are regulated through a sequence of adhesive interactions. The process begins with selectin-mediated tethering and rolling along activated endothelial cells. Neutrophils express P-selectin glycoprotein ligand-1 (PSGL-1), which binds to E- and P-selectins on the inflamed endothelium, initiating contact. Subsequent firm adhesion is achieved through the binding of β2-integrins, specifically leukocyte function-associated antigen-1 (LFA-1) or CD11a/CD18, to intercellular adhesion molecule-1 (ICAM-1), regulated by bidirectional signaling. Neutrophils then continue along the endothelial surface, guided by LFA-1-ICAM-1 interactions, before crossing the endothelium through paracellular or transcellular pathways [23]. Effective removal of neutrophils from inflamed tissue is essential for inflammation resolution and protecting tissue integrity. Therefore, understanding the course of migrated neutrophils is crucial to differentiating between self-limiting and chronic inflammation, as well as advancing focused therapeutic strategies [9].

Targeting adhesion molecules has become a promising approach for regulating neutrophil-mediated inflammation. Fuzapladib sodium hydrate (FZP), a leukocyte function-associated antigen-1 (LFA-1) inhibitor, prevents neutrophil extravasation by interfering with LFA-1-mediated adhesion. It is currently approved for the treatment of canine pancreatitis in the United States of America and Japan [11]. Preclinical investigations in rat and canine models have shown that FZP reduced the severity of pancreatic injury by decreasing neutrophil infiltration [12, 13]. Furthermore, in vitro studies using human umbilical vein endothelial cells (HUVEC) and HL-60 cells revealed reduced neutrophil-endothelial adhesion after lipopolysaccharide (LPS) stimulation and FZP treatment, explained by reduced LFA-1 expression [25]. However, the effect of FZP on the broader range of adhesion molecule expression has yet to be researched, particularly in canine endothelial cells and neutrophils. Moreover, the information available on the dose-dependent effect is limited. This study aims to investigate the effect of FZP on the expression of key adhesion molecules involved in neutrophil-endothelial interactions in a canine cell-based in vitro model, emphasizing potential dose-dependent responses.

MATERIALS AND METHODS

Cell culture

Canine aortic endothelial cells (CnAOEC; Cell Applications, Inc., San Diego, CA, USA; Cat. No Cn304-05) were obtained as a cryopreserved vial at passage 2. In this study, CnAOEC from passage 4 to passage 9 were used. The cells were cultured in the Canine EC Growth Medium (Cell Applications, Cat. No. Cn211K-500) according to the manufacturer’s instructions with a minor modification. Briefly, CnAOEC were seeded at a density of 1 × 104 cells/cm2 onto 100 mm culture dishes (Corning, Lowell, MA, USA) coated with Attachment Factor Solution (AFS; Cell Applications, Cat. No. 123). Fresh medium, pre-warmed to 37°C, was replaced every other day. When cultures reached 80–90% confluence, cells were washed three times with Hanks’ Balanced Salt Solution (HBSS; Thermo Fisher Scientific, Waltham, MA, USA; Cat. No. 14025092) and detached using Acutase solution (Sigma-Aldrich, St. Louis, MO, USA). The cell suspension was then centrifuged at 400 × g for 5 min at 4°C without braking, and the cell pellet was resuspended in Canine EC growth medium. Cell number and viability were assessed using the trypan blue exclusion method (Wako Pure Chemical Industries, Osaka, Japan). Following this assessment, cells were expanded and sub-cultured under identical conditions for subsequent experiments.

Canine neutrophil isolation

Ten milliliters of fresh whole blood were obtained from the cephalic vein of three healthy female beagles, with the approval of the Ethics Committee of Hokkaido University (Approval No. 230104). This followed the institutional guidelines for the care and use of experimental animals. Neutrophils were isolated from 10 mL of fresh, anticoagulated K2EDTA (Dojindo Laboratories, Kumamoto, Japan) using Polymorphprep (Serumwerk Bernburg, Bernburg, Germany) through density gradient centrifugation, following the manufacturer’s protocol for human neutrophil isolation (500 × g for 30 min at 20°C). Residual erythrocytes were eliminated by the addition of 1 mL of 1× RBC lysis buffer (Thermo Fisher Scientific) for 8 min at room temperature. This was immediately followed by an addition of HBSS and centrifugation at 400 × g for 10 min. The residual neutrophils were resuspended and calibrated to 4 × 106 cells/mL in the Roswell Park Memorial Institute 1640 medium (RPMI-1640; Thermo Fisher Scientific), supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich) and 1% penicillin-streptomycin solution (Wako Pure Chemical Industries). The isolated neutrophils were immediately used for the subsequent experiment.

RNA extraction, reverse transcription, and quantitative real-time polymerase chain reaction (qPCR)

CnAOEC were cultured at a density of 2 × 105 cells per well in 6-well plates (Corning), with the Canine EC Growth Medium replaced every other day until it became confluent. The cells were subsequently treated in Canine EC Basal Medium (Cell Applications, Inc., Cat. No. Cn210-500) with either recombinant canine tumor necrosis factor alpha (rh-cTNFα; Kingfisher Biotech, Saint Paul, MN, USA) at 30 ng/mL or LPS (100 ng/mL; Wako Pure Chemical Industries, Cat. No. 127-05141), each administered alone or in combination with Fuzapladib sodium hydrate (1, 10, or 100 µM; BRENDA; Ishihara Sangyo Kaisha, Ltd., Osaka, Japan), abbreviated as FZP. Treatments were applied for 6 hr in a humidified incubator at 37°C with 5% CO2. Following incubation, the cells were washed three times with HBSS to remove residual medium, and total RNA was subsequently isolated.

Freshly isolated neutrophils, at a concentration of 1 × 106 cells/mL, were pre-incubated with or without FZP at concentrations of 1, 10, or 100 µM in a humidified incubator with 5% CO2 at 37°C for 24 hr. The cells were then stimulated with rh-cTNFα at 20 ng/mL for 1 hr. RPMI-1640 supplemented with 10% FBS and 1% penicillin-streptomycin served as the negative control, while rh-cTNFα treatment alone was used as the positive control. Following treatment, neutrophils were washed once with phosphate-buffered saline (PBS; Thermo Fisher Scientific, Cat. No. 10010023). Subsequently, the cells were lysed and stored at −70°C until all samples were collected, after which RNA was extracted. Neutrophil viability under these incubation conditions was evaluated in parallel experiments using 7-Aminoactinomycin D (7-AAD; BD Biosciences, San Diego, CA, USA) staining.

Total RNA was isolated utilizing the NucleoSpin RNA Purification Kit (Macherey-Nagel, Dürren, Germany). The concentration of RNA was determined using a NanoEX Lite spectrophotometer (Optima Inc., Tokyo, Japan) at a wavelength of 260 nm. Subsequently, 500 ng of total RNA from CnAOEC and 50 ng from canine neutrophils were reverse-transcribed into cDNA using the M-MLV RT Kit (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s guidelines. A two-step qPCR was conducted with the KAPA SYBR FAST qPCR Kit (KAPA Biosystems, Woburn, MA, USA). The relative expression levels of target genes were determined using the 2-ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the housekeeping gene for normalization. The expression levels of adhesion-related genes, which include E-selectin, ICAM-1, P-selectin, C-X-C motif chemokine receptor 2 (CXCR2), PSGL-1, and L-selectin, were evaluated to determine the impact of FZP on endothelial and neutrophil adhesion molecules. Primer sequences are listed in Table 1 [18, 22]. The qPCR assays consisted of three biological replicates for each endothelial cell sample. Moreover, each sample comprised two technical replicates. For neutrophils, the process was as follows. Blood was drawn from a dog on three separate occasions. Each sample was used for two technical replicates. This process was repeated for a total of three dogs.

Table 1. Primer sequences for quantitative real-time polymerase chain reaction.

Primer Primer sequence Reference
CXCR2 Forward: 5′ AGCTGCCTTAATCCCCTCAT 3′ [18]
Reverse: 5′ CTGAACCTGCTGGGAAACTC 3′
E-selectin Forward: 5′ GAAATTCTTGGCCCGTCCATC 3′ [22]
Reverse: 5′ ATGCAGCCAGCACTTAATCTGAAAC 3′
GAPDH Forward: 5′ TGTCCCCACCCCCAATGTATC 3′ [22]
Reverse: 5′ CTCCGATGCCTGCTTCACTACCTT 3′
ICAM-1 Forward: 5′ CAGGGTTGCCAGGTACAGTT 3′ [22]
Reverse: 5′ AGTATGGGCTCAGTGGGTTG 3′
L-selectin Forward: 5′ GATTTCAACAGGACCAGCAGCA 3′ [22]
Reverse: 5′ CCGCAGGGTCCACAAGTAAGA 3′
PSGL-1 Forward: 5′ TTCTGGCTGAGATGGCGATG 3′ [22]
Reverse: 5′ AGAGTGGCTGGCTCTGGAGTTC 3′
P-selectin Forward: 5′ TACAACACCAGCTGTCGCTTCC 3′ [22]
Reverse: 5′ GTGCTGTCCACTGTCCCAAGTC 3′

CXCR2: C-X-C motif chemokine receptor 2; GAPDH: glyceraldehyde-3 phosphate dehydrogenase; ICAM-1: intercellular adhesion molecule-1; PSGL-1: P-selectin glycoprotein ligand-1.

Enzyme-linked immunosorbent assay (ELISA)

In an independent experiment, CnAOEC were inoculated onto 96-well plates (Corning) coated with AFS at a density of 1 × 105 cells per well in 200 μL of the Canine EC Growth Medium and incubated for 24 hr to allow cell attachment. Following incubation, the culture medium was replaced with one of the following treatments: rh-cTNFα at 30 ng/mL, either alone or combined with FZP at concentrations of 1, 10, or 100 μM, or with LPS at 100 ng/mL, either alone or in combination with FZP (1, 10, or 100 μM). The Canine EC Basal Medium without stimulants or FZP served as the negative control. All procedures were conducted in a humidified incubator at 37°C with 5% CO2. After 24 hr of stimulation, the concentration of secreted C-X-C motif chemokine ligand 1 (CXCL1) protein in the culture medium was quantified using the Canine CXCL1 ELISA kit (RayBiotech, Inc., Norcross, GA, USA) according to the manufacturer’s instructions.

Flow cytometry

Neutrophils were isolated from three dogs. For each dog, the experiment was conducted in three separate runs. Fresh isolated neutrophils were subjected to the same pre-incubation and stimulation protocol as described above for the qPCR assay. Following this protocol, the cells were washed once with PBS. Subsequently, 3 × 105 cells were resuspended in PBS containing 10% goat serum (Thermo Fisher Scientific) and incubated at room temperature for 20 min to reduce nonspecific antibody binding. The cells were then stained with PE-conjugated mouse anti-human CD11a monoclonal antibody (clone HI111, mouse IgG1; BD Biosciences) or PE-conjugated mouse IgG1, κ isotype control (clone MOPC-21; BD Biosciences) for 10 min under light-protected conditions. After staining, the cells were washed twice with PBS containing 10% goat serum. Two microliters of 7-AAD was then added to the stained cell suspension in 200 µL of PBS containing 10% goat serum and subsequently incubated for 10 min. Flow cytometric analysis was performed using a BD FACSLyric™ Flow Cytometer (BD Biosciences). Viability was quantified as the percentage of 7-AAD-negative (viable) cells within the singlet neutrophil gate. The gating strategy, including neutrophil identification, singlet selection, exclusion of non-viable events, and definition of CD11a-low and CD11a-high subsets using an isotype control, is shown in Supplementary Fig. 2.

Static adhesion assay

A static adhesion assay, modified from a prior human investigation [33], was conducted to assess the impact of FZP on neutrophil adherence to endothelial cells. Within this experiment, CnAOEC were seeded at a density of 1 × 104 cells per well in 96-well plates. The Canine EC Growth Medium was replaced every other day until the cells reached 100% confluence. Once confluent, the cells were pre-incubated for 3 hr with FZP at doses of 1, 10, or 100 μM, or the Canine EC Basal Medium as a control. Following pretreatment, the cells were exposed to rh-cTNFα at a final concentration of 30 ng/mL and incubated for 4 hr. Freshly isolated neutrophils were labeled with Calcein-AM (Dojindo Laboratories). The labeled neutrophils, at a concentration of 1 × 105 cells per well, were then coincubated with treated CnAOEC for 20 min. All incubations were performed at 37°C in a humidified incubator with 5% CO2. Fluorescence intensity (FI) at an excitation wavelength of 485 nm and an emission wavelength of 520 nm was measured using a GloMax Discover microplate reader (Promega, Madison, WI, USA). This measurement was performed before the washing step to determine the total cell count. The cells were then gently washed twice with HBSS to remove non-adherent neutrophils. Subsequently, 100 µL of RPMI-1640 solution was added to each well, and fluorescence was re-evaluated. Neutrophil adhesion was calculated as the relative adherence by examining the FI before and after washing using the following equation:

(Prewash FI of sample − Prewash FI of background) (Postwash FI of sample − Postwash FI of background)×100=% adherence

% adherence of treatmentaverage % adherence of positive control= relative adherence

Similar to the previous experiment, neutrophils were isolated from three healthy dogs, and the experiment was independently repeated three times for each dog. Each repeat included five treatment conditions, with six technical replicates per condition.

Statistical analysis

All data are presented as mean ± standard deviation (SD). Statistical analyses were conducted using GraphPad Prism 10.0 software (GraphPad Software, San Diego, CA, USA), and a P-value <0.05 was considered statistically significant for all tests. The assumption of a normal distribution was assessed using the Shapiro-Wilk test. The repeated-measures (RM) one-way ANOVA followed by Tukey’s multiple comparison test was used to analyze the normally distributed data. In case the assumption of normality was violated, the Friedman test in combination with Dunn’s test was employed instead.

RESULTS

Effect of fuzapladib sodium hydrate on adhesion molecule gene expression in cytokine-induced CnAOEC

To confirm that the observed changes in gene expression were not caused by cytotoxicity, cell viability was evaluated using the Cell Counting Kit-8 assay (CCK-8; Dojindo Laboratories). CnAOEC were treated with FZP (1, 10, and 100 μM) for 24 hr. The results showed that FZP did not cause significant cytotoxicity at any tested concentration. Cell viability at 100 μM FZP remained above 90% compared to the control and showed no statistical difference (P>0.05). In contrast, the positive control (10% DMSO) significantly decreased cell viability (Supplementary Fig. 1).

Following viability confirmation, qPCR was conducted to assess the effect of FZP on the expression of endothelial adhesion molecules, specifically: E-selectin, ICAM-1, and P-selectin in CnAOEC stimulated with rh-cTNFα or LPS. All expression levels were compared to those of the corresponding positive control. The results indicated that stimulation with both LPS and rh-cTNFα increased the mRNA levels of all target genes compared to the negative control (Supplementary Table 1).

Across both stimuli on the CnAOEC for 6 hr, the result revealed that FZP did not reduce E-selectin transcription level relative to the stimulus control. Under LPS stimuli, the mean fold was set at 1.00, while the treatment groups showed mean values of 0.79, 0.85, and 1.40 for FZP at 1, 10, and 100 μM, respectively, as shown in Fig. 1A. Neither of the doses was statistically significant compared to the LPS control group (P≥0.347). Among the treatments, the 100 μM group values increased compared to the 1 μM group (P=0.027), yet other pairs were not significant. In the rh-cTNFα-stimulated group (see Fig. 2A), the statistics showed no difference between treatment groups versus the positive control (P≥0.395) and no difference between the treatments (P≥0.534). The mean folds were 1.00, 0.82, and 0.95 for 1, 10, and 100 μM of FZP, respectively.

Fig. 1.

Fig. 1.

Effects of fuzapladib sodium hydrate (FZP) on adhesion molecule expression in lipopolysaccharide (LPS)-treated canine aortic endothelial cells (CnAOEC). CnAOEC were stimulated with LPS (100 ng/mL) alone for 6 hr or in combination with FZP (1, 10, or 100 μM). The mRNA expression of (A) E-selectin, (B) intercellular adhesion molecule-1 (ICAM-1), and (C) P-selectin was analyzed by qPCR and normalized to the LPS control set to 1.0. The data represent the mean ± SD from three independent experiments. Statistical significance was assessed using RM one-way ANOVA with Tukey’s post hoc test, or the Friedman test with Dunn’s correction when normality was not met. *P<0.05 versus the indicated groups.

Fig. 2.

Fig. 2.

Effects of fuzapladib sodium hydrate (FZP) on adhesion molecule expression in recombinant canine tumor necrosis factor alpha (rh-cTNFα)-stimulated canine aortic endothelial cells (CnAOEC). CnAOEC were challenged with rh-cTNFα (30 ng/mL) alone for 6 hr or combined with FZP (1, 10, or 100 μM). The mRNA expression of (A) E-selectin, (B) intercellular adhesion molecule-1 (ICAM-1), and (C) P-selectin was quantified by qPCR and normalized to the rh-cTNFα control (set to 1.0). Data are presented as mean ± SD from three independent experiments. Statistical significance was assessed using RM one-way ANOVA followed by Tukey’s multiple comparison test. *P<0.05, ** P<0.01 versus the indicated groups.

ICAM-1 gene expression relative to the positive control exhibits a similar pattern in the LPS-exposed group as E-selectin, illustrated in Fig. 1B. The mean fold was 1.00, 0.95, 0.86, and 1.56 for LPS and FZP concentrations of 1, 10, and 100 μM, respectively. The statistical analysis showed no significant effect of the ICAM-1 gene expression after being challenged with all treatments compared to the LPS treatment alone (P≥0.347). However, ICAM-1 was significantly upregulated in the 100 μM group compared to the 10 μM group (P=0.027). Other pairwise comparisons were not significant. For the rh-cTNFα treatment groups, the mean fold versus rh-cTNFα alone was 0.99, 0.81, and 1.39 at 1, 10, and 100 μM of FZP, respectively, as shown in Fig. 2B. These results revealed that FZP at 100 μM concentration significantly increased ICAM-1 gene expression level compared to both the positive control (P=0.007) and the FZP 1 μM treatment group (P=0.039). There are no significant differences between other pairwise comparisons (P≥0.359).

P-selectin mRNA expression level was highlighted across both stimuli, as it illustrates an inverse-dose response. The results of the LPS-challenged group indicate that the mean fold against the isolated LPS treatment was 1.09 (1 μM), 1.21 (10 μM), and 0.84 (100 μM), visible in Fig. 1C. The statistical calculations showed that 100 μM concentration had a significant effect in reducing P-selectin expression levels compared to the 10 μM group (P=0.024). However, other pairwise comparisons were not statistically significant (P≥0.052). For the rh-cTNFα treatment groups, the mean fold change compared to the positive control was 1.07, 0.90, and 0.69 for FZP at 1, 10, and 100 μM, respectively, in a dose-dependent pattern. Figure 2C visualizes this pattern. The statistical results indicate that P-selectin was downregulated after incubation with FZP 100 μM compared to both incubations with rh-cTNFα alone (P=0.009) and FZP 1 μM (P=0.046). However, all remaining pairwise comparisons were non-significant (P≥0.157).

Effect of fuzapladib sodium hydrate on CXCL1 protein expression in cytokine-induced CnAOEC

The concentration of CXCL1 protein was quantified using the Canine CXCL1 ELISA kit to determine the effect of FZP on cytokine-induced CnAOEC. As expected, stimulation with both LPS and rh-cTNFα markedly increased CXCL1 levels compared with the negative control (Supplementary Table 3). The conducted ANOVA test showed no significant effect of treatment on CXCL1 expression in LPS-stimulated samples (P=0.286), illustrated in Fig. 3A. In contrast, the overall effect of treatment was statistically significant in the rh-cTNFα-challenged group (F(1.16, 2.32)=20.14, P=0.035), as shown in Fig. 3B. However, Tukey’s post hoc test did not identify significant pairwise differences (P≥0.054), indicating that the reduction represents a downward trend rather than a statistically significant suppression. The partial eta-squared ηρ2 was 0.91, consistent with a very large effect size despite the non-significant pairwise comparisons.

Fig. 3.

Fig. 3.

Effects of fuzapladib sodium hydrate (FZP) on C-X-C motif chemokine ligand 1 (CXCL1) protein expression in cytokine-induced canine aortic endothelial cells (CnAOEC). CnAOEC were stimulated with (A) lipopolysaccharide (LPS; 100 ng/mL) or (B) recombinant canine tumor necrosis factor alpha (rh-cTNFα; 30 ng/mL), either in isolation or combined with FZP (1, 10, or 100 μM) for 24 hr. CXCL1 levels in culture supernatants were measured using a Canine CXCL1 ELISA kit. Data represent mean ± SD from three independent experiments. Statistical significance was determined by RM one-way ANOVA with Tukey’s multiple comparison test (P>0.05).

Effect of fuzapladib sodium hydrate on adhesion molecule gene expression in cytokine-induced canine neutrophils

The effect of FZP on neutrophil adhesion molecule gene expression, including CXCR2, PSGL-1, and L-selectin, was evaluated using neutrophils isolated from three healthy dogs. For each dog, experiments were independently repeated three times. Expression values were normalized within the dogs to the rh-cTNFα–stimulated condition. Subsequently, the gene expression data were averaged for each dog before statistical analysis. Baseline comparisons showed no significant difference in CXCR2 or L-selectin expression between non-stimulated and cTNFα–stimulated neutrophils, but PSGL-1 expression was significantly decreased following stimulation (Supplementary Table 2).

To verify cell survival under the incubation conditions used for gene expression analysis, neutrophil viability was assessed by evaluating membrane integrity using 7-AAD staining in parallel flow cytometry experiments performed under identical conditions. Viability remained high across all treatments (90.6–91.8%) with no significant differences across all groups (P≥0.078), confirming that the observed gene expression changes were not due to cytotoxicity.

The results of this analysis are shown in Fig. 4A–C. They highlight that FZP did not significantly affect CXCR2 gene expression across 1, 10, and 100 μM, with relative fold changes of 0.92, 0.80, and 0.88, respectively (P≥0.368). This is illustrated by Fig. 4A. For PSGL-1, expression increased at 1 μM (1.40-fold) and declined at 10 and 100 μM (0.94- and 0.53-fold, respectively), visible in Fig. 4B. When comparing each result with rh-cTNFα, there was no statistical significance (P≥0.064). However, 100 μM was significantly lower than 10 μM (P=0.037). L-selectin revealed a similar pattern, showing relative fold changes of 1.81, 0.88, and 0.54 (1, 10, and 100 μM, respectively). Importantly, expression at 100 μM was significantly lower than that of the rh-cTNFα-stimulated control (P=0.005), as visualized in Fig. 4C.

Fig. 4.

Fig. 4.

Effects of fuzapladib sodium hydrate (FZP) on adhesion molecule gene expression in recombinant canine tumor necrosis factor alpha (rh-cTNFα)-induced canine neutrophils. Neutrophils from three dogs were pre-incubated with FZP (1, 10, or 100 μM) for 24 hr and then stimulated with rh-cTNFα (20 ng/mL) for 1 hr. Gene expression of (A) C-X-C motif chemokine receptor 2 (CXCR2), (B) P-selectin glycoprotein ligand-1 (PSGL-1), and (C) L-selectin was quantified by qPCR and normalized to rh-cTNFα-stimulated controls. Data represent mean ± SD, averaged per dog. Statistical analysis was performed using RM one-way ANOVA with Tukey’s test (*P<0.05, **P<0.01).

Effect of fuzapladib sodium hydrate on LFA-1 on rh-cTNFα-induced canine neutrophils

This study evaluated whether FZP modulates the expression of LFA-1 (CD11a) in canine neutrophils under rh-cTNFα-stimulated conditions. Neutrophils were isolated from three dogs, and three independent experiments were performed for each animal. The mean value from each dog was used for statistical analysis. The results indicated that stimulation with rh-cTNFα did not significantly alter CD11a expression compared to the negative control (Supplementary Table 4).

The effect of FZP on the mean fluorescence intensity (MFI) of CD11a is shown in Fig. 5A. The mean MFI of the rh-cTNFα control group was 2,818; meanwhile, the FZP-treated groups were 2,892, 2,685, and 2,250 at FZP 1, 10, and 100 μM, respectively. The statistics indicated that there was no significant difference in overall treatment effect (P=0.727). In addition, the flow cytometric analysis also revealed two distinct populations of CD11a-positive cells, characterized by either low or high CD11a expression (Fig. 5B). Consequently, the effect of FZP on the CD11a expression population was determined. The mean percentage of live cells with low CD11a expression was 49.59% in the rh-cTNFα-stimulated group and 49.15%, 53.83%, and 66.70% following FZP treatment at 1, 10, and 100 μM, respectively (Fig. 5C). Conversely, the proportion of live cells showing high CD11a expression was 37.59%, 47.30%, 42.23%, and 41.41% for the rh-cTNFα control, FZP at 1, 10, and 100 μM groups, respectively, as exhibited in Fig. 5D. The results revealed no statistical significance in both the low (P=0.253) and high-expression (P=0.608) populations between any pairs of comparisons.

Fig. 5.

Fig. 5.

Effects of fuzapladib sodium hydrate (FZP) on leukocyte function-associated antigen-1 (LFA-1; CD11a subunit) expression in recombinant canine tumor necrosis factor alpha (rh-cTNFα)-stimulated canine neutrophils. Neutrophils were pre-incubated with FZP (1, 10, or 100 μM) for 24 hr and stimulated with rh-cTNFα (20 ng/mL) for 1 hr. (A) Mean fluorescence intensity (MFI) of CD11a expression. (B) Representative flow-cytometric plots showing distinct CD11a-low and CD11a-high subpopulations. (C and D) Quantitative analysis of low- and high-expression populations, respectively. Each dog was tested in triplicate, using the mean per dog. Data are mean ± SD (n=3). Statistical significance was assessed using RM one-way ANOVA with Tukey’s test, or the Friedman test with Dunn’s correction. No significant differences were detected (P>0.05).

Effect of fuzapladib sodium hydrate on static neutrophil adherence to rh-cTNFα-induced CnAOEC

Given the observed downregulation of P-selectin on endothelial cells following treatment with FZP, the potential effect on neutrophil adhesion to rh-cTNFα-stimulated CnAOEC under static adhesion conditions was further investigated. CnAOEC at passages 4–9 were used for this experiment. Calcein-AM–labeled neutrophils, isolated from three healthy beagles, were applied to the endothelial cell monolayer following treatment. Three independent experiments were performed for each dog, and the mean per dog was used for statistical analysis.

Stimulation with rh-cTNFα induced a marked increase in neutrophil adhesion to CnAOEC compared to the negative control (Supplementary Table 5). The effect of different concentrations of FZP on neutrophil adhesion was evaluated, as shown in Fig. 6. Overall, there was no statistically significant difference in adhesion among the treatment groups (P=0.446). Subsequent pairwise comparisons confirmed the lack of significance between any of the groups (P≥0.683).

Fig. 6.

Fig. 6.

Effect of fuzapladib sodium hydrate (FZP) on static neutrophil adhesion to recombinant canine tumor necrosis factor alpha (rh-cTNFα)-stimulated canine aortic endothelial cells (CnAOEC). CnAOEC were pre-incubated with FZP (1, 10, or 100 μM) for 3 hr and subsequently stimulated with rh-cTNFα (30 ng/mL) for 4 hr. Calcein-AM-labeled neutrophils (1 × 105 cells/well) were added and allowed to adhere for 20 min. Neutrophil adhesion was quantified as relative fluorescence intensity before and after washing. Data represent mean ± SD from three dogs, each tested in three independent experiments. The mean per dog was used for statistical analysis using the Friedman test with Dunn’s post hoc correction, observing no significant effect (P>0.05).

DISCUSSION

This study investigated the effects of FZP on adhesion molecules in CnAOEC and canine neutrophils, focusing on E-selectin, ICAM-1, P-selectin, CXCL1, CXCR2, PSGL-1, L-selectin, and LFA-1. Across both stimuli, low concentrations of FZP (1 and 10 μM) showed no significant effect on E-selectin and ICAM-1 gene expression compared to the stimulation controls, yet 100 μM resulted in a significant increase in expression levels. These findings are consistent with earlier observations in HUVEC, where pretreatment with 1 μM FZP did not reduce ICAM-1 protein expression after LPS stimulation [25]. In contrast, P-selectin expression illustrated a dose-response profile: rh-cTNFα-stimulated CnAOEC showed a significant reduction at 100 μM, and LPS-stimulated cells demonstrated a similar downward trend, though not significant. A notable aspect of the endothelial response was the divergent behavior of P-selectin and ICAM-1 at 100 μM. This difference indicates a specific modulation of signaling pathways rather than overall cytotoxicity, which would usually inhibit global protein synthesis. One possible explanation is a functional compensatory mechanism that responds with an increase in ICAM-1 expression in response to selectin suppression to maintain adhesive quality [4].

In addition to adhesion molecules, this study examined the CXCL1-CXCR2 axis, a key pathway in neutrophil recruitment and survival [16]. Dysregulated CXCL1 expression contributes to inflammation and chronic injury in multiple organs [34]. In this study, both LPS and rh-cTNFα strongly induced CXCL1 secretion from CnAOEC, confirming the expected pro-inflammatory activation. FZP did not change CXCL1 levels under LPS stimulation. In rh-cTNFα-stimulated conditions, the overall treatment effect was statistically significant, but post hoc comparisons were not. The reduction at 100 μM should therefore be interpreted as a non-significant downward trend rather than confirmed suppression. Notably, the effect size was very large ηρ2 , indicating that FZP accounted for substantial variance in CXCL1 level despite the limited statistical power. This observation is consistent with a previous report showing reduced cytokine-induced neutrophil chemoattractant (CINC), the rodent homolog of CXCL1, following FZP treatment in an inflammatory model [35]. Given the established role of the CXCL1-CXCR2 axis in neutrophil-mediated tissue injury, including severe lung conditions [24] and acute pancreatitis, in which fibroblast-derived CXCL1 contributes to inflammation [32], even a partial reduction of CXCL1 has been reported to influence neutrophil infiltration and inflammatory pathology. Related preclinical findings, such as reduced macrophage infiltration [15] and improved clinical outcome in canine acute pancreatitis [6], further support the possibility that FZP influences this cytokine pathway, though confirmation will require studies with larger sample sizes.

TNFα is a well-known proinflammatory cytokine that activates neutrophils. The transcriptional responses observed in rh-cTNFα-stimulated neutrophils were consistent with established models of leukocyte activation. PSGL-1 was significantly downregulated, whereas CXCR2 and L-selectin remained comparable to non-stimulated controls. These patterns are compatible with the predominance of rapid ectodomain shedding from the surface rather than transcriptional modulation [2, 14, 20]. Interestingly, high concentrations of FZP further decreased L-selectin and PSGL-1 mRNA expression. Because L-selectin mediates leukocyte rolling and secondary tethering between leukocytes [1, 3, 17, 26], and PSGL-1 cooperates with L-selectin to initiate LFA-1 activation [27], the observed reductions in L-selectin and PSGL-1 suggest that FZP may interfere with early steps of neutrophil recruitment. This interpretation is consistent with the established role of L-selectin in directing lymphocyte migration through high endothelial venules [31].

In addition to transcriptional responses, the effect of FZP on neutrophil surface expression of LFA-1 (CD11a) was examined. rh-cTNFα stimulation did not increase CD11a surface expression compared with control conditions. This is consistent with the established biology of LFA-1, in which cytokines typically regulate integrin affinity rather than total surface levels [30]. Accordingly, MFI analysis was used to determine whether FZP altered CD11a expression on rh-cTNFα-stimulated neutrophils. Total LFA-1 (CD11a) expression remained similar across all treatment groups. Although a numerical increase in the proportion of cells in the low-expression subset was observed at 100 μM FZP, this redistribution did not reach statistical significance. Consequently, it is suggested that FZP does not primarily affect surface expression or population distributions under these conditions. This pattern is consistent with the previous report indicating that FZP and related inhibitors can reduce integrin activation, such as LFA-1 and MAC-1, in inflammatory models, limiting their conformational activation and adhesive function [25].

The functional relevance of these molecular changes was examined using a static neutrophil adhesion assay. As expected, rh-cTNFα stimulation significantly increased neutrophil adhesion to CnAOEC. Pretreatment of endothelial cells with FZP did not affect adhesion across all treatment groups, indicating that suppression of P-selectin transcription alone is insufficient to affect static adhesion in vitro. This is consistent with previous studies showing that P-selectin is essential for the initial tethering of polymorphonuclear leukocytes. However, by itself, it cannot support firm adhesion without additional activating signals, such as platelet-activating factors [19]. P-selectin has also been involved in several inflammatory pathologies, including dermatitis, lung injury, ischemia, myocardial damage, and arterial thrombosis [7, 21, 28]. Thus, although no significant effects were detected in this static adhesion assay, which primarily relies on integrin-mediated firm adhesion, the observed P-selectin suppression remains biologically significant for the earlier stages of the adhesion cascade. Because P-selectin mediates initial tethering and rolling under physiological flow conditions, its downregulation by FZP suggests a potential to attenuate the recruitment phase of inflammation. Furthermore, only endothelial cells were exposed to FZP in this assay, and neutrophil integrin activation was therefore unlikely to be affected, which may further explain the absence of changes in firm adhesion in this study.

Taken together, these results suggest that FZP modulates several adhesion molecules in endothelial cells and neutrophils in a dose-dependent manner. In CnAOEC, the most consistent effect was suppression of P-selectin and a potential reduction of CXCL1 secretion. Yet, in neutrophils, decreases in L-selectin and PSGL-1 were observed. Although statistical significance was not achieved across multiple assays, the overall downward trends in both cell types support the possibility that FZP influences the early steps of neutrophil recruitment, particularly the rolling and tethering phases. It should be noted that most of the notable effects occurred at 100 μM, which exceeds the expected peak plasma concentration (Cmax) observed in dogs treated with the clinical dose at 0.4 mg/kg [29]. Consequently, these findings should be interpreted as in vitro mechanistic observations demonstrating the potential effect rather than a direct reflection of therapeutic plasma concentration.

However, this study has several limitations. The experiments were performed under static in vitro conditions, which do not replicate physiological shear stress or dynamic interactions that occur in vivo. The number of donor dogs and the range of FZP concentrations were also limited, which may influence the statistical power. Most observations were derived from gene expression analyses, with restricted confirmation at the protein level. In the present static adhesion assay, FZP treatment was restricted to endothelial cells to specifically isolate the endothelial contribution to neutrophil recruitment. Consequently, the direct effects of FZP on the neutrophil side were not evaluated in this functional assay. Future studies should employ flow-based adhesion assays, which more accurately replicate physiological conditions, and co-incubation assays under cytokine-induced conditions to clarify downstream consequences. Additional experiments with larger sample sizes and protein-level analyses, as well as further investigation of the underlying mechanisms, would help confirm the biological relevance of FZP. Overall, the present findings provide experimental support that FZP has anti-inflammatory effects by modulating adhesion molecules and neutrophil trafficking.

CONFLICT OF INTEREST

The authors declare that they have no competing financial interests or personal relationships that could have influenced the work reported in this study.

Supplementary Material

jvms-88-3-471-s001.pdf (932.8KB, pdf)

Acknowledgments

The authors would like to thank the staff of the Laboratory of Veterinary Surgery, Department of Veterinary Clinical Science, Hokkaido University, for their valuable technical assistance and continuous support throughout this study. We are also grateful to the animal care staff for their assistance with sample collection and to our colleagues for constructive discussions.

REFERENCES

  • 1.Alon R, Fuhlbrigge RC, Finger EB, Springer TA. 1996. Interactions through L-selectin between leukocytes and adherent leukocytes nucleate rolling adhesions on selectins and VCAM-1 in shear flow. J Cell Biol 135: 849–865. doi: 10.1083/jcb.135.3.849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Asagoe K, Yamamoto K, Takahashi A, Suzuki K, Maeda A, Nohgawa M, Harakawa N, Takano K, Mukaida N, Matsushima K, Okuma M, Sasada M. 1998. Down-regulation of CXCR2 expression on human polymorphonuclear leukocytes by TNF-alpha. J Immunol 160: 4518–4525. doi: 10.4049/jimmunol.160.9.4518 [DOI] [PubMed] [Google Scholar]
  • 3.Bargatze RF, Kurk S, Butcher EC, Jutila MA. 1994. Neutrophils roll on adherent neutrophils bound to cytokine-induced endothelial cells via L-selectin on the rolling cells. J Exp Med 180: 1785–1792. doi: 10.1084/jem.180.5.1785 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bullard DC, Kunkel EJ, Kubo H, Hicks MJ, Lorenzo I, Doyle NA, Doerschuk CM, Ley K, Beaudet AL. 1996. Infectious susceptibility and severe deficiency of leukocyte rolling and recruitment in E-selectin and P-selectin double mutant mice. J Exp Med 183: 2329–2336. doi: 10.1084/jem.183.5.2329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X, Zhao L. 2017. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 9: 7204–7218. doi: 10.18632/oncotarget.23208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cridge H, Lim SY, Algül H, Steiner JM. 2022. New insights into the etiology, risk factors, and pathogenesis of pancreatitis in dogs: Potential impacts on clinical practice. J Vet Intern Med 36: 847–864. doi: 10.1111/jvim.16437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Doré M, Sirois J. 1996. Regulation of P-selectin expression by inflammatory mediators in canine jugular endothelial cells. Vet Pathol 33: 662–671. doi: 10.1177/030098589603300605 [DOI] [PubMed] [Google Scholar]
  • 8.Doré M, Simon SI, Hughes BJ, Entman ML, Smith CW. 1995. P-selectin- and CD18-mediated recruitment of canine neutrophils under conditions of shear stress. Vet Pathol 32: 258–268. doi: 10.1177/030098589503200307 [DOI] [PubMed] [Google Scholar]
  • 9.Filep JG. 2022. Targeting Neutrophils for Promoting the Resolution of Inflammation. Front Immunol 13: 866747. doi: 10.3389/fimmu.2022.866747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Habtezion A. 2015. Inflammation in acute and chronic pancreatitis. Curr Opin Gastroenterol 31: 395–399. doi: 10.1097/MOG.0000000000000195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hines OJ, Pandol SJ. 2019. Management of severe acute pancreatitis. BMJ 367: l6227. doi: 10.1136/bmj.l6227 [DOI] [PubMed] [Google Scholar]
  • 12.Imamura T, Niikawa J, Kitamura K, Takahashi A, Ikegami A, Yoshida H, Tanaka S, Mitamura K. 2003. Effect of IS-741 on ethionine-induced acute pancreatitis in rats: relation to pancreatic acinar cell regeneration. J Gastroenterol 38: 260–267. doi: 10.1007/s005350300045 [DOI] [PubMed] [Google Scholar]
  • 13.Isaji S, Hayashi J, Higashiguchi T, Yokoi H, Ogura Y, Noguchi T, Kawarada Y. 1999. Effect of IS-741 (a new synthetic antiinflammatory agent) on acute necrotizing pancreatitis in dogs. Significance of its inhibitory effect on cytosolic phospholipase A2. Digestion 60 Suppl 1: 47–51. doi: 10.1159/000051453 [DOI] [PubMed] [Google Scholar]
  • 14.Ivetic A, Hoskins Green HL, Hart SJ. 2019. L-selectin: a major regulator of leukocyte adhesion, migration and signaling. Front Immunol 10: 1068. doi: 10.3389/fimmu.2019.01068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kaji N, Iwaoka K, Nakamura S, Tsukamoto A. 2023. Fuzapladib reduces postsurgical inflammation in the intestinal muscularis externa. J Vet Med Sci 85: 1151–1156. doi: 10.1292/jvms.23-0257 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Korbecki J, Gąssowska-Dobrowolska M, Wójcik J, Szatkowska I, Barczak K, Chlubek M, Baranowska-Bosiacka I. 2022. The importance of CXCL1 in physiology and noncancerous diseases of bone, bone marrow, muscle and the nervous system. Int J Mol Sci 23: 4205. doi: 10.3390/ijms23084205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kunkel EJ, Chomas JE, Ley K. 1998. Role of primary and secondary capture for leukocyte accumulation in vivo. Circ Res 82: 30–38. doi: 10.1161/01.RES.82.1.30 [DOI] [PubMed] [Google Scholar]
  • 18.Li Y, Imaizumi T, Matsumiya T, Seya K, Kawaguchi S, Ding J, Ohkuma H. 2020. Polyinosinic-polycytidylic acid induces CXCL1 expression in cultured hCMEC/D3 human cerebral microvascular endothelial cells. Neuroimmunomodulation 27: 38–47. doi: 10.1159/000506482 [DOI] [PubMed] [Google Scholar]
  • 19.Lorant DE, Topham MK, Whatley RE, McEver RP, McIntyre TM, Prescott SM, Zimmerman GA. 1993. Inflammatory roles of P-selectin. J Clin Invest 92: 559–570. doi: 10.1172/JCI116623 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Marsik C, Mayr F, Cardona F, Schaller G, Wagner OF, Jilma B. 2004. Endotoxin down-modulates P-selectin glycoprotein ligand-1 (PSGL-1, CD162) on neutrophils in humans. J Clin Immunol 24: 62–65. doi: 10.1023/B:JOCI.0000018064.13793.83 [DOI] [PubMed] [Google Scholar]
  • 21.Minamino T, Kitakaze M, Asanuma H, Tomiyama Y, Shiraga M, Sato H, Ueda Y, Funaya H, Kuzuya T, Matsuzawa Y, Hori M. 1998. Endogenous adenosine inhibits P-selectin-dependent formation of coronary thromboemboli during hypoperfusion in dogs. J Clin Invest 101: 1643–1653. doi: 10.1172/JCI635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Okanishi H, Kagawa Y, Watari T. 2014. Expression of selectins and P-selectin glycoprotein ligand-1 in dogs with lymphocytic-plasmacytic enteritis. Vet Immunol Immunopathol 161: 42–48. doi: 10.1016/j.vetimm.2014.06.005 [DOI] [PubMed] [Google Scholar]
  • 23.Park SA, Hyun YM. 2016. Neutrophil extravasation cascade: what can we learn from two-photon intravital imaging? Immune Netw 16: 317–321. doi: 10.4110/in.2016.16.6.317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sawant KV, Xu R, Cox R, Hawkins H, Sbrana E, Kolli D, Garofalo RP, Rajarathnam K. 2015. Chemokine CXCL1-mediated neutrophil trafficking in the lung: role of CXCR2 activation. J Innate Immun 7: 647–658. doi: 10.1159/000430914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shikama H, Yotsuya S, Satake S, Sugi H, Kato M. 1999. Effect of IS-741 on cell adhesion between human umbilical vein endothelial cells and HL-60 cells. Biol Pharm Bull 22: 127–131. doi: 10.1248/bpb.22.127 [DOI] [PubMed] [Google Scholar]
  • 26.Spertini O, Luscinskas FW, Kansas GS, Munro JM, Griffin JD, Gimbrone MA, Jr., Tedder TF. 1991. Leukocyte adhesion molecule-1 (LAM-1, L-selectin) interacts with an inducible endothelial cell ligand to support leukocyte adhesion. J Immunol 147: 2565–2573. doi: 10.4049/jimmunol.147.8.2565 [DOI] [PubMed] [Google Scholar]
  • 27.Stadtmann A, Germena G, Block H, Boras M, Rossaint J, Sundd P, Lefort C, Fisher CI, Buscher K, Gelschefarth B, Urzainqui A, Gerke V, Ley K, Zarbock A. 2013. The PSGL-1-L-selectin signaling complex regulates neutrophil adhesion under flow. J Exp Med 210: 2171–2180. doi: 10.1084/jem.20130664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tremblay C, Paradis M, Doré M. 2001. Expression of E- and P-selectin in tumor necrosis factor-induced dermatitis in dogs. Vet Pathol 38: 261–268. doi: 10.1354/vp.38-3-261 [DOI] [PubMed] [Google Scholar]
  • 29.U.S. Food and Drug Administration. 2022. Freedom of Information Summary, Conditional Approval NADA 141–567, PANOQUELL®-CA1 (fuzapladib sodium for injection). https://animaldrugsatfda.fda.gov/adafda/app/search/public/document/downloadFoi/13134 [accessed on November 29, 2025].
  • 30.van Kooyk Y, Figdor CG. 2000. Avidity regulation of integrins: the driving force in leukocyte adhesion. Curr Opin Cell Biol 12: 542–547. doi: 10.1016/S0955-0674(00)00129-0 [DOI] [PubMed] [Google Scholar]
  • 31.von Andrian UH, Mempel TR. 2003. Homing and cellular traffic in lymph nodes. Nat Rev Immunol 3: 867–878. doi: 10.1038/nri1222 [DOI] [PubMed] [Google Scholar]
  • 32.Wang Q, Zhang X, Han C, Lv Z, Zheng Y, Liu X, Du Z, Liu T, Xue D, Li T, Wang L. 2025. Immunodynamic axis of fibroblast-driven neutrophil infiltration in acute pancreatitis: NF-κB-HIF-1α-CXCL1. Cell Mol Biol Lett 30: 57. doi: 10.1186/s11658-025-00734-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wilhelmsen K, Farrar K, Hellman J. 2013. Quantitative in vitro assay to measure neutrophil adhesion to activated primary human microvascular endothelial cells under static conditions. J Vis Exp 78: e50677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wu CL, Yin R, Wang SN, Ying R. 2021. A review of CXCL1 in cardiac fibrosis. Front Cardiovasc Med 8: 674498. doi: 10.3389/fcvm.2021.674498 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yamaguchi Y, Okabe K, Liang J, Matsumura F, Akizuki E, Matsuda T, Ohshiro H, Nakano S, Ishihara K, Ogawa M. 1999. The novel carboxamide derivative IS-741 reduces neutrophil chemoattractant production by bronchoalveolar macrophages in rats with cerulein-induced pancreatitis complicated by sepsis. Digestion 60 Suppl 1: 52–56. doi: 10.1159/000051454 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

jvms-88-3-471-s001.pdf (932.8KB, pdf)

Articles from The Journal of Veterinary Medical Science are provided here courtesy of Japanese Society of Veterinary Science

RESOURCES