Enhanced antitumor activity of atorvastatin and luteolin, with or without doxorubicin, in a solid Ehrlich carcinoma mouse model: modulation of ABC transporters, telomerase, and cancer stem cells

Abstract

This study evaluated the antitumor efficacy of atorvastatin (ATO) and luteolin (LUT), administered individually or in combination with or without doxorubicin (DOX), in mice bearing solid Ehrlich carcinoma (SEC). Additionally, we examined the effects of these treatments on ATP-binding cassette (ABC) transporters, telomerase reverse transcriptase (TERT), and cancer stem cell–related markers as potential mechanisms underlying chemoresistance. SEC tumors were induced in 70 Swiss albino female mice, which were randomly assigned into seven groups (n = 10/group): SEC control, DOX (4 mg/kg, i.p.), ATO (20 mg/kg, i.p.), LUT (40 mg/kg, i.p.), ATO+ DOX, LUT+DOX, and ATO + LUT. At the end of the study, tumors were excised, weighed, and processed for histopathological evaluation, immunohistochemical analysis of CD44, quantitative assessment of ABCB1 and ABCG2 gene expression, and protein analysis of both the non-phosphorylated (TERT) and phosphorylated form (P-TERT). Co-treated groups exhibited a greater reduction in tumor growth compared to the control and single-agent groups. These effects were accompanied by marked downregulation of ABCB1 and ABCG2 gene expression and suppression of TERT and P-TERT protein levels. Histopathological findings revealed increased apoptotic features, including karyorrhexis, and reduced mitotic activity in the co-treated groups. CD44 immunostaining was strong in the SEC and DOX groups, moderate in the ATO- or LUT-treated groups, and weak in the co-treated groups. Combining ATO or LUT with DOX enhanced antitumor efficacy and attenuated molecular determinants associated with chemoresistance in SEC. Notably, the ATO+ LUT combination without DOX demonstrated the greatest antitumor efficacy compared to DOX-containing regimens, highlighting its potential as a multi-target, non-cytotoxic therapeutic strategy.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12032-026-03257-y.

Introduction

Breast cancer (BC) is considered a significant health concern in Egypt, representing 37.7% of female cancer cases [1]. Cancer treatment often encounters resistance to therapy, a major obstacle that contributes to treatment failure and low survival rates. Various mechanisms may contribute to chemotherapy resistance, including drug inactivation, reduced drug uptake or enhanced drug efflux within cells, modified drug targets, activation of alternative survival pathways, DNA repair, and suppression of apoptosis [2].

The overexpression of ATP-binding cassette (ABC) transporters, particularly ABC subfamily B member 1 (ABCB1), also known as P-glycoprotein (P-gp) or multidrug resistance protein 1 (MDR1), along with ABC subfamily G member 2 (ABCG2), known as breast cancer resistance protein (BCRP), represents the primary cause of insufficient intracellular drug concentration in cancer cells [3]. Through ATP-dependent drug efflux, these transporters hinder the effectiveness of chemotherapy in cancer cells, contributing to the emergence of multidrug resistance [4].

Telomerase, a reverse transcriptase enzyme, has a crucial role in senescence and the development of drug resistance in cancer cells. This enzyme comprises two subunits: telomerase reverse transcriptase (TERT) and telomerase RNA [5]. In BC, TERT is often overexpressed, which is associated with both drug resistance and tumor progression [6]. Phosphorylation of TERT enhances telomerase activity, making it essential for maintaining the integrity of the telomerase holoenzyme [7].

Cluster of Differentiation 44 (CD44) is a multifunctional transmembrane adhesion glycoprotein that is implicated in various physiological processes [8]. It is widely recognized as a cell surface biomarker for cancer stem cells (CSCs) and has a critical role in regulating tumor initiation and progression. CD44 promotes tumor proliferation, survival, and metastasis by activating signaling pathways, such as Hippo/(Yes-associated protein) YAP, Hypoxia-Inducible Factor-1 alpha, and Wnt–Forkhead Box M1 (FOXM1)–Twist signaling [9]. Additionally, CD44 regulates nuclear FOX protein A2 (FOXA2) and modulates Ras-mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) pathways, thereby facilitating malignant progression [10, 11].

The Ehrlich tumor is a well-established, rapidly growing, and highly transplantable tumor system that originates from a mouse mammary adenocarcinoma. It shares several histopathological and molecular features with human breast carcinoma but does not directly correspond to a specific stage in the human cancer [12]. Subcutaneous inoculation leads to the formation of solid Ehrlich carcinoma (SEC), which is a crucial model for evaluating the effectiveness of anticancer drugs and potential adjuvants [13].

Doxorubicin (DOX) is related to the anthracycline group and is highly effective in treating various malignancies, including BC. DOX has chemotherapeutic effects by intercalating topoisomerase II and DNA base pairs, causing oxidative stress and initiating apoptosis. However, cancer cells may develop resistance to DOX therapy through various mechanisms [14]. Thus, using adjuvant agents can enhance the efficacy of DOX while mitigating its adverse effects and reducing the development of resistance.

Atorvastatin (ATO) is a widely prescribed statin that reduces cardiovascular risk by inhibiting 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme in cholesterol biosynthesis [15]. Beyond its lipid-lowering activity, ATO interferes with the mevalonate pathway, resulting in a decrease in the prenylation of Ras and Rho GTPases, thereby suppressing tumor cell proliferation, migration, and metastatic potential. Accumulating evidence indicates that ATO exhibits anticancer activity across various malignancies, including breast, prostate, pancreatic, and liver cancers [16]. These antitumor effects are mediated by the modulation of several oncogenic signaling pathways, including the PI3K/AKT/mammalian target of rapamycin (mTOR) axis [17]. Furthermore, ATO has been reported to suppress MAPK/extracellular signal-regulated kinase (ERK) signaling [18] and downregulate CD44-associated metastatic signaling [19], resulting in decreased tumor progression and increased apoptosis [20, 21].

Luteolin (LUT; 3′,4′,5,7-tetrahydroxyflavone) is a naturally occurring flavonoid abundant in various fruits and vegetables and is widely recognized for its potential as a treatment for hypertension, oxidative stress, and inflammation [22]. Beyond its antioxidant and anti-inflammatory actions, LUT demonstrates significant anticancer activity, attributed to its ability to suppress tumor proliferation, angiogenesis, and metastasis [23, 24]. LUT modulates several critical oncogenic pathways, including the PI3K/AKT/mTOR, MAPK/ERK, and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathways. Furthermore, LUT has been shown to reduce cancer stemness by downregulating the expression of stem cell–associated markers such as CD44 [25].

Hence, the present study aimed to investigate the antitumor effects of ATO and LUT as single agents and in combination with or without DOX. To our knowledge, these combinations have not previously been assessed in the SEC model, nor have their effects on key chemoresistance pathways been evaluated. By assessing ABCB1 and ABCG2 gene expression, TERT and P-TERT protein expression, and the cancer stem cell marker CD44, this study provides an integrated evaluation of how these treatments may enhance antitumor activity and mitigate drug resistance.

Materials and Methods

Medications

Doxorubicin hydrochloride (DOX; Adricin 2 mg/mL) was obtained from Hikma Specialized Pharmaceuticals (Cairo, Egypt). Atorvastatin calcium (ATO: 94.73% purity) was provided by the Egyptian International Pharmaceutical Industries Company (EIPICO, Egypt) and dissolved in 10% ethanol. Luteolin (LUT; 99% purity) was purchased from INDOFINE Chemical Company, Inc. (USA) and dissolved in 0.5% dimethyl sulfoxide (DMSO; Sisco Research Laboratories, India).

Animals

Seventy female Swiss Albino mice (25–28 g) were purchased from the National Research Center (Cairo, Egypt) and housed in wire cages under standard lighting conditions. Mice were acclimatized for one week before the start of the experiment and provided with water and a standard pellet chow (IBEX International Co., Ltd., Cairo, Egypt). All experimental procedures complied with the established criteria for the care and use of laboratory animals, as certified by the Research Ethics Committee of the Faculty of Pharmacy, Tanta University (TP/RE/25 Ph-003).

Preparation of Ehrlich ascitic carcinoma cells

Ehrlich ascitic carcinoma (EAC) cells were purchased from the Pharmacology and Experimental Oncology Unit of the National Cancer Institute (Giza, Egypt). To maintain viability, EAC cells (1 × 10⁶) were implanted into the peritoneal cavities of mice. The cells were allowed to proliferate for 10 days. Then, ascitic fluid containing EAC cells was collected using a sterile syringe through intraperitoneal (i.p.) puncture . The collected fluid was diluted with sterile 0.9% saline and counted using a Neubauer hemocytometer (Sigma-Aldrich, USA). Cell viability was assessed using the trypan blue exclusion method, which should exceed 99% [26].

Induction of SEC and experimental design

The SEC was transplanted by subcutaneous inoculation of 0.2 mL viable EAC cells (2.5 × 10⁶/mL) into the right thigh of female Swiss Albino mice. After 12 days, a solid tumor mass of approximately 100 mm³ developed [27]. Mice bearing SEC were randomly assigned into seven experimental groups (10 mice/group) as follows: SEC control group (received vehicle); DOX group (received 4 mg/Kg i.p. DOX every 5 days on days 12^th, 17^th, 22^nd, and 27^th). The dose of DOX was based on previously established studies demonstrating effective antitumor activity with acceptable toxicity, thereby allowing evaluation of potential combination effects [26, 28]. ATO group (received 20 mg/Kg i.p. ATO on alternate days) [29]; LUT group (mice received 40 mg/Kg i.p. LUT on alternate days) [30]. The combination groups followed the same dosing schedules: ATO+DOX group (received DOX 4 mg/kg, i.p. every 5 days on days 12t^h, 17^th, 22^nd, and 27^th, concurrently with ATO 20 mg/kg, i.p. on alternate days); LUT+DOX group (received DOX 4 mg/kg, i.p. every 5 days on days 12^th, 17t^h, 22^nd, and 27^th, concurrently with LUT 40 mg/kg, i.p. on alternate days); and ATO+LUT group (received ATO 20 mg/kg, i.p. and LUT 40 mg/Kg, i.p. concurrently on alternate days).

On day 28, the experiment ended. Mice were euthanized by cervical dislocation under isoflurane anesthesia. The tumor tissue was carefully excised and weighed using an electronic balance (ADAM^®, UK). Tumor tissues were rinsed with normal saline and divided into portions. One portion was preserved in 10% neutral buffered formalin (pH 7.4) for histopathological and CD44 immunohistochemical analysis. Other portions were stored at −80°C for ABC gene expression analysis and TERT and P-TERT protein expression.

Assessment of tumor volume and survival rate

The alteration in tumor volume was evaluated three times per week from day 12 to 28. The dimensions of the tumor were measured using a Vernier digital caliper (Anyi Instrument Co., Ltd., China). Tumor volume was calculated using the formula: Tumor volume (mm³) = 0.52 (A × B²), where A and B are the length of the minor and major axis, respectively [31]. The survival rate for each experimental group was calculated as follows: Survival rate = (number of live animals in a group at the end of the experiment (day 28)/number of animals in the same group at the start) × 100 [32].

Assessment of tumor inhibition rate

The tumor inhibition rate (TIR) was calculated using the formula: TIR = [(Mean tumor volume of the control tumor group − Mean tumor volume of the treated group)/Mean tumor volume of control tumor group × 100] [26].

Assessment of combination effects

The combination effects were assessed using the Bliss multiplicative model. The fractional tumor volume (FTV) for each treatment was determined by the formula FTV = (median tumor volume of the treated group)/(median tumor volume of the tumor control) on day 28. The expected FTV for the combined treatment was calculated as FTV _expected = FTV A × FTV B. The synergistic ratio (R) was calculated using the formula R = FTV _expected/FTV _observed, where FTV _observed represents the median FTV of the combination group. A value of R greater than 1 indicates synergism, a value of R equal to 1 indicates additivity, and a value of R less than 1 indicates antagonism [33].

Assessment of ABCB1 & ABCG2 gene expression by reverse transcriptase -quantitative PCR (RT-qPCR)

Total RNA was isolated from the tumor tissue using a total RNA extraction kit (Bioer Technology, Binjiang, China) following the manufacturer’s guidelines. Complementary DNA (cDNA) was synthesized from the extracted total RNA using the HiSenScript RH (-) cDNA synthesis kit (iNtRON Biotechnology, Seongnam, Korea). The resulting cDNA was subsequently employed for quantitative PCR with SYBR Green via the SensiFAST™ SYBR No-ROX kit (Bioline, USA). Primer sequences were selected based on previously published studies by Latunde-Dada et al. [34] and El-Sisi et al. [35], and their specificity was verified with NCBI BLAST (Table 1). The primers for the target genes were synthesized by SYNBIO Technologies Co., USA. qPCR amplification was performed using a Pikoreal 5100 RT-qPCR system (Thermo Fisher Scientific, Finland) with an initial activation step at 95°C for 1 min, followed by 45 cycles consisting of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. The cycle threshold (Ct) values for the target gene were normalized to the Ct value of GAPDH (the housekeeping gene) and expressed as a relative fold change using the Livak 2^−ΔΔCT method [36].

Table 1.

Primers used for RT-qPCR

Gene	Sequence (5ˋ→ 3`)		Product Size (bp)
ABCB1	F R	ACCGCAAACGCTTTATGCTG ACGAGCTATGGCAATGCGTT	158 bp
ABCG2	F R	TCGCAGAAGGAGATGTGTTGAG CCAGAATAGCATTAAGGCCAGG	144 bp
GAPDH	F R	TGACATCAAGAAGGTGGTGAA GCATCGAAGGTGGAAGAGTG	123 bp

Primers were designed to target regions common to all transcript variants of each gene, allowing quantification of total gene expression. Specificity was confirmed using NCBI Primer-BLAST against the Mus musculus mRNA RefSeq database, ensuring unique amplification of the intended gene with no significant off-target matches. ABCB1: ATP binding cassette subfamily B member 1, ABCG2: ATP binding cassette subfamily G member 2, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, F: forward, R: reverse

Western blot analysis of telomerase reverse transcriptase

Protein expression of TERT and P-TERT (Ser824) after treatments was assessed using Western blot. Lysates were prepared from 100 mg of tumor tissues in TriFast buffer (VWR International), and protein concentration was quantified using the Bradford assay [37]. Each sample (30 µg protein) was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to a PVDF membrane (Millipore, USA). Membranes were blocked in 5% nonfat dry milk (Cell Signaling Technology, USA), then incubated overnight at 4°C with primary antibodies: TERT (1:1000, 201r-1513, SRB Laboratories), P-TERT (1:750, 201r-1534, SRB Laboratories), and β-actin (1:1000, Abcam 8224). Next, membranes were incubated with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) for 1 h at room temperature, followed by five times (10 min each) using blotting buffer (25 mM Tris, 0.15 M NaCl, 0.1% Tween-20, pH 7.4) [38]. Band intensities were quantified and normalized to β-actin using ImageJ software (version 1.53t, NIH, Bethesda, MD, USA).

Histopathological examination

Tumor samples were carefully excised and immediately fixed in 10% neutral buffered formalin (pH 7.4) for 24 h. Following fixation, the samples underwent standard paraffin embedding, after which sections were cut at a thickness of 3 μm and stained with hematoxylin and eosin (H and E) [39]. Stained sections were examined using a light microscope (Olympus BX51, Olympus America, Melville, NY), and images were acquired with a digital camera (Olympus DP11) attached to the microscope. The resulting images were analyzed to quantify tumor giant cells, nuclear karyorrhexis, mitotic figures, and apoptotic cells. For each sample, cell counts were performed in six randomly selected high-power fields, evaluating 100 cells per field.

Immunohistochemical examination of CD44

Paraffin-embedded tissue sections undergo deparaffinization with xylene, followed by rehydration through a graded ethanol series. Antigen retrieval was performed by microwave heating in 10 mM citrate buffer (pH 6.0) for 10 -20 min, followed by cooling at room temperature. Endogenous peroxidase activity was inhibited by incubating sections with 3% hydrogen peroxide in phosphate-buffered saline (PBS) for 10 min. After PBS rinses, nonspecific binding was blocked using a protein-blocking solution containing 1.5% normal goat serum in PBS for 20 min. Sections were incubated overnight at 4°C with rabbit monoclonal anti-CD44 antibody (1:200; EPR18668; Abcam, USA). After additional PBS washes, sections were treated with an HRP-conjugated secondary antibody. Immunoreactivity was visualized using 3,3-diaminobenzidine tetrahydrochloride as the chromogen. Sections were rinsed with distilled water and counterstained with hematoxylin for 10 s [40]. Cytoplasmic CD44 expression was assessed by immunohistochemistry. Tumor cells were classified as negative if fewer than 10% of cells were stained. Positive staining was scored based on the percentage of positive cells: 10–25% as weak, 26–50% as moderate, and more than 50% as strong. Quantitative analysis was conducted in seven high-power fields at ×400 magnification of the tumor tissue using ImageJ software [41]. H and E staining and immunohistochemical analyses were conducted on adjacent, non-serial tissue sections, as the limited availability of tissue blocks precluded direct serial-section comparisons. All sections were processed under identical experimental conditions to maintain consistency in morphological and immunohistochemical evaluation.

Statistical analysis

Data normality was evaluated using the Shapiro–Wilk test. Statistical analyses were conducted using one-way analysis of variance (ANOVA), followed by Fisher’s least significant difference (LSD) post hoc test, with the Statistical Package for the Social Sciences (SPSS, version 22.0). Statistical significance was defined as p < 0.05. Results are presented as mean ± standard deviation (SD) and percentage change [42].

Results

Effect on tumor volume, TIR, and survival rate

As illustrated in Fig. 1A, tumor volume increased gradually in the untreated SEC group in a time-dependent manner. At the end of the experiment, mice bearing SEC and treated with DOX, ATO, or LUT showed a significant (p < 0.05) decrease in tumor volume by 39.86%, 35.84%, and 30.66%, respectively, compared to the SEC untreated group (Table 2). Treatment with ATO + DOX, LUT + DOX, or ATO + LUT resulted in a significant (p < 0.05) reduction in tumor volume by 57.38%, 52.67%, and 66.30%, respectively, compared to the SEC group. The combined treatments demonstrated a significant decrease in tumor volume relative to the individual treatments. This effect was particularly notable in the ATO + LUT-free DOX treatment.

Fig. 1.

Effect of Various Treatments on (A) Tumor Volume, (B) Tumor Inhibition Rate, (C) Survival Rate (%) in Mice Bearing Solid Ehrlich Carcinoma (SEC). DOX: Doxorubicin (4 mg/kg i.p.), ATO: Atorvastatin (20 mg/kg i.p.), LUT: Luteolin (40 mg/kg i.p.). Data are presented as Mean ± SD (n=10), a: significant versus SEC, b: significant versus DOX, c: significant versus ATO, d: significant versus LUT, e: significant versus ATO+DOX, f: significant versus LUT+DOX.

Table 2.

Effect of various treatments on tumor volume and weight

Animal Groups	At the end of the experiment
	Tumor volume (mm3)	Tumor weight (g)
SEC tumor control	3003.32 ± 90.37	6.76 ± 0.58
DOX	1806.27 ± 91.41 a	4.11 ± 0.76 a
ATO	1927.01 ± 35.94 a	4.16 ± 0.84 a
LUT	2082.45 ± 128.99 a	4.24 ± 0.89 a
ATO + DOX	1279.91 ± 91.05 a, d	2.30 ± 0.35 a, b, c, d
LUT + DOX	1421.55 ± 69.64 a	2.87 ± 0.07 a, b, c, d, e
ATO + LUT	1012.97 ± 65.05 a, b, c, d	1.71 ± 0.29 a, b, c, d, f

Data are presented as mean ± SD. SEC: solid Ehrlich carcinoma, DOX: (Doxorubicin; 4 mg/kg i.p.), ATO: (Atorvastatin; 20 mg/kg i.p.), LUT: (Luteolin; 40 mg/kg i.p.). a: significant versus SEC, b: significant versus DOX, c: significant versus ATO, d: significant versus LUT, e: significant versus ATO + DOX, f: significant versus LUT + DOX

The calculated TIR further supported the antitumor efficacy of the treatment groups. Treatment with DOX, ATO, and LUT resulted in TIR of 39.81%, 38.80%, and 30.60%, respectively. Similarly, groups co-treated with ATO + DOX, LUT + DOX, and ATO + LUT exhibited TIR of 57.39%, 52.61%, and 67.28%, respectively. The TIR ranked in descending order: ATO + LUT > ATO + DOX > LUT + DOX > DOX > ATO > LUT (Fig. 1B).

To further evaluate these results, treatment interactions were assessed using observed and expected FTV. The expected FTV values were 0.434 for ATO + DOX, 0.478 for ATO + LUT, and 0.461 for LUT + DOX, while the corresponding observed FTV values were 0.420, 0.342, and 0.460, respectively. Calculation of the synergistic ratio (R) revealed that the ATO + DOX and ATO + LUT combinations exhibited synergistic effects, with R values of 1.03 and 1.40, respectively. In contrast, the LUT + DOX combination exhibited an additive interaction (R = 1.00). Collectively, these findings indicate that the co-treated groups demonstrated significant inhibition of tumor growth compared with the respective individual treatment groups.

The survival rates during the experimental period were also examined. The SEC control group demonstrated a 71.4% survival rate, while the DOX-treated group had a survival rate of 78.6%. Individual treatments with ATO or LUT showed slightly higher survival rates, with 85.7%. In contrast, combination treatments showed the highest survival rates with 92.9% in ATO + DOX, LUT +DOX, and ATO + LUT groups (Fig. 1C).

Effect on tumor weight

As illustrated in Table 2, all treatments significantly (p < 0.05) decreased tumor weight compared to the SEC control group. Treatment with DOX, ATO, or LUT groups resulted in a significant (p < 0.05) reduction in tumor weight by 39.18%, 38.43%, and 37.25%, respectively, compared to the SEC group. Similarly, treatment with ATO + LUT, ATO + DOX, and LUT + DOX significantly (p < 0.05) reduced tumor weight by 74.69%, 65.96%, and 57.53%, respectively, compared to the SEC group. Combined treatments, especially ATO +LUT, significantly reduced tumor weight compared to all treatment groups (Table 2).

Effect on ABCB1 and ABCG2 gene expression

Treatment of tumor tissue significantly suppressed ABCB1 and ABCG2 gene expression, as illustrated in Fig. 2. Mice treated with DOX, ATO, or LUT demonstrated a significant (p < 0.05) downregulation in ABCB1 expression by 5.7%, 17.1%, and 13.5%, and in ABCG2 expression by 22.4%, 10.3%, and 15.6%, respectively, relative to the SEC untreated group.

Fig. 2.

Effect of Various Treatments on (A) ABCB1 Gene Expression and (B) ABCG2 Gene Expression in Mice Bearing Solid Ehrlich Carcinoma (SEC). DOX: Doxorubicin (4 mg/kg i.p.), ATO: Atorvastatin (20 mg/kg i.p.), LUT: Luteolin (40 mg/kg i.p.). Data are presented as Mean ± SD (n=10), a: significant versus SEC, b: significant versus DOX, c: significant versus ATO, d: significant versus LUT, e: significant versus ATO+DOX, f: significant versus LUT+DOX. ABCB1: ATP-binding cassette (ABC) subfamily B member 1, ABCG2: ABC subfamily G member 2.

Similarly, co-treatment with ATO + DOX, LUT + DOX, and ATO + LUT exerted a significant (p < 0.05) reduction in ABCB1 expression by 59.1%, 43.4%, and 54.8%, and in ABCG2 expression by 53.8%, 31.4%, and 40.4%, respectively, compared to the SEC untreated group. Among all treated groups, the co-treated with ATO + DOX exhibited the most significant reduction in ABCB1 and ABCG2 gene expression (Fig. 2).

Effect on TERT and P-TERT protein expression

As shown in Fig. 3, mice bearing SEC and treated with DOX, ATO, or LUT showed a significant (p < 0.05) reduction in TERT protein expression by 14.88%, 19.28%, and 28.66%, respectively, compared to the SEC group. However, no significant difference in TERT protein expression was observed between the individual treatments of DOX and ATO. On the other hand, the groups co-treated with ATO + DOX, LUT + DOX, and ATO + LUT showed a significant (p < 0.05) reduction in TERT protein expression by 34.32%, 62.8%, and 70.5%, respectively, compared to the SEC group (Fig. 3A, B).

Fig. 3.

Effect of Various Treatments on Protein Expression of TERT and P-TERT: (A)Representative Western Blot Bands of TERT (~127 kDa), P-TERT (~127 kDa), and β-actin (~44kDa), ( B) Relative Protein Expression of TERT/ β-actin, (C) Relative Protein Expression of P-TERT/β-actin, (D) TERT/P-TERT Ratio. DOX: Doxorubicin (4 mg/kg i.p.), ATO: Atorvastatin (20mg/kg i.p.), LUT: Luteolin (40 mg/kg i.p.), SEC: Solid Ehrlich carcinoma. Data are presented asMean±SD (n=3), a: significant versus SEC, b: significant versus DOX, c: significant versus ATO, d:significant versus LUT, e: significant versus ATO+DOX, f: significant versus LUT+DOX. TERT:Telomerase reverse transcriptase, P-TERT: Phosphorylated telomerase reverse transcriptase.

Additionally, the mice bearing SEC treated with DOX, ATO, or LUT showed a significant (p < 0.05) reduction in P-TERT protein expression by 9.7%, 23.01%, and 19.57%, respectively, compared to the SEC-untreated group. Similarly, ATO + DOX, LUT + DOX, or ATO + LUT co-treated groups had a significant (p < 0.05) reduction in P-TERT protein expression by 39.74%, 52.39%, and 68.67%, respectively, compared to the SEC group. Co-treated groups demonstrated a significant decrease in TERT and its phosphorylated form protein expression relative to individual treatment groups (Fig. 3A, C). Notably, ATO + LUT combined treatment showed the most significant reduction in both TERT and P-TERT compared to all other treatments (Fig. 3).

To further assess the effect of these treatments, we calculated the TERT/P-TERT ratio in each group to evaluate changes in TERT phosphorylation status. A lower ratio reflects enhanced TERT phosphorylation, whereas a higher ratio indicates reduced phosphorylation. DOX, LUT, and LUT + DOX treatments resulted in a decreased ratio, indicating increased TERT phosphorylation. In contrast, ATO, ATO + DOX, and ATO + LUT increased the ratio, suggesting suppression of TERT phosphorylation (Fig. 3D).

Effect on histopathology of solid tumor tissue

As illustrated in Fig. 4(A-C), in the control SEC group, histopathological examination revealed viable foci with densely packed, round, polygonal, large, deeply stained tumor cells interspersed with small eosinophilic necrotic zones, which replaced the subcutaneous and muscular tissues. Furthermore, the SEC group showed a high number of unusual mitotic figures (3.5 ± 0.52), tumor giant cells (2.6 ± 0.52), and minimal nuclear karyorrhexis (0.7 ± 0.48), with a small number of apoptotic cells (2.4 ± 0.52) (Fig. 7).

Fig. 4.

Representative photomicrographs of H&E-stained solid tumor sections of the SEC and DOX groups. (A-C) SEC control group: A showing viable foci consisting of densely packed large, round, and polygonal deeply stained tumor cells (black arrows) interspaced by small eosinophilic necrotic zones (white arrows) replacing subcutaneous and muscular tissues (magnification ×100: scale bar 100 μm). B & C showing numerous atypical mitotic figures (yellow arrowheads), tumor giant cells (open arrowheads), and very mild nuclear karyorrhexis (blue arrows), as well as a few apoptotic cells (curved arrow) (magnification ×400; scale bar 50 μm). (D-F) DOX group: D showing smaller viable foci containing shrunken tumor cells (black arrows) interspaced by larger eosinophilic necrotic zones (white arrows) than in the SEC group (magnification ×100; scale bar 100 μm). E & F showing very few atypical mitotic figures (yellow arrowheads), very few tumor giant cells (open arrowheads), and increased nuclear karyorrhexis (blue arrows) were observed with many apoptotic cells (curved arrow) (magnification ×400; scale bar 50 μm).

Fig. 7.

The Effect of Various Treatments on Tumor Histopathology; (A) Number of apoptotic cells, (B) Number of nuclear karyorrhexis, (C) Number of nuclei having mitotic figures, and (D) Number of tumor giant cells. DOX: Doxorubicin (4 mg/kg i.p.), ATO: Atorvastatin (20 mg/kg i.p.), LUT: Luteolin (40 mg/kg i.p.). SEC: Solid Ehrlich carcinoma. Data are presented as Mean ± SD (n=10). a: significant versus SEC, b: significant versus DOX, c: significant versus ATO, d: significant versus LUT, e: significant versus ATO+DOX, f: significant versus LUT+DOX. HPF: High power field.

As shown in Fig. 4(D-F), sections from mice treated with DOX showed smaller viable foci with reduced tumor cells than the SEC untreated group. The DOX-treated group exhibited a significant (p < 0.05) reduction in atypical mitotic figures by 85.7% (0.5 ± 0.52) and tumor giant cells by 84.6% (0.4 ± 0.516), with elevated nuclear karyorrhexis by 142.85% (1.7 ± 0.48) and apoptotic cells by 187.5% (6.9 ± 0.99) compared to the SEC untreated group (Fig. 7).

Tumor sections from mice treated with ATO revealed fewer viable foci with reduced tumor cells than the SEC untreated group (Fig. 5A-C). Sections of the ATO group also demonstrated a significant (p < 0.05) reduction in tumor giant cells by 88.5% (0.3 ± 0.48) with a substantial increase in nuclear karyorrhexis by 157.14% (1.8 ± 0.42) and apoptotic cells by 145.8% (5.9 ± 0.73) compared to the SEC group (Fig. 7).

Fig. 5.

Representative photomicrographs of H & E-stained solid tumor sections of ATO and LUT groups. (A-C) ATO group: A showing smaller viable foci containing shrunken tumor cells (black arrows) interspaced by large eosinophilic necrotic zones (white arrows) (magnification×100; scale bar 100 μm). B & C showing very few tumor giant cells (open arrowheads), increased nuclear karyorrhexis (blue arrows), and many apoptotic cells (curved arrow) (magnification×400; scale bar 50 μm). (D-F) LUT group: D showing many viable foci containing shrunken tumor cells (black arrows) interspaced by eosinophilic necrotic zones (white arrows) (magnification ×100; scale bar 100 μm). E & F showing few tumor giant cells (open arrowheads), prominent nuclear karyorhexis (blue arrows), and many apoptotic cells (curved arrow) (magnification ×400; scale bar 50 μm).

Moreover, sections from mice treated with LUT demonstrated multiple viable foci with shrunken tumor cells (Fig. 5D-F). LUT treatment revealed a significant decrease in tumor giant cells by 53.8% (1.2 ± 0.42) and an increase in nuclear karyorrhexis by 157.14% (1.8 ± 0.42) and apoptotic cells by 175% (6.6 ± 0.52) compared to the SEC control group (Fig. 7).

Tumor sections from the ATO + DOX group revealed a few smaller viable foci containing shrunken tumor cells, as well as a few tumor cells within the viable areas of the tumor (Fig. 6A, B). ATO+DOX treatment showed a significant reduction in tumor giant cells by 92.3% (0.2 ± 0.42), an increase in nuclear karyorrhexis by 314.3% (2.9 ± 0.32), and an elevation in the apoptotic cells by 450% (13.2 ± 0.79) compared to the control SEC group (Fig. 7).

Fig. 6.

Representative photomicrographs of H&E-stained solid tumor sections of co-treatedgroups. (A, B) ATO+DOX group; A showing few smaller viable foci containing shrunkentumor cells (black arrows) interspaced by widespread eosinophilic necrotic zones (whitearrows) (magnification ×100; scale bar 100 μm). B showing few tumor cells within theviable areas, very few tumor giant cells (open arrowheads), prominent nuclear karyorrhexis(blue arrows), and many apoptotic cells (curved arrow) (magnification ×400; scale bar50 μm). (C, D) LUT+DOX group: C showing viable foci containing shrunken tumor cells(black arrows) interspaced by eosinophilic necrotic zones (white arrows) (magnification×100; scale bar 100 μm). D showing few tumor giant cells (open arrowheads), very fewatypical mitotic figures (yellow arrowheads), prominent nuclear karyorrhexis (blue arrows),and many apoptotic cells (curved arrow) were observed (magnification X400: bar 50). (E,F) ATO+LUT group; E showing small viable foci containing few shrunken tumor cells(black arrows) interspaced by eosinophilic necrotic zones (white arrows) (magnification×100; scale bar 100 μm). F showing very few tumor giant cells (open arrowheads), nomitotic figures, marked nuclear karyorrhexis (blue arrows), and many apoptotic cells(curved arrow) (magnification ×400; scale bar 50 μm).

Tumor sections from mice receiving LUT+ DOX treatment showed viable foci containing shrunken tumor cells (Fig. 6C, D). LUT + DOX treatment also showed a significant decrease in tumor giant cells by 88.5% (0.3 ± 0.48), a reduction in mitotic figures by 85.7% (0.4 ± 0.52), an increase in nuclear karyorrhexis by 271.4% (2.6 ± 0.51), and an increase in apoptotic cells by 387.5% (11.7 ± 1.16) compared to the control SEC group (Fig. 7).

Fig. 6(E, F) showed that tumor sections from mice bearing SEC and treated with ATO + LUT revealed small viable foci containing a few shrunken tumor cells. Sections from the ATO + LUT-treated group also showed a significant reduction of tumor giant cells (0.2 ± 0.41) by 92.3% relative to the SCE group. There was also a significant increase in nuclear karyorrhexis (2.9 ± 0.31) and apoptotic cells (15.8 ± 0.79) by 314.3% and 558.3%, respectively, compared to the SEC group (Fig. 7).

The co-treated groups, especially the ATO + LUT group, exhibited a significant (p < 0.05) increase in apoptotic cells compared to all treatments and nuclear karyorrhexis compared to individual treatment groups (Fig. 7A, B). Mitotic figures were observed in the SEC, DOX, and LUT + DOX groups but were absent in the ATO, LUT, ATO + DOX, and ATO + LUT-treated groups (Fig. 7C). All treatments revealed a significant reduction in tumor giant cells relative to the SEC control group (Fig. 7D).

Immunohistochemical localization of CD44 in solid tumor tissue

Fig. 8(A–G) illustrates the immunohistochemical staining of tumor sections from the control and treated groups. The SEC control group exhibited strong positive CD44 expression (90.35 ± 0.86). Tumor sections from the DOX group showed strong CD44 immunostaining, but this was significantly reduced by 12% (79.5 ± 0.8) compared to the SEC group (P < 0.05). ATO or LUT individual treatments resulted in moderate CD44 expression, with significant reduction by 48.78% (46.28 ± 1.49) and 64.89% (31.72 ± 1.29), respectively, compared with the SEC group. Notably, combined treatments with ATO + DOX, LUT + DOX, and ATO + LUT exhibited weak CD44 immunostaining, with significant reductions by 76.24% (21.47 ± 1.49), 79.07% (18.91 ± 0.91), and 86.73% (11.99 ± 0.99), respectively, compared to the SEC group. Among all treatments, the ATO + LUT combined treatment demonstrated the most significant reduction in CD44 expression. Furthermore, all combined treatments significantly decreased CD44 expression compared with the corresponding individual treatment groups, as illustrated in Fig. 8H.

Fig. 8.

Microscopic pictures of immunostained sections from solid Ehrlich carcinoma (SEC) tumors against CD44. Immunostaining showed strong positive expression in SEC control group (A) and DOX group (B), moderate expression in ATO (C) and LUT (D) groups, and weak expression in ATO+DOX (E), LUT+DOX (F), and ATO+LUT (G) groups (magnification ×400; scale bar 50µm). H: The Percent (%) Expression of CD44 immunostained sections in various treated groups: Data are presented as Mean±SD (n=10), a: significant versus SEC, b: significant versus DOX, c:significant versus ATO, d: significant versus LUT, e: significant versus ATO+DOX, f: significant versus LUT+DOX. DOX: Doxorubicin, ATO: Atorvastatin, LUT: Luteolin.

Discussion

Breast cancer (BC) is the most diagnosed malignancy affecting women globally. One of the major obstacles in treating BC is resistance to therapy. The mechanisms of chemoresistance in BC are complex and result in treatment failure, including enhanced drug efflux through transporter proteins such as ABC transporters, DNA repair mechanisms, the existence of CSCs, and decreased apoptosis [43].

Doxorubicin (DOX) is one of the most effective chemotherapeutic medications for BC treatment. However, resistance to DOX has developed, which promotes tumor growth and leads to adverse effects on patient prognosis and survival [14]. Therefore, adjuvant therapy, whether natural or synthetic, with DOX is necessary to address drug resistance and minimize side effects. The present study was designed to investigate the effects of ATO and LUT as adjunctive therapies with or without DOX in mice bearing SEC. We also evaluated the potential role of these combinations in mitigating various drug resistance mechanisms, including cancer stemness, telomerase, and ABC transporter expression.

In the present study, a reduction in tumor volume and weight was observed in the DOX-treated group relative to the SEC group. These results were aligned with histopathological findings; herein, the DOX group revealed fewer tumor cells, increased apoptotic cells, a low number of mitotic figures, small numbers of tumor giant cells, and elevated nuclear karyorrhexis compared to the SEC untreated group. Additionally, SEC-untreated group showed the lowest survival rate, indicating a higher tumor burden. In contrast, DOX-treated mice demonstrated a slightly higher survival rate than the SEC group, which is consistent with the moderate toxicity of DOX. These findings were consistent with previous studies [28, 44].

Fortunately, the ATO or ATO+DOX treatments demonstrated higher survival rates than the SEC untreated or DOX groups. Mice treated with ATO or ATO+DOX exhibited a marked reduction in volume and weight of tumor, accompanied by an increase in TIR, compared to the DOX group. These results were supported by histopathological findings, which revealed the absence of mitotic figures and an increase in apoptosis compared to DOX single treatment. ATO+DOX treatment showed significantly greater effectiveness than ATO or DOX individual treatments. The anticancer effects of ATO have been previously reported in many studies [15, 21, 29].

Similarly, mice treated with the LUT+DOX combination exhibited an enhanced antitumor effect, as evidenced by significant reduction in tumor volume and weight. This combination demonstrated an increase in TIR and a higher survival rate than individual treatments with DOX or LUT. The histopathological findings were also improved in LUT+DOX treatment. These results were aligned with Soliman et al. [45] and Azab et al. [46], who suggested that LUT has an anticancer effect against SEC through promoting P53 and cyclin D1 expression and activating the apoptosis process. Thus, our findings indicated that combining ATO or LUT with DOX can enhance the anticancer activity of DOX by reducing tumor cell proliferation and growth, which may be attributed to synergistic and additive interactions between agents.

In addition, mice treated with the ATO+LUT combination showed the most significant reduction in tumor volume and weight, as well as an increased TIR compared to all treated groups. This combination also showed an increase in survival rate compared to single treatments. The histopathological findings corroborated these results, suggesting that the combination of ATO and LUT enhanced the anticancer efficacy of individual treatments. Previous studies supported and interpreted these findings, where Palko-Łabuz et al. [47] demonstrated that combining simvastatin and mevastatin with flavonoids such as baicalein and 6-hydroxyflavone significantly enhanced their cytotoxic and pro-apoptotic effects, thereby overcoming drug resistance in colon cancer cells. Furthermore, the co-application of simvastatin and mevastatin with 8-prenylnaringenin and chrysin reduced cell viability and induced apoptosis in Jurkat human leukemic T cells [48]. These results demonstrated that treatment with ATO+LUT produced substantial tumor inhibition and notable histopathological improvements, regardless of the DOX. This enhanced efficacy may be attributed to a synergistic interaction between the two agents, suggesting that the combination therapy has superior therapeutic potential compared with either agent alone.

ABC transporters serve as a barrier against various harmful substances. However, overexpression of ABCB1 and ABCG2 transporters facilitates the efflux of chemotherapeutic agents, lowering their intracellular concentrations to subtherapeutic levels and ultimately promoting the development of resistance [49]. Thereby, targeting these transporters could enhance the accumulation of chemotherapeutic agents within cancer cells, leading to increased cancer cell death [50].

The current study indicated that treatment with either DOX or ATO, individually, downregulated the expression of the ABCB1 and ABCG2 genes compared to the SEC group. Furthermore, mice that received ATO+DOX treatment exhibited greater inhibition of these genes than all treatments. These data were consistent with the study of Deng et al. [51], who revealed that some statins, such as rosuvastatin, lovastatin, fluvastatin sodium, and ATO, may inhibit ABCG2. Furthermore, simvastatin suppressed the expression of ABCB1 and ABCG2 genes in human neuroblastoma (SH-SY5Y) cells and in two xenograft mouse models [52]. Our findings indicated that combining ATO with DOX was associated with reduced ABCB1 and ABCG2 gene expression, suggestive of potential modulation of chemoresistance-related pathways. However, this interpretation is based only on gene expression changes, as this study did not assess intracellular DOX accumulation.

It has been demonstrated that flavonoids can inhibit ABC transporters through several strategies, including interfering with ATP hydrolysis, blocking the drug binding site, lowering their expression, interacting with membrane transporter proteins, and impeding the removal of drugs through these transporters [53]. The present results indicated that mice treated with LUT exhibited downregulation of ABCB1 and ABCG2 gene expression. This finding was agreed with El Gueder et al. [54], who reported that LUT inhibited ABCB1 in the DOX-resistant human sarcoma cell line (MES-SA/Dx5).

Our findings showed that the LUT+DOX co-treated group demonstrated a significant suppression of ABCB1 and ABCG2 gene expression compared to individual treatment. This finding supported that combining flavonoids with chemotherapy medications could be considered a promising strategy for cancer treatment [55]. Additionally, ATO+LUT combined treatment resulted in downregulation of ABCB1 and ABCG2 gene expression compared to either treatment alone. This further supports their ability to modulate key pathways of chemoresistance.

Telomerase is essential for maintaining telomere length and preserving genome stability. However, uncontrolled telomere elongation, conferring cellular immortality, is a feature of cancer cells [56]. Phosphorylation of TERT by several kinases at specific sites enhances telomerase activity, protein interactions, and the overall behavior of cancer cells. These modifications could potentially lead to aggressive cancer phenotypes characterized by increased proliferation and therapeutic resistance [7].

In the current study, DOX, ATO, or their combination exhibited a marked reduction in TERT and P-TERT protein expression compared to the SEC group. The ATO+DOX group revealed more inhibitory effects than individual treatments. The combination also increased TERT/P-TERT ratio, reflecting a greater impact on TERT phosphorylation. These findings were consistent with the study by Wang et al. [57], who showed that ATO inhibited TERT expression in human hepatocellular carcinoma cell lines (HepG2 and Hep3B).

Fortunately, LUT or LUT+DOX combined treatment suppressed TERT and P-TERT protein expression compared to single DOX treatment; however, both treatments decreased TERT/P-TERT ratio. Similar findings were observed in the study by Huang et al. [58], who reported that treating human triple-negative BC cells (MDA-MB-231) with LUT for 48 h significantly reduced TERT mRNA expression. The present study showed a significant decrease in both TERT and P-TERT protein expressions following ATO+LUT treatment, accompanied by an increase in the TERT/P-TERT ratio. Notably, this combination elicited a significantly greater suppression of TERT and P-TERT expression than all other treatments.

CD44 is a marker for CSCs in multiple malignancies. It can contribute to cancer chemoresistance through several mechanisms, including the upregulation of MDR1 protein expression, enhancement of drug efflux, and modulation of apoptosis-related gene expression [59, 60]. In the current study, immunohistochemical results revealed a strong expression of CD44 in the DOX group, which was significantly reduced in mice treated with ATO and ATO+DOX. This beneficial effect of ATO could be attributed to the downregulation of Wnt/β-catenin, AKT signaling, and signal transducer and activator of transcription 3, as reported by Choi et al. [19] upon examination of the human gastric adenocarcinoma cell line (MKN45).

The anticancer effect of LUT was further demonstrated in the current work when combined with DOX, where CD44 expression was significantly reduced in the LUT+DOX group compared to individual treatment groups. Tasi et al. [61] reported that LUT treatment inhibited CD44 in MDA-MB-231 cells, suggesting that LUT may play a significant role in targeting and reducing the stem-like properties in BC cells. Furthermore, ATO+LUT combined treatment exerted a greater reduction in CD44 expression than the SEC control and other treatment groups. These findings highlighted the impact of combined treatments in reducing cancer stem cell characteristics and lowering resistance to chemotherapy.

Despite the promising findings, the present study has several limitations. Continuous body weight monitoring and comprehensive toxicological evaluations were not performed, which would have allowed a more thorough assessment of systemic safety. Future studies should incorporate longitudinal toxicity assessments and further examine doxorubicin uptake, intracellular accumulation, and the functional activity of ABCB1 and ABCG2 transporters to clarify their contribution to treatment response.

Conclusion

Our study demonstrated that the use of ATO or LUT as adjuvant therapy, with or without DOX, resulted in antitumor effects in the SEC mouse model through the modulation of multiple complementary pathways. The combined treatments significantly reduced tumor volume and weight, promoted apoptosis, and suppressed key factors associated with cancer progression and chemotherapy resistance, including ABC gene expression, TERT protein expression, and the presence of cancer stem cells. These findings likely reflect synergistic and additive interactions among the combined treatments, emphasizing the superior therapeutic efficacy compared with single treatments. The combined ATO and LUT, without DOX, exhibited significant antitumor effects, including a reduction in tumor burden, TERT, and P-TERT protein expression, as well as a decrease in CD44 expression level, suggesting a potentially safer, chemotherapy-free strategy that could improve therapeutic outcomes while minimizing reliance on chemotherapeutic medications. Collectively, these findings point out the clinical promise of repurposing widely available agents, such as statins and dietary flavonoids, to enhance chemotherapy responsiveness or reduce dependence on conventional cytotoxic drugs. Future studies are warranted to elucidate the molecular mechanisms underlying the DOX-independent antitumor activity of the ATO and LUT combination.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Al-Ashmawy GM: Designed the study, analyzed the data, and reviewed the manuscript. El-Ashmawy NE: Conceived and designed the study, analyzed the data, and critically reviewed the manuscript. Hamada OB: Conducted the research, analyzed the data, and drafted the manuscript. Khedr NF: Conceived and designed the study, analyzed the data, and reviewed the manuscript. All authors have approved the final version of the manuscript for publication.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.