Skip to main content
NCBI home page
Cellular Oncology logoLink to Cellular Oncology
. 2014 Dec 1;37(6):439–454. doi: 10.1007/s13402-014-0207-3

Apoptosis induction by an analog of curcumin (BDMC-A) in human laryngeal carcinoma cells through intrinsic and extrinsic pathways

Kumaravel Mohankumar 1, Sankar Pajaniradje 1, Subhashree Sridharan 1, Vivek Kumar Singh 2, Larance Ronsard 3, Akhil C Banerjea 3, Benson Chellakkan Selvanesan 4, Mohane Selvaraj Coumar 2, Latha Periyasamy 1, Rukkumani Rajagopalan 1,✉
PMCID: PMC13004476  PMID: 25433549

Abstract

Background

Head and neck cancer is the sixth most frequently occurring cancer worldwide and accounts for about 2 % of all cancer-related deaths annually. Curcumin is a well-known chemopreventive agent, and apoptosis induction by curcumin has been reported in many cancer cell types. We synthesized an ortho-hydroxy substituted analog of curcumin, bisdemethoxycurcumin analog (BDMC-A), and aimed to demarcate the apoptotic effects induced by BDMC-A on human laryngeal cancer Hep-2 cells and to compare these effects with those induced by curcumin.

Methods

We evaluated the apoptotic effects of BDMC-A in comparison to those of curcumin on Hep-2 cells by performing Western blotting, RT-PCR, fluorescent staining and DNA fragmentation assays. In addition, we carried out an in silico molecular docking study on the EGFR kinase domain.

Results

We found that BDMC-A can induce apoptosis in Hep-2 cells by regulating the expression of both intrinsic and extrinsic apoptotic proteins, i.e., Bcl-2, Bax, apoptososme complex and death receptors, more efficiently than curcumin. We also observed increased nuclear fragmentation and chromatin condensation after BDMC-A treatment compared to curcumin treatment. Depolarized mitochondria and ROS generation was well pronounced in both BDMC-A and curcumin treated Hep-2 cells. Our in silico molecular docking study on the EGFR kinase domain revealed that BDMC-A may dock more efficiently than curcumin.

Conclusions

From our results we conclude that BDMC-A can induce apoptosis in Hep-2 laryngeal carcinoma cells more effectively than curcumin, and that this activity can be attributed to the presence of a hydroxyl group at the ortho position within this compound.

Keywords: Hep-2, BDMC-A, Apoptosis, Western blotting, RT-PCR, EGFR docking

Introduction

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and includes tumors of the pharynx, oral cavity and larynx [1–4]. Curcumin (diferuloylmethane), a principle ingredient in the spice turmeric, is well known for its anti-carcinogenic, anti-inflammatory and pharmacological properties [5]. Previous studies indicate that the efficacy of curcumin is due to its multi-targeting effect on cancer cells. Currently known targets of curcumin include several cell survival and proliferation-related transcription factors (e.g., NF-kB, AP-1, STAT3, PPAR-γ) [6–8], metastasis and angiogenesis-related factors (e.g., VEGF, ICAM-1 COX-2, MMP-9) [9], kinases (e.g., EGFR, ERK, JAK, PKB) [10] and cytokines (e.g., TNF, IL-1, IL-6 MIP) [11]. Induction of apoptosis is a central dogma in cancer treatment. Previous reports have shown that curcumin can induce apoptosis in many cancer types, including breast, colon, lung, liver, prostate and hematopoietic cancers [12]. It selectively induces apoptosis in tumor cells through mitochondria-associated intrinsic and death receptor-mediated extrinsic pathways. In addition, curcumin has been shown to be able to inhibit the initiation and malignant transformation of tumor cells [13]. Many curcumin analogs have been reported to induce apoptosis in different cancers but, as yet, the mechanisms underlying these diverse effects are not well understood.

Previously, we showed that our newly synthesiszed compound, bisdemethoxycurcumin analog (BDMC-A), exhibits potent anti-oxidant [14], anti-tumor and anti-mutagenic [15] activities. Additional effects of BDMC-A on alcohol- and ΔPUFA-induced oxidative stress [16], hyperlipidemia [17] and matrix metalloproteinase [18] have also been reported by our lab. BDMC-A has also been assessed for its anti-carcinogenic effects on colon cancer DMH-treated rats [19] and, in addition, the anti-proliferative and cell cycle arrest potential of BDMC-A in Hep-2 cells has been compared to curcumin [20]. Here, we aimed to delineate the molecular mechanisms underlying apoptosis induction by BDMC-A in Hep-2 cells compared to curcumin.

In laryngeal squamous cell carcinoma, EGFR over-expression is an early event that demarcates the transformation from dysplasia to neoplasia. EGFR signals to PI3K to propagate the phosphorylation of Akt. The activated form of Akt, p-Akt, promotes cell survival and proliferation. In normal cells, the PI3K/Akt pathway plays a prominent role in the regulation of cellular growth and proliferation, and in maintaining tissue homeostasis. Recent research has also emphasized a role of PI3K in HNSCC [21]. The downstream signaling cascade of PI3K/Akt involves the tumor suppressor p53 which, in turn, activates Bax [22]. Curcumin, which has been approved by the FDA, appears to act as a multiple-edged sword that can induce p53-medated apoptosis in several different cancer types [23].

There are two major apoptotic pathways, i.e., an extrinsic pathway and an intrinsic (mitochondria-mediated) pathway. In the extrinsic pathway, apoptosis is induced via the death receptor cascade [24, 25] that activates caspase-8 which, in turn, activates downstream effector caspases, particularly caspase-3, that ultimately culminate in apotosis-specific morphological changes. Features of the intrinsic pathway include permeabilization of outer mitochondrial membranes and release of cytochrome c from the mitochondrial intermembranous space into the cytosol. This release of cytochrome c is regulated by the anti-apoptotic protein Bcl-2 and the pro-apoptotic protein Bax, i.e., the Bcl-2/Bax ratio. Activation of caspase-3 through the cytochrome c/Apaf-1/caspase-9 containing apoptosome complex leads to PARP cleavage and DNA fragmentation, thereby inducing apoptosis [26, 27]. Here, we investigated the mechanisms underlying BDMC-A induced apoptosis in Hep-2 cells and compared them with those induced by curcumin.

Materials and methods

Chemicals and reagents

Curcumin (1,7 – bis - (4- hydroxy -3-methoxyphenyl) -1,6- hepatadiene -3,5- dione; diferuloyl methane), Dulbecco’s Modified Eagle Medium (DMEM), antibiotics and fetal bovine serum (FBS), the Annexin V Cy3 kit, Acridine Orange (AO), Ethidium Bromide (EtBr), dimethylsulfoxide (DMSO), Hoechst 33258, Propidium Iodide (PI), Rhodamine 123 (Rh123) and 2′-7′-Dichlorodihydrofluorescein diacetate (DCFH-DA) were purchased from Sigma-Aldrich, Bangalore, India. Primary antibodies against Bcl-2, Bax, caspase-3, caspase-8, caspase-9, cytochrome c, p53, FasL, PARP, PI3K and pAkt were purchased from Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA and Cell Signaling Technology, USA. The secondary antibodies were also obtained from Santacruz Biotechnology Inc.

Curcumin analog synthesis

The curcumin analog BDMC-A (bisdemethoxycurcumin analog, Fig. 1), was synthesized as per method described earlier [28].

Fig. 1.

Fig. 1

Open in a new tab

a Structure of BDMC-A and b structure of curcumin

Cells and culture conditions

Hep-2 cells were obtained from NCCS, Pune, India. The cells were grown in DMEM medium supplemented with 10 % FBS and maintained at 37 °C in an atmosphere of humidified 5 % CO2 and 95 % air. The culture medium was changed every 48 h and the cells were split when they reached confluence.

Western blotting

Western blotting was carried out as described before [29]. Briefly, Hep-2 cells were grown in a 6-well plate and pre-selected concentrations of curcumin and BDMC-A were added. After 24 h, nuclear and cytosolic proteins were extracted and protein concentrations were determined using a Bio-Rad Bradford protein assay. Protein samples were resolved by 12 % sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and electro-transferred to nitrocellulose membranes. These membranes were blocked in blocking buffer containing 5 % non fat dry milk. Next, primary antibodies were added and the membranes were incubated at 4 °C overnight. After this, the membranes were incubated with corresponding secondary antibodies for 1 h. β-actin served as a control for protein loading. Protein bands were revealed by enhanced chemiluminescence in conjunction with ECL (Pierce, Rockford, IL, USA) and Chemi Doc Imaging System (Bio-Rad, Hercules, CA, USA), respectively.

RT-PCR

Hep-2 cells were grown in 6 well-plates and pre-selected concentrations of curcumin and BDMC-A were added. After 12 h treatment, total RNA was extracted using TRIzol [30] according to the manufacturer’s instructions. Reverse transcription was performed with 2 μg of total RNA using gene-specific upstream and downstream primers (Bcl-2- upstream - 5′- attgggaagtttcaaatcagc - 3′, downstream - 5′- tgcattcttggacgaggg- 3′, Bax - upstream - 5′- gctggacattggacttcctc - 3′, downstream - 5′- ctcagcccatcttcttccag - 3′). The respective mRNA expression levels were normalized to GAPDH (upstream - 5′- cgaccactttgtcaagctca - 3′, downstream - 5′ - cccctcttcaaggggtctac - 3′) in the same samples. PCR products were analyzed by electrophorsis in 2 % agarose gels and ethidium bromide staining. The signals were captured using a gel documentation system.

Detection of morphological changes by Hoechst 33258 staining

Cell nuclear morphologies were evaluated by Hoechst 33258 fluorescent DNA staining. To this end, Hep-2 cells were seeded in 24-well plates at a density of 105 cells per well and grown for 24 h. Next, the cells were treated with BDMC-A (10 μM) or curcumin (25 μM) for 24 h. IC50 concentrations and cytostatic doses were derived from our previous work [20]. After this, the cells were washed with phosphate buffered saline (PBS), fixed with methanol, suspended in 8 μg/ml Hoechst-33258 and incubated for 30 min at 37 °C in the dark. Finally, the cells were washed with PBS and examined under an inverted fluorescence microscope (Nikon).

Detection of apoptosis by AO/EB staining

Acridine Orange/Ethidium Bromide (AO/EB) staining was carried out to detect apoptosis-related morphological changes. To this end, Hep-2 cells were treated with BDMC-A or curcumin for 24 h, washed with PBS and trypsinized. A 25 μl cell suspension (1 × 104 cells/ml) was mixed with 1 μl AO/EB solution (one part each of 100 μg/ml acridine orange and 100 μg/ml ethidium bromide in PBS) prior to microscopy. Next, 10 μl of gently mixed suspension was placed on a microscope slide, covered with a glass slip and examined under a fluorescence microscope (Olympus) equipped with a digital imaging system.

Evaluation of DNA integrity by Propidium Iodide staining

DNA integrity was evaluated using Propidium Iodide (PI) staining as reported before [31]. Briefly, Hep-2 (3 × 106 cells/ml) cells were grown in 6-well plates, treated with BDMC-A or curcumin for 24 h, washed with ice cold PBS and fixed in 70 % ethanol. Next, the cells were washed twice with PBS and 0.5 ml PI buffer containing 0.1 % Triton X-100, 0.1 % sodium citrate, 5 μl RNase A (1 mg/mL) and 5 μl PI (50 μg/ml in PBS) was added. This mixture was incubated at 37 °C for 1 h and evaluated under fluorescent microscope (Olympus).

Detection of early apoptosis by Annexin V Cy3 staining

An Annexin V Cy3™ (APO–AC, Sigma) kit was used to detect early stages of apoptosis. This kit contains two fluorescent labels to measure cell viability and apoptosis. Non-fluorescent 6 carboxyfluorescein diacetate (6-CFDA) becomes hydrolyzed to a green fluorescent compound, 6-carboxyfluorescein (6-CF), by esterase present in living cells. AnnexinV-Cy3.18 (AnnCy3) binds to phosphatidylserine (PS) that is present on the outer leaflet of the plasma membrane of cells that undergo apoptosis (observed as red fluorescence). Living cells are stained only with 6-CF (green), whereas cells in early stages of apoptosis are stained with both AnnCy3 (red) and 6-CF (green). Hep-2 cells were treated with BDMC-A or curcumin for 24 h, fluorescently stained according to the manufacturer’s protocol and evaluated under a fluorescent microscope (Nikon, Eclipse).

Measurement of mitochondrial membrane potential (ΔΨm) by Rhodamine 123

Rhodamine 123 (Rh123) is a fluorescent dye that accumulates in polarized mitochondrial membranes of normal cells. This cationic dye binds to metabolically active mitochondria. Curcumin or BDMC-A treated cells were fixed with ice cold methanol for 30 min and incubated with 5 μg/ml Rh 123 at 37 °C for 30 min. After incubation, the cells were washed once with PBS. The intensity of Rh 123 staining was measured by fluorescence microscopy at an excitation wave length of 505 nm with an emission filter of 534 nm (Nikon).

Intracellular reactive oxygen species (ROS) imaging

Intracellular reactive oxygen species (ROS) generation was measured by the oxidative-sensitive fluorescent probe 2′-7′- Dichlorodihydrofluorescein diacetate (DCFH-DA). To evaluate the involvement of ROS in cytotoxicity, qualitative fluorescence microscopic analyses were performed after DCFH-DA staining. Briefly, 0.2 × 106 cells were cultured in a 6‐well plate for 48 h in DMEM and, subsequently, exposed to pre-determined doses of BDMC-A or curcumin for 24 h. Following incubation, the cells were washed once with PBS and then stained with 10 μM DCF-DA for 30 min at 37 °C in the dark. After this, the cells were washed twice with chilled PBS. Stain-positive areas were evaluated and photographed using a fluorescence microscope (Nikon; DCFH-DA Ex 488 nm, Em 520 nm).

DNA fragmentation assay

Cells (0.2 × 106) were seeded in 6-well plates and curcumin or BDMC-A were added at pre-determined concentrations for 24 h. After harvesting, the cells were washed with PBS and pelleted by centrifugation. The cell pellets were treated with 100 μl lysis buffer and centrifuged, after which the supernatant was collected and treated overnight with RNase A (5 μg/ml) and proteinase K (2.5 μg/ml) for 4 h at 37 °C. After addition of 0.5 v/v 10 M ammonium acetate, the DNA was precipitated with 2.5 v/v ice cold ethanol and the DNA fragments were separated by gel electrophoresis. This method separates only fragmented and not intact genomic DNA.

Docking of curcumin and BDMC-A to EGFR

In silico docking of curcumin and BDMC-A to the EGFR kinase domain (PDB ID: 1M17) was performed using the Glide procedure (Glide, version 5.7, Schrödinger, Inc., New York, NY, 2011) as reported before [32]. In brief, ligand structures were drawn using Chemdraw software and then subjected to ligand preparation using the LigPrep module of Schrödinger 2010 (v9.1) keeping default values, to generate possible conformations and ionization states of the ligands. Next, the protein structure was prepared using the Protein Preparation Wizard of the Schrödinger module by assigning all the bond orders, adding hydrogen atoms and removing all the crystallographic water molecules from the protein. The Prime Module of Schrödinger was used to add missing residues and loops to the protein. Finally, energy minimization was carried out using the OPLS-2005 force field with implicit solvation. Next, the prepared protein-ligand complex was employed to build energy grids using the default values of protein atom scaling (1.0) within a cubic box around the centroid of the co-crystallized ligand (Erlotinib). The boundary box dimensions (within which the centroid of a docked pose is confined) were set at 20 Å × 20 Å × 20 Å. The above generated grid files were used for docking the ligands in the Glide Xtra Precision (XP) mode. Default parameters were utilized, except for the energy minimization steps (n = 200), for carrying out the docking of the ligand to the protein in a flexible mode. The docking poses of the ligands were used to calculate the binding free energies (ΔG bind) of the ligands, using PRIME oftware (Prime, version 2.2, Schrödinger, Inc., New York, NY, 2011) in conjunction with the Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) methodology. The ligand poses were minimized using the local optimization feature in Prime, and the energies of the complexes were calculated with the OPLS-2005 force field and the Generalized-Born/Surface Area continuum solvent model. During the simulation process, the ligand strain energy was also considered.

Statistical analyses

All the data were analyzed using the SPSS 7.5-Windows Students version software (SPSS Inc., Chicago, IL, USA). For all the measurements, one-way ANOVA followed by Tukey’s test was used to assess the statistical significance between groups. A statistically significant difference was considered when p ≤ 0.05.

Results

BDMC-A and curcumin affect the PI3K/Akt/p53 pathway

The PI3K/Akt pathway is known to mediate several cellular processes including growth, proliferation and survival. Alterations in this pathway through chemopreventive agents is known to induce apoptosis. In BDMC-A treated Hep-2 cells, we observed a significant decrease in PI3K protein expression compared to that in curcumin treated cells (Fig. 2a and b(i)). A downstream target of PI3K is Akt. In BDMC-A treated Hep-2 cells we also observed a decrease in (activated) pAkt expression, as shown in Fig 2a and b(ii). Treatment with BDMC-A also elicited a significant upregulation of p53 expression in a dose- and time-dependent manner (Fig. 3a and b(i), c(i and ii), which is a hallmark of the intrinsic apoptotic pathway.

Fig. 2.

Fig. 2

Open in a new tab

a Effect of BDMC-A and curcumin on the expression of PI3K/AKT proteins. Hep-2 cells were incubated with 25 μM curcumin and 10 μM BDMC-A for 24 h. Western blots were prepared and probed with antibodies. β-Actin was used as an internal loading control. b Protein levels were quantified using densitometry analysis and are expressed as relative band intensities. Values are expressed as mean ± Standard Deviation (SD) of three independent experiments. ANOVA followed by Tukey’s test was used to assess the statistical significance between groups. *: p ≤ 0.05 level significance relative to control group

Fig. 3.

Fig. 3

Open in a new tab

Time- and dose-dependent expression of p53 and cytochrome c. Hep-2 cells were incubated with 25 and 50 μM curcumin and 10 and 20 μM BDMC-A for 12 (a) and 24 h (b). Western blots were prepared and probed with antibodies. β-Actin was used as internal loading control. 3c (i) and (ii): Densitometric analyses after 12 h and 24 h treatment, respectively. Protein levels were quantified using densitometry analysis and expressed by relative band intensities. Values are expressed as mean ± Standard Deviation (SD) of three independent experiments. ANOVA followed by Tukey’s test was used to assess the statistical significance between groups. *: p ≤0.05 level significance relative to control group

BDMC-A regulates intrinsic apoptotic signaling molecules

To investigate intracellular signaling involved in apoptosis in Hep-2 cells after treatment with BDMC-A or curcumin, we analysed the intrinsic apoptosis markers Bcl-2, Bax, cytochrome c, Apaf-1, caspase-9, caspase-3 and PARP cleavage. By doing so, we found that BDMC-A was able to increase the level of cytochrome c in a time- and dose-dependent manner (Fig. 3a and b(ii), c(i and ii). A significant upregulation of Bax and a downregulation of Bcl-2 in BDMC-A treated cells compared to curcumin treated cells was observed (Fig. 4a and b(i and ii)). Also, upregulation of Apaf-1 (Fig. 4a and b(iii)) and downregulation of caspase-9 (Fig. 4a and b(iv)) were observed more effectively after BDMC-A treatment than after curcumin treatment. BDMC-A treatment significantly upregulated the effector caspase-3 (Fig. 4a and b(v)), including an induction of PARP cleavage (Fig. 4a and b (vi)), to induce apoptosis more effectively than curcumin treatment. After mRNA expression analysis, we found that the Bcl-2 level (Fig. 5a and c(i)) was downregulated, whereas the Bax level (Fig. 5b and c(ii)) was significantly upregulated, after BDMC-A treatment compared to curcumin treatment.

Fig. 4.

Fig. 4

Open in a new tab

a Effect of BDMC-A and curcumin on the expression of intrinsic apoptotic proteins. Cells were incubated with 25 μM curcumin and 10 μM BDMC-A for 24 h. After 24 h Western blots were prepared and probed with antibodies. β-Actin was used as internal loading control. b Protein levels were quantified using densitometric analysis and expressed in relative band intensities. Values are expressed as mean ± Standard Deviation (SD) of three independent experiments. ANOVA followed by Tukey’s test was used to assess the statistical significance between groups. *: p ≤ 0.05 level significance relative to control group

Fig. 5.

Fig. 5

Open in a new tab

Effect of BDMC-A and curcumin on mRNA expression of Bcl-2 and Bax. Cells were incubated with 25 μM curcumin and 10 μM BDMC-A for 24 h. Bcl-2 and Bax mRNA expression patterns were assessed by RT-PCR and agarose gel electrophoresis (a and b). GAPDH was used as an internal loading control. c mRNA expression levels were quantified using densitometric analysis and expressed as relative intensities. Values are expressed as mean ± Standard Deviation (SD) of three independent experiments. ANOVA followed by Tukey’s test was used to assess the statistical significance between groups. *: p ≤ 0.05 level significance relative to control group

BDMC-A affects the regulation of extrinsic apoptotic signaling molecules

The extrinsic apoptosis pathway is mediated by FasL. This ligand activates the death receptor which, in turn, activates downstream signaling molecules such as caspase-8, leading to the induction of apotosis. After Western blotting, we observed more significant increases in FasL (Fig. 6a and b (i)) and caspase-8 (Fig. 6a and b (ii)) protein expression levels in BDMC-A treated cells compared to curcumin treated cells, indicating involvement of the extrinsic pathway as well.

Fig. 6.

Fig. 6

Open in a new tab

a Effect of BDMC-A and curcumin on the expression of extrinsic apoptotic proteins. Cells were incubated with 25 μM curcumin and 10 μM BDMC-A for 24 h. Western blots were prepared and probed with antibodies. β-Actin was used as internal loading control. b Protein levels were quantified using densitometric analysis and expressed in relative band intensities. Values are expressed as mean ± Standard Deviation (SD) of three independent experiments. ANOVA followed by Tukey’s test was used to assess the statistical significance between groups. *: p ≤ 0.05 level significance relative to control group

Apoptosis induction by BDMC-A revealed by Hoechst 33258 and Propidium Iodide staining

In order to visualise apoptosis, Hep-2 cells were treated with BDMC-A and curcumin for 24 h. After this treatment, the cells were stained with Hoechst 33258 and Propidium Iodide (PI) individually. Upon microscopic evaluation, it was found that morphological changes such as chromatin condensation and nuclear fragmentation were more pronounced in BDMC-A treated cells than in curcumin treated cells. A similar positive correlation with apoptosis was observed (Fig. 7a and b).

Fig. 7.

Fig. 7

Open in a new tab

Morphological analysis for apoptosis detection. A Induction of apoptosis in Hep-2 cells by BDMC-A and curcumin after 24 h at fixed concentrations. (a) control, (b) curcumin and (c) BDMC-A. Morphologic changes in nuclear chromatin of cells undergoing apoptosis and fragmented apoptotic bodies were assessed by Hoechst 33258 staining. Condensed or fragmented nuclei were observed under a fluorescence microscope. B Induction of apoptosis in Hep-2 cells by BDMC-A and curcumin after 24 h at fixed concentrations. (a) control, (b) curcumin and (c) BDMC-A. Morphologic changes in nuclear chromatin of cells undergoing apoptosis and fragmented apoptotic bodies were assessed by Propidium Iodide staining. Condensed or fragmented nuclei were observed under a fluorescence microscope. C Induction of apoptosis in Hep-2 cells by BDMC-A and curcumin after 24 h at fixed concentrations. (a) control, (b) curcumin and (c) BDMC-A. Phosphatidyl externalization was observed by Annexin V-cy3 staining. 6-Carboxyfluorescein stain (green), cy3 stain (red) and merged stain (orange-red) denote early apoptotic stages. D Induction of apoptosis in Hep-2 cells by BDMC-A and curcumin after 24 h at fixed concentrations. (a) control, (b) curcumin and (c) BDMC-A. Morphologic changes in nuclear chromatin of cells undergoing apoptosis. Live cells stain green, yellow indicates early apoptotic and orange indicates late apoptotic stages after AO/EB staining. E Induction of apoptosis in Hep-2 cells by BDMC-A and curcumin after 24 h at fixed concentrations. (a) control, (b) curcumin and (c) BDMC-A. Production of reaction oxygen species (ROS) was assessed by DCFH-DA staining. F Induction of apoptosis in Hep-2 cells by BDMC-A and curcumin after 24 h at fixed concentrations. (a) control, (b) curcumin and (c) BDMC-A. Depolarization of mitochondrial membrane potential is visualized as green fluorescence and polarized mitochondria as orange/red fluorescence after Rhodamine 123 staining. Dashed arrows indicate cells containing polarized mitochondria and solid arrows indicate cells containing depolarized mitochondria

Early onset apoptosis revealed by phosphatidylserine (PS) externalization

In order to assess the onset of apoptosis, cell surface phosphatidylserine (PS) was detected by the PS-binding protein Annexin V conjugated with Cy3 using an Annexin V-Cy3 detection kit. Evaluation of Hep-2 cells treated with BDMC-A indicated an early onset of apoptosis. The cells showed a double stain of Cy3 labeled Annexin V and 6-carboxyfluorescein (6-CF), emitting red and green fluorescence signals, respectively. Early apoptosis was more prominent in BDMC-A treated cells than in curcumin treated cells (Fig. 7c).

Early and late onset apoptosis revealed by Acridine Orange/Ethidium Bromide staining

Dual staining with Acridine Orange/Ethidium Bromide (AO/EtBr) was used to evaluate the nuclear morphology of apoptotic Hep-2 cells. Acridine Orange is a vital dye that stains both living and dead cells, whereas Ethidium Bromide stains cells when membrane damage occurs. By using this dual staining approach, green indicates viable cells, yellow indicates early apoptotic cells and orange/red indicates late apoptotic cells. In the untreated control, uniformly green living cells were observed with normal and large nuclei, as expected, whereas after BDMC-A treatment yellow (early apoptotic) and orange/red (late apoptotic) cells were observed (Fig. 7d).

BDMC-A induces apoptosis through reactive oxygen species

In order to assess whether reactive oxygen species (ROS) are involved in BDMC-A mediated cytotoxicity, 2′,7′-dichlorfluorescein-diacetate (DCFH-DA) was used. Intracellular non-fluorescent DCFH is converted into highly fluorescent DCF through the action of hydrogen peroxide (ROS) generated in the presence of peroxidase. By using this method, we found that BDMC-A treated Hep-2 cells showed more ROS production than curcumin treated cells. This observation indicates that BDMC-A is a more potent apoptosis inducer than curcumin (Fig. 7e).

BDMC-A induces loss of mitochondrial membrane potential (ΔΨm)

Next we tested whether alterations in mitochondrial membrane potential (ΔΨm) (i.e., depolarization), which is indicative for early stage apoptosis, occurs after BDMC-A treatment. To test this, we used Rhodamine 123 (Rh123), a lipophilic cationic dye, as an indicator for mitochondrial membrane potential. Through this dye, depolarized mitochondria are marked by a green fluorescence and polarized mitochondria by an orange-red fluorescence. We found that both BDMC-A and curcumin treated Hep-2 cells emitted green fluorescence, indicating loss of mitochondrial membrane potential. We also found that BDMC-A was more potent in inducing membrane depolarization than curcumin (Fig.7f).

BDMC-A induces DNA fragmentation

Subsequently, we set out to test whether BDMC-A can induce DNA fragmentation. Cleavage of DNA at internucleosomal linker sites, yielding DNA fragments of 180 bp, is regarded as a biochemical hallmark of apoptosis. Genomic DNAs extracted from untreated Hep-2 cells, and BDMC-A or curcumin treated Hep-2 cells, were subjected to agarose gel electrophoresis. In contrast to the untreated control cells, we readily observed ladder formation in both BDMC-A and curniculum treated cells, with a considerable higher level of DNA fragmentation in the BDMC-A treated cells (Fig. 8).

Fig. 8.

Fig. 8

Open in a new tab

BDMC-A and curcumin induced apoptosis in Hep-2 cells was assessed by DNA fragmentation. Hep-2 cells were treated with fixed concentrations of BDMC-A and curcumin for 24 h. Cells were trypsinized and lysed in lysis buffer, after which fragmented DNA was isolated, purified and separated on 2 % agarose gels. (a) 100 bp ladder, (b) control, (c) curcumin and (d) BDMC-A

In silico docking of curcumin/BDMC-A to EGFR

In order to better understand the molecular interactions between curcumin/BDMC-A and the epidermal growth factor receptor (EGFR) kinase domain, in silico docking experiments were carried out using the Glide software package (Schrödinger, v9.1). Initially, the docking protocol was validated by redocking the original co-crystallized ligand (Erlotinib, a known EGFR kinase inhibitor) into the EGFR kinase domain. It was found that the docked conformation of Erlotinib, generated by Glide, and the co-crystallized ligand conformation were very similar, with a RMSD (root mean square deviation) value of <2 Å. This confirms that the Glide program is able to identify the bioactive conformation of Erlotinib successfully and can reliably be used to identify bioactive conformations of other ligands by docking to the EGFR kinase domain.

Next, in silico docking of curcumin and BDMC-A was carried out to investigate whether they can interact with the EGFR kinase domain in a manner similar to Erlotinib. Erlotinib interacts with the ATP binding site of the EGFR kinase domain by forming an important H-bond between the N1 atom of the quinozoline ring and the backbone NH of the hinge region of the Met769 residue (PDB ID: 1 M17), thereby mimicking the hydrogen bond formed by the adenine ring of ATP with the EGFR. The docked pose of curcumin and BDMC-A to the EGFR kinase domain indicated that BDMC-A can form three H-bonds with the protein, while curcumin can only form two such bonds (Fig. 9a and b). The BDMC-A keto group (C = O) can form one H-bond with the backbone NH of MET769 and the phenolic OH can form one H-bond with the backbone carbonyl of PRO770. A third H-bond can be formed between another phenolic OH of BDMC-A and the side chain carboxylate group of ASP831 (i.e., DFG loop). In contrast, we found that the curcumin keto group (C = O) can form one H-bond with the backbone NH of MET769 and that the phenolic OH can form one H-bond with the side-chain carboxylate group of GLU738 (Cα Helix). Moreover, we found that BDMC-A had a higher docking score (Glide score = −9.86) and free binding energy (ΔG = −68.64, calculated using the MM/PBSA method), than curcumin (Glide score = −9.53; ΔG = −66.42) (Table 1).

Fig. 9.

Fig. 9

Open in a new tab

a Docking pose of BDMC-A to the EGFR kinase domain (PDB: 1M17). A total of three H-bonds are formed between the protein and BDMC-A, one H-bond with a hinge region at residue MET769 and PRO770 and one H-bond with a DFG loop at residue ASP831. Glide Score: −9.86. b Docking pose of curcumin to the EGFR kinase domain (PDB: 1M17). A total of two H-bonds are formed between the protein domain and curcumin: one H-bond with a hinge region at residue MET769 and another one with a Cα Helix at residue GLU738. Glide Score: −9.53. Yellow dotted lines represent H-bonds between the ligand and the protein

Table. 1.

Comparison of interaction between Erlotinib (co-crystallized ligand), Curcumin and BDMC-A to EGFR kinase domain (PDB ID: 1M17)

Sl. No. Ligand Hydrogen bond forming residues Glide Score ΔG bind (kcal/mol)
1 Erlotinib MET769 −11.71 −92.14
2 BDMC-A MET769, PRO770 & D831 −9.86 −68.64
3 Curcumin MET769 & GLU738 −9.53 −66.42
Open in a new tab

Discussion

Apoptosis is a multi-step process of programmed cell death that is essential for the maintenance of homeostasis in multicellular organisms. In cancer, the apoptosis/cell-division ratio is altered and a compromised apoptosis is, therefore, considered as one of the hallmarks of cancer [33]. In the past, it has been shown that curcumin can trigger apoptosis in various cancers in vivo and in vitro, and several reports have shown that curcumin can induce cell death by affecting the expression of apoptosis-associated genes [34]. Previously, we have reported an antiproliferative effect of both curcumin and its bisdemethoxycurcumin analog BDMC-A on Hep-2 human laryngeal carcinoma cells. The IC50 values were 20 μM for BDMC-A and 50 μM for curcumin [20]. Here, we have investigated the mechanisms underlying BDMC-A induced apoptosis in Hep-2 cells and compared them with those induced by curcumin.

The intrinsic apoptotic pathway involves p53, a molecular ‘guardian of the genome’. p53 acts as a transcription factor that can upregulate the expression of Bax which, in turn, can induce apoptosis [35, 36]. Here we show that BDMC-A can up-regulate the expression of p53 in Hep-2 cells more potently than curcumin. Concordantly, we found a stronger upregulation of Bax expression when Hep-2 cells were treated with BDMC-A compared to curcumin. The PI3K pathway can be controlled by signaling through the epidermal growth factor receptor (EGFR). This pathway is often activated in tumors, particularly in laryngeal squamous cell carcinomas in which the EGFR is over-expressed. The EGFR, a tyrosine kinase receptor located at the cell membrane, transmits signals from extracellular ligands to intracellular effector molecules such as PI3K and Akt. Activated PI3K/Akt signaling can promote tumor growth. Based on these functional relationships, it is thought that for the control of tumor growth PI3K inhibitors will be most effective in combination with EGFR inhibitors [37]. Here, we found that both curcumin and BDMC-A can inhibit PI3K and pAkt, but the effect of BDMC-A was more pronounced. Previously, it has also been found that pAkt can activate Mdm2 which, in turn, can inhibit p53 [38]. The BDMC-A induced upregulation of p53 that we observed in our study can thus be attributed to the inhibition of PI3K and pAkt. Since p53 can induce Bax, and since Bax is a well-known inhibitor of Bcl-2, the down-regulation of Bcl-2 that we observed in our study can also be attributed to the upstream distortion of this pathway. When the Bcl-2/Bax ratio increases, disruption of the mitochondrial membranes increases, allowing cytochrome c to leak into the cytosol [39]. Cytochrome c binds to Apaf-1 (apoptotic protease activating factor-1) to form an apoptosome complex with caspase-9 (unique to the intrinsic pathway), which ultimately results in apoptosis. Our results showed a significant increase in cytochrome c expression, Apaf-1 binding and activation of caspase- 9 in BDMC-A treated Hep-2 cells compared to curcumin, indicating induction of the intrinsic apoptotic pathway by BDMC-A. Caspases belong to a group of aspartic acid-specific cysteine proteases involved in the initiation and execution of apoptosis via poly (ADP) ribosepolymerase (PARP) cleavage, ultimately resulting in desintegartion of the cell. Caspase-3 is known to act as an effector caspase that preceeds PARP cleavage and DNA fragmentation, which is another hallmark of apoptosis [40, 41]. In our study, PARP cleavage and caspase-3 induction were found to be more pronounced in BDMC-A treated cells compared to curcumin treated cells. Moreover, BDMC-A induced the formation of typical apoptosis-related DNA laddering patterns. Thus, our data clearly indicate that BDMC-A acts as a potent inducer of apoptosis by upregulating caspase-3, PARP cleavage and DNA fragmentation.

Curcumin is known to be able to stimulate apoptosis through the extrinsic pathway by modulating ‘death activators’ such as TNF-α and Fas ligand (FasL). Activation of death receptors activates caspase-8. This initiator caspase triggers the effector caspase-3 and amplifies the apoptotic cascade [42]. We observed upregulation of FasL, caspase-8 and caspase-3 expression upon curcumin and BDMC-A treatment, and found that this upregulation was more pronounced in BDMC-A treated cells, indicating its more potent ability to activate the extrinsic apoptotic pathway. We also found that BDMC-A treated Hep-2 cells showed nuclear fragmentation, which is another prominent feature of apoptosis [43], and that this nuclear fragmentation was more pronounced in BDMC-A treated cells compared to curcumin treated cells.

Early apoptosis is marked by changes in annexin proteins. Annexins comprise a family of calcium-dependent phospholipid-binding proteins, which can bind to phosphatidylserine (PS). Upon initiation of apoptosis, PS loses its asymmetric distribution in the phospholipid bilayer and translocates from the inner to the outer leaflet of the plasma membrane. Our results correlate well with the externalization of PS and indicate that in BDMC-A treated Hep-2 cells early onset of apoptosis is induced more potently than in curcumin treated cells.

Oxidative stress may generate reactive oxygen species (ROS) in tumor cells, which may increase the cytotoxic activity of therapeutic drugs [44]. Though curcumin acts as a free radical scavenger, an effect on ROS generation has been reported in many cancer types [45, 46]. The formation of ROS is important for cytochrome c release from mitochondria and, thus, for triggering caspase-mediated apoptosis. Previously, it has been found that curcumin is able to induce apoptosis through ROS production and cytochrome c release [47]. Accordingly, we observed a higher ROS production in BDMC-A treated Hep-2 cells compared to curcumin treated cells.

An increase in mitochondrial membrane potential is an indication of a higher rate of mitochondrial ATP synthesis. The exit of apoptogenic factors to the cytosol is facilitated by depolarizing the mitochondrial membrane potential. Depolarized mitochondrial membrane potential can be assessed by Rhodamine 123 staining. The clear shift from orange/red fluorescence to green fluorescence that we observed in our study indicates the occurrence of mitochondrial membrane depolarization. This result supports the notion that BDMC-A can induce apoptosis in Hep-2 laryngeal cancer cells through signaling at the mitochondrial level.

The EGFR is suggested as one of the molecular targets through which curcumin exerts its anti-proliferative/apoptotic activity in cancer cells [48, 49]. Since Hep-2 cells are known to over-express EGFR [50], inhibition of EGFR kinase activity by curcumin/BDMC-A may underlie the anti-proliferative/apoptotic effects of these compounds in these cells. To further unravel at the molecular level the interactions between curcumin/BDMC-A and the EGFR kinase domain, we used the Erlotinib-EGFR kinase domain complex structure (PDB ID: 1M17) for carrying out in silico docking studies. Erlotinib (trade name Tarceva) is an EGFR kinase inhibitor designed for the treatment of non-small cell lung cancer and has been shown to interact with the kinase domain of the EGFR [51]. Moreover, Erlotinib is currently in phase III development for the treatment of head and neck cancer [52]. In silico docking of curcumin/BDMC-A showed that both compounds can interact with the EGFR kinase domain through a H-bond interaction with the hinge region of the MET769 residue. Crystallographic studies of several kinase inhibitor-protein complexes, including Erlotinib, revealed that this hinge region interaction is essential for an effective inhibition of the kinase activity [53, 54]. Since our in silico docking studies predict the formation of a H-bond with this important hinge region of the MET769 residue, we conclude that the anti-proliferative activity of both curcumin and BDMC-A may be mediated through inhibition of the EGFR kinase domain. In addition to its presumed interaction with the MET769 residue, BDMC-A was found to be able to undergo an additional H-bond interaction with the DFG loop of the ASP831 residue. Recently, furano-pyrimidine EGFR kinase inhibitors were shown to specifically interact with this DFG loop and to modify the kinase activity [54, 55]. Additionally, we found that BDMC-A exhibits higher docking and free binding energy scores compared to curcumin. These in silico results suggest that BDMC-A may interact with the EGFR kinase domain more efficiently than curcumin and, thus, may exhibit a better anti-proliferative activity than curcumin, which is concordant with our in vitro results.

Our results indicate that BDMC-A affects caspase-dependent (via mitochondrial homeostasis disruption) and caspase-independent (via ROS production) pathways, and both intrinsic and extrinsic apoptotic effectors, to induce the inhibition of Hep-2 tumor cell growth. Our results also strongly indicate that BDMC-A mediates cell death through apoptosis rather than necrosis. This latter notion is also supported by our previous work in which release of lactate dehydrogense (LDH) in BDMC-A treated Hep-2 cells was observed. Our current study also indicates that both type I apoptosis (independent of pro-apoptotic factors) and type II apoptosis (dependent on pro-apoptotic factors) occur in BDMC-A treated cells. The observed enhanced efficacy of BDMC-A may be due to the presence of the hydroxyl group at the ortho position. This property turns BDMC-A into a novel candidate compound for treating laryngeal cancer. Our in silico docking results suggest that BDMC-A can interact with the EGFR kinase domain better than curcumin, in a manner similar to that of the EGFR kinase inhibitor Erlotinib. This interaction may result in the observed upregulation of downstream apoptotic proteins and the concomitant potent anti-cancer effect elicited by BDMC-A.

In conclusion, we found that BDMC-A exerts specificity towards laryngeal cancer Hep-2 cells and opens up a therapeutic window for the treatment of this malignancy. Further studies are required to clearly delineate the cellular pathways affected by this analog, including all the genes affected by curcumin, to turn this molecule into a promising chemopreventive/therapeutic agent.

Acknowledgments

This work was financially supported by University Grants Commission [F.No 37-309/2009(SR)] and UGC [F.No 41-981/2012 (SR)]. The authors thank DST-FIST, UGC-SAP and DBT -IPLS for providing the infrastructural support. Kumaravel Mohankumar thanks CSIR for providing a senior research fellowship.

Conflict of interest

The authors declare that they have no conflict of interest.

References

  • 1.S. Ghosh, A. Ghosh, G.P. Maiti, N. Alam, A. Roy, B. Roy, S. Roychoudhury, C.K. Panda, Alterations of 3p21.31 tumor suppressor genes in head and neck squamous cell carcinoma: correlation with progression and prognosis. Int. J. Cancer 123, 2594–2604 (2008) [DOI] [PubMed] [Google Scholar]
  • 2.C. Salazar, R. Nagadia, P. Pandit, J. Cooper-White, N. Banerjee, N. Dimitrova, W.B. Coman, C. Punyadeera, A novel saliva-based microRNA biomarker panel to detect head and neck cancers. Cell. Oncol. 37, 331–338 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.T. Nakaoka, A. Ota, T. Ono, S. Karnan, H. Konishi, A. Furuhashi, Y. Ohmura, Y. Yamada, Y. Hosokawa, Y. Kazaoka, Combined arsenic trioxide-cisplatin treatment enhances apoptosis in oral squamous cell carcinoma cells. Cell. Oncol. 37, 119–129 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.D. Weiss, C. Stockmann, K. Schrödter, C. Rudack, Protein expression and promoter methylation of the candidate biomarker TCF21 in head and neck squamous cell carcinoma. Cell. Oncol. 36, 213–224 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.B.B. Aggarwal, C. Sundaram, N. Malani, H. Ichikawa, Curcumin: the Indian solid gold. Adv. Exp. Med. Biol. 595, 1–75 (2007) [DOI] [PubMed] [Google Scholar]
  • 6.S. Shishodia, M.M. Chaturvedi, B.B. Aggarwal, Role of curcumin in cancer therapy. Curr. Probl. Cancer 31, 243–305 (2007) [DOI] [PubMed] [Google Scholar]
  • 7.N. Chakravarti, J.N. Myers, B.B. Aggarwal, Targeting constitutive and interleukin-6-inducible signal transducers and activators of transcription 3 pathway in head and neck squamous cell carcinoma cells by curcumin (diferuloylmethane). Int. J. Cancer 119, 1268–1275 (2006) [DOI] [PubMed] [Google Scholar]
  • 8.A. Chen, J. Xu, A.C. Johnson, Curcumin inhibits human colon cancer cell growth by suppressing gene expression of epidermal growth factor receptor through reducing the activity of the transcription factor Egr-1. Oncogene 25, 278–287 (2006) [DOI] [PubMed] [Google Scholar]
  • 9.S. Prakobwong, J. Khoontawad, P. Yongvanit, C. Pairojkul, Y. Hiraku, P. Sithithaworn, P. Pinlaor, B.B. Aggarwal, S. Pinlaor, Curcumin decreases cholangiocarcinogenesis in hamsters by suppressing inflammation-mediated molecular events related to multistep carcinogenesis. Int. J. Cancer 129, 88–100 (2011) [DOI] [PubMed] [Google Scholar]
  • 10.P. Anand, C. Sundaram, S. Jhurani, A.B. Kunnumakkara, B.B. Aggarwal, Curcumin and cancer: an “old-age” disease with an “age-old” solution. Cancer Lett. 267, 133–164 (2008) [DOI] [PubMed] [Google Scholar]
  • 11.J.M. Davis, E.A. Murphy, M.D. Carmichael, M.R. Zielinski, C.M. Groschwitz, A.S. Brown, J.D. Gangemi, A. Ghaffar, E.P. Mayer, Curcumin effects on inflammation and performance recovery following eccentric exercise-induced muscle damage. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, 2168–2173 (2007) [DOI] [PubMed] [Google Scholar]
  • 12.B.B. Aggarwal, A. Kumar, A.C. Bharti, Anticancer potential of curcumin: preclinical and clinical studies. Anticancer Res. 23, 363–398 (2003) [PubMed] [Google Scholar]
  • 13.J. Nautiyal, S. Banerjee, S.S. Kanwar, Y. Yu, B.B. Patel, F.H. Sarkar, A.P. Majumdar, Curcumin enhances dasatinib-induced inhibition of growth and transformation of colon cancer cells. Int. J. Cancer 128, 951–961 (2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.R.J. Anto, G. Kuttan, K.V.D. Babu, K.V. Rajasekharan, R. Kuttan, Anti-tumour and free radical scavenging activity of synthetic curcuminoids. Inter. J. Pharm. 131, 1–7 (1996) [Google Scholar]
  • 15.R.J. Anto, J. George, K.V. Babu, K.N. Rajasekharan, R. Kuttan, Antimutagenic and anticarcinogenic activity of natural and synthetic curcuminoid. Mutat. Res. 370, 127–131 (1996) [DOI] [PubMed] [Google Scholar]
  • 16.R. Rukkumani, K. Aruna, P.S. Varma, K.N. Rajasekaran, V.P. Menon, Comparative effects of curcumin and an analog of curcumin on alcohol and PUFA induced oxidative stress. J. Pharm. Pharm. Sci. 7, 274–283 (2004) [PubMed] [Google Scholar]
  • 17.R. Rukkumani, K. Aruna, P.S. Varma, P. Viswanathan, K.N. Rajasekaran, V.P. Menon, Protective role of a novel curcuminoid on alcohol and PUFA-induced hyperlipidemia. Toxicol. Mech. Methods 15, 227–234 (2005) [DOI] [PubMed] [Google Scholar]
  • 18.R. Rajagopalan, S. Sridharan, V.P. Menon, Hepatoprotective role of bis-demethoxy curcumin analog on the expression of matrix metalloproteinase induced by alcohol and polyunsaturated fatty acid in rats. Toxicol. Mech. Methods 20, 252–259 (2010) [DOI] [PubMed] [Google Scholar]
  • 19.T. Devasena, K.N. Rajasekaran, V.P. Menon, Bis-1,7-(2-hydroxyphenyl)-hepta-1,6-diene-3,5-dione (a curcumin analog) ameliorates DMH-induced hepatic oxidative stress during colon carcinogenesis. Pharmacol. Res. 46, 39–45 (2002) [DOI] [PubMed] [Google Scholar]
  • 20.M. Kumaravel, P. Sankar, P. Latha, C.S. Benson, R. Rukkumani, Antiproliferative effects of an analog of curcumin in Hep-2 cells: a comparative study with curcumin. Nat. Prod. Commun. 8, 183–186 (2013) [PubMed] [Google Scholar]
  • 21.K.Y. Chang, S.Y. Tsai, S.H. Chen, H.H. Tsou, C.J. Yen, K.J. Liu, H.L. Fang, H.C. Wu, B.F. Chuang, S.W. Chou, C.K. Tang, S.Y. Liu, P.J. Lu, C.Y. Yen, J.Y. Chang, Dissecting the EGFR-PI3K-AKT pathway in oral cancer highlights the role of the EGFR variant III and its clinical relevance. J. Biomed. Sci. 20, 43 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.S. Haupt, M. Berger, Z. Goldberg, Y. Haupt, Apoptosis - the p53 network. J. Cell Sci. 116, 4077–4085 (2003) [DOI] [PubMed] [Google Scholar]
  • 23.G. Sa, T. Das, Anti cancer effects of curcumin: cycle of life and death. Cell Div. 3, 14 (2008) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.C. Gajate, F. Mollinedo, Cytoskeleton-mediated death receptor and ligand concentration in lipid rafts forms apoptosis-promoting clusters in cancer chemotherapy. J. Biol. Chem. 280, 11641–11647 (2005) [DOI] [PubMed] [Google Scholar]
  • 25.H.F. Lu, K.C. Lai, S.C. Hsu, H.J. Lin, M.D. Yang, Y.L. Chen, M.J. Fan, J.S. Yang, P.Y. Cheng, C.L. Kuo, J.G. Chung, Curcumin induces apoptosis through FAS and FADD, in caspase-3-dependent and -independent pathways in the N18 mouse-rat hybrid retina ganglion cells. Oncol. Rep. 22, 97–104 (2009) [DOI] [PubMed] [Google Scholar]
  • 26.S. Shankar, R.K. Srivastava, Bax and Bak genes are essential for maximum apoptotic response by curcumin, a polyphenolic compound and cancer chemopreventive agent derived from turmeric, Curcuma longa. Carcinog. 28, 1277–1286 (2007) [DOI] [PubMed] [Google Scholar]
  • 27.M. Roy, S. Chakraborty, M. Siddiqi, R.K. Bhattacharya, Induction of Apoptosis in Tumor Cells by Natural Phenolic Compounds. Asian Pac. J. Cancer Prev. 3, 61–67 (2002) [PubMed] [Google Scholar]
  • 28.K.V. Dinesh Babu, K.N. Rajasekaran, Simplified conditions for the synthesis of curcumin I and other curcuminoids. Org. Prep. Proc. Int. 24, 674–677 (1994) [Google Scholar]
  • 29.R.J. Fido, A.S. Tatham, P.R. Shewry, Western blotting analysis, in Methods in molecular biology: plant gene transfer and expression protocols, ed. by H. Jones, vol. 49 (Humana Press Inc, Totowa, 1995), pp. 423–437 [DOI] [PubMed] [Google Scholar]
  • 30.P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159 (1987) [DOI] [PubMed] [Google Scholar]
  • 31.C. Brana, C. Benham, L. Sundstrom, A method for characterising cell death in vitro by combining propidium iodide staining with immunohistochemistry. Brain Res. Brain Res. Protoc. 10, 109–114 (2002) [DOI] [PubMed] [Google Scholar]
  • 32.R.A. Friesner, R.B. Murphy, M.P. Repasky, L.L. Frye, J.R. Greenwood, T.A. Halgren, P.C. Sanschagrin, D.T. Mainz, Extra precision glide: docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes. J. Med. Chem. 4, 6177–6196 (2006) [DOI] [PubMed] [Google Scholar]
  • 33.D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation. Cell 144, 646–674 (2011) [DOI] [PubMed] [Google Scholar]
  • 34.C. Ramachandran, S. Rodriguez, R. Ramachandran, P.K. Raveendran Nair, H. Fonseca, Z. Khatib, E. Escalon, S.J. Melnick, Expression profiles of apoptotic genes induced by curcumin in human breast cancer and mammary epithelial cell lines. Anticancer Res. 25, 3293–3302 (2005) [PubMed] [Google Scholar]
  • 35.S.W. Lowe, E. Cepero, G. Evan, Intrinsic tumour suppression. Nature 432, 307–315 (2004) [DOI] [PubMed] [Google Scholar]
  • 36.T. Miyashita, J.C. Reed, Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293–299 (1995) [DOI] [PubMed] [Google Scholar]
  • 37.S. Awantika, K. Durga Prasad, G. Archana, In Silico molecular docking analysis to identify PI3K inhibitors as possible NSCLC agents. Int. J. Comput. Bioinfo. In Silico Model 2, 68–71 (2013) [Google Scholar]
  • 38.U.M. Moll, O. Petrenko, The MDM2-p53 interaction. Mol. Cancer Res. 1, 1001–1008 (2003) [PubMed] [Google Scholar]
  • 39.R. Wilken, M.S. Veena, M.B. Wang, E.S. Srivatsan, Curcumin: a review of anti-cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Mol. Cancer 10, 12 (2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.S. Shankar, Q. Chen, K. Sarva, I. Siddiqui, R.K. Srivastava, Curcumin enhances the apoptosis-inducing potential of TRAIL in prostate cancer cells: molecular mechanisms of apoptosis, migration and angiogenesis. J. Mol. Signal. 2, 10 (2007) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.R.U. Janicke, M.L. Sprengart, M.R. Wati, A.G. Porter, Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J. Biol. Chem. 273, 9357–9360 (1998) [DOI] [PubMed] [Google Scholar]
  • 42.H.Y. Chang, X. Yang, Proteases for cell suicide: functions and regulation of caspases. Microbiol. Mol. Biol. Rev. 64, 821–846 (2000) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.R. Prasanna, C.C. Harish, R. Pichai, D. Sakthisekaran, P. Gunasekaran, Anti-cancer effect of Cassia auriculata leaf extract in vitro through cell cycle arrest and induction of apoptosis in human breast and larynx cancer cell lines. Cell Biol. Int. 33, 127–134 (2009) [DOI] [PubMed] [Google Scholar]
  • 44.C.B. Gonzales, N.B. Kirma, J.J. De La Chapa, R. Chen, M.A. Henry, S. Luo, K.M. Hargreaves, Vanilloids induce oral cancer apoptosis independent of TRPV1. Oral Oncol. 50, 437–447 (2014) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.D. Wang, J. Hu, L. Lv, X. Xia, J. Liu, X. Li, Enhanced inhibitory effect of curcumin via reactive oxygen species generation in human nasopharyngeal carcinoma cells following purple-light irradiation. Oncol. Lett. 6, 81–85 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.A. Shehzad, J. Lee, T.L. Huh, Y.S. Lee, Curcumin induces apoptosis in human colorectal carcinoma (HCT-15) cells by regulating expression of Prp4 and p53. Mol. Cells 35, 526–532 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.T. Atsumi, K. Tonosaki, S. Fujisawa, Induction of early apoptosis and ROS-generation activity in human gingival fibroblasts (HGF) and human submandibular gland carcinoma (HSG) cells treated with curcumin. Arch. Oral Biol. 51, 913–921 (2006) [DOI] [PubMed] [Google Scholar]
  • 48.N. Hasima, B.B. Aggarwal, Cancer-linked targets modulated by curcumin. Int. J. Biochem. Mol. Biol. 3, 328–351 (2012) [PMC free article] [PubMed] [Google Scholar]
  • 49.S. Shishodia, Molecular mechanisms of curcumin action: gene expression. Biofactors 39, 37–55 (2013) [DOI] [PubMed] [Google Scholar]
  • 50.G.P. Maiti, P. Mondal, N. Mukherjee, A. Ghosh, S. Ghosh, S. Dey, J. Chakrabarty, A. Roy, J. Biswas, S. Roychoudhury, C.K. Panda, Overexpression of EGFR in head and neck squamous cell carcinoma is associated with inactivation of SH3GL2 and CDC25A genes. PLoS One 8, e63440 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.J. Stamos, M.X. Sliwkowski, C. Eigenbrot, Structure of the epidermal growth factor receptor kinase domain alone and in complex with a 4-anilinoquinazoline inhibitor. J. Biol. Chem. 277, 46265–46272 (2002) [DOI] [PubMed] [Google Scholar]
  • 52.R.B. Cohen, Current challenges and clinical investigations of epidermal growth factor receptor (EGFR) - and ErbB family-targeted agents in the treatment of head and neck squamous cell carcinoma (HNSCC). Cancer Treat. Rev. 40, 567–577 (2014) [DOI] [PubMed] [Google Scholar]
  • 53.M.E. Noble, J.A. Endicott, L.N. Johnson, Protein kinase inhibitors: insights into drug design from structure. Science 303, 1800–1805 (2004) [DOI] [PubMed] [Google Scholar]
  • 54.J.J. Liao, Molecular recognition of protein kinase binding pockets for design of potent and selective kinase inhibitors. J. Med. Chem. 50, 409–424 (2007) [DOI] [PubMed] [Google Scholar]
  • 55.Y.H. Peng, H.Y. Shiao, C.H. Tu, P.M. Liu, J.T. Hsu, P.K. Amancha, J.S. Wu, M.S. Coumar, C.H. Chen, S.Y. Wang, W.H. Lin, H.Y. Sun, Y.S. Chao, P.C. Lyu, H.P. Hsieh, S.Y. Wu, Protein kinase inhibitor design by targeting the Asp-Phe-Gly (DFG) motif: the role of the DFG motif in the design of epidermal growth factor receptor inhibitors. J. Med. Chem. 56, 3889–3903 (2013) [DOI] [PubMed] [Google Scholar]

Articles from Cellular Oncology are provided here courtesy of Springer

RESOURCES