Abstract
Background
Multiple myeloma (MM) is an incurable tumor characterized by the clonal expansion of malignant plasma cells in the bone marrow. Tumor-associated macrophages (TAMs) play a crucial role in the MM microenvironment by promoting plasma cell survival and conferring therapy resistance. ETV1 (E-twenty-six transformation-specific variant 1) is a transcription factor that has been proven to be an oncogenic driver in various cancers, but its functional role and the potential mechanisms in MM remain poorly understood.
Methods
Gene expression profiles were analyzed in bone marrow plasma cells from three healthy and 45 MM samples obtained from the GSE125361 dataset. Cell growth was assessed using CCK-8 and colony formation assays. Macrophage phenotypes were characterized by flow cytometry, and TAM infiltration was evaluated via immunofluorescence double staining. Tumor development was detected by in vivo fluorescence imaging system. Transcriptional activity was examined using luciferase reporter and chromatin immunoprecipitation (ChIP) assays. The N6-Methyladenosine (m6A) modification levels of ETV1 in MM cells were detected by m6A RNA immunoprecipitation followed by qPCR (m6A RIP-qPCR), and the interaction between ETV1 mRNA and METTL3 (methyltransferase-like 3) was evaluated using RIP-PCR.
Results
Bioinformatics analysis revealed that ETV1 was significantly upregulated in MM and associated with poor prognosis of MM patients. Gain-of-function and loss-of-function experiments demonstrated that ETV1 overexpression enhanced MM cell proliferation and M2 polarization of TAMs both in vitro and in vivo, whereas ETV1 knockdown exerted the opposite effects. Mechanistically, we confirmed that METTL3 upregulated ETV1 expression by enhancing its m6A methylation modification. Furthermore, ETV1 transcriptionally activated RBMS1 (RNA-binding motif, single-stranded-interacting protein 1), and RBMS1 knockdown abrogated the pro-tumorigenic effects of ETV1 overexpression.
Conclusions
These findings underscore the pivotal role of the ETV1/RBMS1 signaling axis in MM progression and M2 polarization of TAMs. Our results further suggest that ETV1 may represent a promising therapeutic target in MM, offering novel insights into its oncogenic function and underlying regulatory mechanisms.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12967-026-07799-7.
Keywords: Multiple myeloma, Tumor-associated macrophages, ETV1, m6A methylation, RBMS1
Introduction
Multiple myeloma (MM) is an incurable hematological malignancy characterized by the proliferation of malignant plasma cells within the bone marrow microenvironment. This pathological process leads to serious complications, including osteolytic bone lesions, renal impairment, and profound immunosuppression [1, 2]. Despite significant advancements in therapeutic approaches over the past decade, the prognosis of MM patients remains suboptimal, with a 5-year survival rate below 25% [3]. This grim reality highlights the urgent need to elucidate the molecular mechanisms underlying MM pathogenesis and to identify novel targets for its therapy.
The survival and proliferation of malignant plasma cells rely heavily on their dynamic interactions with various matrix components such as stromal cells, extracellular matrix proteins and soluble mediators [4]. Among these microenvironmental elements, tumor-associated macrophages (TAMs) have emerged as a pivotal player in MM [5, 6]. Convincing evidence indicates that TAMs not only protect MM cells from spontaneous and drug-induced apoptosis, but also promote multiple aspects of tumor biology, including cell proliferation, invasion and metastasis [7]. Notably, TAMs predominantly exhibit an M2-like polarization state, functioning as a major source of anti-inflammatory cytokines that further reinforce the immunosuppressive microenvironment [8, 9]. This polarized phenotype enables macrophages to simultaneously support tumor growth while actively suppressing anti-tumor immune responses, creating a permissive environment for MM progression.
E-twenty-six transformation-specific (ETS) transcription factor family plays a pivotal role in various physiological and pathological processes such as embryogenesis, wound healing and tumor progression [10, 11]. ETV1 (ETS variant 1), a member of the ETS family, has emerged as a key oncogenic driver in multiple malignancies. For instance, ETV1 promoted tumorigenesis in a mouse model of melanoma [12]. In pancreatic ductal adenocarcinoma, ETV1 facilitated epithelial-mesenchymal transition (EMT), stromal expansion, and metastasis through the upregulation of HAS2 [13]. Similarly, ETV1 promoted metastatic progression in hepatocellular carcinoma by modulating the expression of PTK2 and c-MET [14]. In addition, ETV1 was significantly associated with the infiltration of TAMs in colorectal cancer [15]. Intriguingly, ETV1 was shown to orchestrate the recruitment of M2 TAMs in esophageal squamous cell carcinoma [16]. However, its precise functional role in MM progression and M2 polarization of TAMs remain to be fully elucidated.
N6-Methyladenosine (m6A), an abundant epigenetic modification in mRNA and non-coding RNAs, plays a critical role in regulating RNA stability, splicing, and translation [17]. m6A modification modulates gene expression in a post-transcriptional manner, involving three classes of proteins: methyltransferases (“writers”), demethylases (“erasers”), and RNA-binding proteins (“readers”) [18]. METTL3 (methyltransferase-like 3), a methyltransferase for m6A modification, has been extensively implicated in tumor progression across multiple cancer types, including bladder cancer [19], prostate cancer [20], hepatocellular carcinoma [21] and cervical cancer [22]. Notably, accumulating evidence has demonstrated that METTL3 is significantly upregulated in MM and contributes to its tumorigenesis [23, 24]. Strikingly, the SRAMP database reveals the presence of highly probable m6A modification sites on ETV1 mRNA (http://www.cuilab.cn/m6asiteapp/old). Furthermore, the RM2Target database predicts METTL3 as a potential m6A writer for ETV1 (http://rm2target.canceromics.org/#/search). However, the mechanistic relationship between METTL3-mediated m6A modification and ETV1 upregulation in MM remains unclear and warrants further investigation.
RBMS1 (RNA-binding motif, single-stranded-interacting protein 1) is an RNA-binding protein that has been demonstrated to play an oncogenic role in various malignancies, including gastric cancer [25], triple-negative breast cancer [26], and non-small cell lung cancer [27]. Interestingly, bioinformatics analysis using the JASPAR database (https://jaspar.elixir.no/) revealed the presence of potential ETV1 binding sites in the promoter region of RBMS1, suggesting a possible transcriptional regulatory relationship between these two molecules. Based on these findings, we hypothesized that ETV1 may contribute to MM progression and infiltration of TAMs through transcriptional regulation of RBMS1. However, this hypothesis requires experimental validation.
This study aims to: (1) investigate the role of ETV1 in MM progression and M2 polarization of TAMs and (2) elucidate the underlying molecular mechanism mediated by the ETV1/RBMS1 axis.
Materials and methods
Bioinformatics analysis
The gene expression dataset GSE125361, comprising three normal and 45 MM bone marrow plasma cell samples, was obtained from the GEO database for bioinformatic analysis. Quantitative data values were pre-processed using Feature Extraction software 11.5.1.1 (Agilent, USA) using default parameters. Differentially expressed genes (DEGs) were identified using the thresholds |log₂FC|>1 and p < 0.05. A volcano plot was generated to visualize the distribution of DEGs using R (4.3.0) package ggplot2 (3.5.1). Functional enrichment analyses, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were performed to identify key pathways associated with MM using R (4.3.0) package ggplot2 (3.5.1). The expression pattern of all ETS family members was illustrated using a heat map (R (4.3.0) package ggplot2 (3.5.1)) and a lollipop plot. Kaplan-Meier survival analysis (https://www.kmplot.com/analysis/index.php? p=service&cancer=myeloma) was conducted to assess the prognostic significance of ETV1, ETV2, and ETV5 expression levels in MM patients. In addition, statistical differences between normal and MM samples were analyzed using Student’s t-test.
Xenograft tumor models
All animal procedures were approved by the Ethics Committee of the Harbin Medical University and were conducted in accordance with the Guide for the Care and Use of Laboratory Animals. Six-week-old female NOG mice were randomly assigned to four groups: EV, OE-ETV1 shRNA-NC, shRNA-1-ETV1 and shRNA-2-ETV1. Following one week of acclimatization, the mice were intravenously injected with RPMI8226 cells (5 × 106 cells /mouse, n = 6/group). Tumor development was assessed 24 days post-injection using an in vivo fluorescence imaging system. After imaging, serum and tumor tissues were collected for further analysis.
H&E staining
The tumor tissues were fixed in 4% formaldehyde solution, dehydrated and embedded in paraffin. Sections of 5 μm thickness were prepared, deparaffinized and rehydrated. Subsequently, the sections were stained with hematoxylin for 5 min and eosin for 3 min. Pathological changes in the tissue sections were then examined and imaged under a microscope (Olympus).
Immunohistochemical staining
The fixed tissue sections in 4% formaldehyde solution were deparaffinized and rehydrated, followed by quenching of endogenous peroxidase activity with 3% H2O2 for 15 min. Subsequently, the sections were incubated overnight at 4 °C with ETV1 antibody (dilution 1: 100, AP51197, Abcepta, Suzhou, China). Afterward, goat anti-rabbit IgG/HRP secondary antibody (dilution 1:100, SE134, Solarbio) was added and incubated at 37 °C for 45 min. Staining was visualized using DAB (MXB® Biotechnology, Fuzhou, China). Finally, the nuclei were counterstained with hematoxylin, and images were acquired using an Olympus microscope.
Cell lines, culture conditions and cell transfection
RPMI8226 cells were obtained from iCell Bioscience (Shanghai, China) and cultured in IMDM medium (Biosharp, Hefei, China) containing 20% fetal bovine serum (FBS, Tianhang Biotechnology, Zhejiang, China). KMS11 and THP-1 cells were obtained from iCell Bioscience and cultured in RPMI-1640 medium (Solarbio, Beijing, China) containing 10% FBS. All cells were placed in a 5% CO2 incubator at 37 °C.
ETV1 overexpression vector (with an His tag) was synthesized from General bio (Anhui, China). METTL3 overexpression vector was synthesized from Youbio, (Changsha, China). siRNAs targeting RBMS1 (siRNA-1-RBMS1: GGACAAGUUAUUUCUACAATT, siRNA-2-RBMS1: GCAGAUGAGUCAUCUG.
UCATT and siRNA-3-RBMS1: GGUGAAGCUCUGUCAACCATT) were obtained from Genecefepharm Biotech (Wuxi, China). Overexpressed plasmids and siRNAs were transfected into MM cells by Lipofectamine 3000 Reagent (Invitrogen, Carlsbad, CA, USA).
Construction of stable ETV1 knockdown or overexpression
To generate stable cell lines with ETV1 knockdown or overexpression, shRNAs targeting ETV1 (shRNA-1: CCGGGCTCATGATTCAGAAGAACTTTCAAGAGAA.
GTTCTTCTGAATCATGAGCCTTTTT and shRNA-2: CCG CTTTCAAGATCTAAG.
TCAATTTTCAAGAGAAATTGACTTAGATCTTGAAAGTTTTT) were cloned into the pLKO.1-EGFP-puro lentiviral vector (Fenghui Biotechnology, Changsha, China), while human ETV1 cDNA was inserted into the pCDH-CMV-MCS-EF1-GFP-T2A-puro lentiviral vector (Fenghui Biotechnology). Each construct was co-transfected with lentiviral packaging plasmids (psPAX2 and pMD2.G, Fenghui Biotechnology) into HEK293T cells to produce lentiviral particles. The resulting lentiviruses were then used to infect RPMI8226 and KMS11 cells to establish stable lines. After 72 h, the infection efficiency was assessed using quantitative real-time PCR (qPCR) and western blot analysis.
Cell viability assay
Cells were seeded in 96-well plates at a density of 6 × 103 cells/well and incubated for the indicated durations (0, 24, 48, and 72 h). Subsequently, 10 µl CCK8 solution (Biosharp) was added to each well, followed by incubation for 2 h at 37 °C. The optical density (OD) at 450 nm was measured using a microplate reader (BioTek, Winooski, VT, USA).
Colony formation assay
Cells were seeded at 1000 cells per culture plate and cultured in a 37 °C 5% with CO2 incubator containing 0.33% Argrose (Biosharp). After about 2 weeks, they were observed and photographed under a microscope (Olympus, Tokyo, Japan).
Co-culture of M0 macrophages and MM cells
THP-1 cells were differentiated into M0 macrophages by treatment with 350 nM phorbol 12-myristate 13-acetate (PMA, Macklin, Shanghai, China) for 24 h. For the macrophage polarization assay, a Transwell system was employed. MM cells (5 × 105 cells/well) were seeded in the upper chamber, while M0 macrophages (1 × 106 cells/well) were placed in the lower chamber. After 24 h of co-culture, the proportion of CD206 (a marker of M2 macrophages) was measured in the M0 population using flow cytometry.
Flow cytometry analysis
For cell cycle detection, cells were centrifuged at 1000 g for 5 min, and the precipitated cells were mixed with 1 ml precooled 70% ethanol and fixed overnight at 4 °C. Cells were centrifuged and precipitated again, and after removal of the supernatant, 1 ml precooled PBS was added and resuspended. The steps of centrifugation and removal of the supernatant were repeated, and 0.5 ml propidium iodide (PI) staining solution was added to the cells for resuspension of cell precipitation. The samples were incubated at 37 °C in the dark for 30 min and immediately subjected to flow detection.
For detection of CD68 + or CD206+: cells were collected by centrifugation. After fixation and membrane rupture, 5 µl human CD68 antibody (CL647-65593, Proteintech, Rosemont, IL, USA) or CD206 human antibody (CL647-98458-3, Proteintech) were added and incubated in the dark for 30 min at 4 °C. For detection of CD11b+F4/80 + CD206+, cells were collected by centrifugation, and 5 µl mouse CD11b antibody (E-AB-F1081D, Elabscience, Wuhan, China), 5 µl mouse F4/80 antibody (E-AB-F0995J, Elabscience), and 5 µl mouse CD206 antibody (E-AB-F1135E, Elabscience) were added and incubated in the dark for 30 min. Subsequently, the cells were washed with staining buffer, centrifuged at 350 g for 5 min, and the supernatant was discarded. Next, cell precipitate was resuspended in the Cell Staining Buffer. Flow cytometry was then performed using NovoCyte (Agilent, USA), and data were analyzed using NovoExpress (1.4.1).
Enzyme-linked immunosorbent assay (ELISA)
CCL2 levels in cell culture supernatants were measured using a CCL2 ELISA kit (FineTest, Wuhan, China) according to the manufacturer’s instructions.
qPCR
Total RNA was extracted using TRIpure (BioTeke, Beijing, China) and reverse-transcribed into cDNA using the HP All-in-one qRT Master MixⅡ (YoungGen Biotechnology, Kunming, China). qPCR was performed using SYBR Green (Solarbio) on a Pangaea 3 instrument (Abcepta). The relative fold change in gene expression was calculated using the 2 − ΔΔCt method, with α-tubulin serving as the internal reference control. The primer sequences used are listed in Table 1.
Table 1.
qPCR primer sequences
| Name | Sequence 5’-3’ |
|---|---|
| ETV1 F | CAAGAGCCAGGAATGTA |
| ETV1 R | TAATAGCGGAGTGAACG |
| RBMS1 F | GGCAAAGCAACAGGAAC |
| RBMS1 R | AAAGCCAACACCACGAC |
| METTL3 F | GACAGCCCAGTGCCTAC |
| METTL3 R | GACCTCGCTTTACCTCAA |
| CD163 F | GAGACTGTTAGGGAAGGTG |
| CD163 R | TGTTTGTTGCCTGGATT |
| Arg-1 F | TTTGCTGACATCCCTAAT |
| Arg-1 R | TTCCGTTCTTCTTGACTT |
| CD206 F | TGGGTGTCCGAATCTCA |
| CD206 R | CGATCCCTTGTAGAGCATA |
| CCL2 F | TCATAGCAGCCACCTTCATT |
| CCL2 R | TCACAGCTTCTTTGGGACAC |
| RIP ETV1 F | AAGGTATTTAGCGATTG |
| RIP ETV1 R | CCTATGACTCAGTTTGG |
| CHIP RBMS1 F | CCAGTTGACCCAGAATC |
| CHIP RBMS1 R | CGAGAACAATCGCAGAA |
| β-actin F | CAGCCATGTACGTTGCTATCCA |
| β-actin R | TCACCGGAGTCCATCACGAT |
RNA Immunoprecipitation (RIP) assay
RIP assay was performed using a commercial RIP Kit (Genecreate, Wuhan, China). Briefly, cells were lysed with RIP lysis buffer, and the lysates were incubated with RIP buffer containing Protein A/G magnetic beads conjugated with 3 µg anti-METTL3 antibody (15073-1-AP, Proteintech) or control IgG for 3 h. After immunoprecipitation and subsequent washing with RIP wash buffer, the complexes were eluted with elution buffer and analyzed by reverse transcription PCR.
m6A RIP-qPCR
Following the manufacturer’s instructions of the m6A MeRIP kit (Bersin, Guangzhou, China), RNA fragments were immunoprecipitated using Protein A/G magnetic beads pre-coated with 4 µg m6A antibody or IgG for 2 h. After washing with IP buffer, the m6A-modified RNA fragments were eluted, and the m6A enrichment of ETV1 was quantified by qPCR.
Luciferase reporter assay
The luciferase reporter vectors containing the full-length or truncated promoter sequences of RBMS1 were inserted into pGL3-Basic plasmid and transfected into RPMI8226 cells together with ETV1 overexpression plasmid. pRL-TK was used as internal reference plasmid. Luciferase activity was measured 24 h after transfection using a kit (Biosharp).
Chromatin immunoprecipitation (ChIP) assay
ChIP assay was conducted using a commercial ChIP assay kit (Beyotime, Shanghai, China). Briefly, cells were cross-linked with 1% formaldehyde for 10 min at 37 °C. The reaction was quenched with glycine solution to terminate fixation. Cells were then pelleted and resuspended in 0.2 ml SDS lysis buffer supplemented with 1 mM PMSF. The chromatin was fragmented by sonication to generate DNA fragments of appropriate size. Next, 20 µl aliquot of the lysate was set aside as the input control, and the remaining sample was incubated with 70 µl Protein A/G Agarose/Salmon Sperm DNA slurry. After centrifugation at 1,000 × g for 1 min at 4 °C, the supernatant was collected and incubated with 1 µg target-specific antibody or control IgG. Subsequently, 60 µl Protein A/G Agarose/Salmon Sperm DNA was added to immunoprecipitate the antibody-chromatin complexes. Finally, the co-precipitated DNA was purified and analyzed by reverse transcription PCR. The primers are listed in Table 1.
Western blot
Equal amounts of protein (20 µg) extracted using RIPA buffer (Solarbio) were separated by 10% SDS-PAGE and subsequently transferred onto PVDF membranes (Millipore, Billerica, MA, USA). The membranes were then incubated overnight at 4 °C with the following primary antibodies: human ETV1 (1: 1000 dilution, AP51197, Abcepta), human cyclinD1 (1: 5000 dilution, 26939-1-AP, Proteintech, Wuhan, China), human RBMS1 (1: 1000 dilution, 11061-2-AP, Proteintech) and human CCL2 (1: 500 dilution, 507277, Zen-bioscience, Chengdu, China). After primary antibody incubation, the membranes were probed with goat anti-rabbit IgG/HRP secondary antibody (1:3000 dilution, SE134, Solarbio) at room temperature for 1 h. Protein signals were detected using an ECL system (Solarbio), and band intensities were quantified through grayscale analysis with Tanon Image software (Shanghai, China).
Statistical analysis
All data were expressed as mean ± standard deviation (SD) and analyzed using GraphPad Prism 8.0 software. Statistical differences were analyzed using Student’s t-test (for two groups) and one-way or two-way analysis of variance, followed by Tukey post hoc tests (for multiple groups). p < 0.05 was defined as statistical significance.
Results
Bioinformatics analysis of gene expression in MM
To identify potential therapeutic targets in MM, we obtained the GSE125361 dataset from the GEO database for comprehensive bioinformatics analysis. The volcano plot revealed 1,471 significantly upregulated genes and 2,254 significantly downregulated genes (Fig. 1A). Subsequent GO enrichment analysis of these DEGs demonstrated significant enrichment in key biological processes including DNA replication, regulation of cell cycle phase transition and macrophage activation. At the molecular levels, these DEGs were notably enriched in the DNA replication preinitiation complex and DNA-binding transcription factor binding (Fig. 1B). KEGG pathway analysis further indicated that these DEGs were primarily involved in critical pathways such as DNA replication, cell cycle regulation, transcriptional misregulation in cancer, and PI3K-Akt signaling pathway (Fig. 1B).
Fig. 1.
Bioinformatics analysis of gene expression in MM. The data of GSE125361 expression profile were subjected to bioinformatics analysis. (A) Volcano plot was used to display the expression of DEGs. (B) GO and KEGG enrichment analysis of DEGs was performed. (C-D) Heat map and lollipop graph were employed to show the expression of all ETS family members. (E) The expression of three DEGs (ETV1, ETV2 and ETV5) in the ETS family in the GSE125361 chip. (F) Kaplan-Meier Plotter was utilized to analyze the survival of MM patients with low or high expression of ETV1, ETV2 and ETV5. Data are mean ± SD. #, p < 0.05; ##, p < 0.01
The ETS family has been widely involved in the progression of cancers. To further analyze the expression profile of ETS family members, we employed both heatmap and lollipop graph visualizations. Our analysis revealed three DEGs within the ETS family: ETV1, ETV2 and ETV5 (Fig. 1C-D). Subsequent examination of these DEGs in normal and MM bone marrow plasma cell samples demonstrated that ETV1 and ETV2 were significantly upregulated in MM samples (Fig. 1E). Survival analysis yielded intriguing findings: elevated expression of ETV1 and ETV5 correlated with poorer patient outcomes, high ETV2 expression was unexpectedly associated with improved survival (Fig. 1F). This paradoxical survival benefit observed with ETV2 expression warranted further investigation. Among the remaining candidates (ETV1 and ETV5), we selected ETV1 as the primary focus for this study based on its more pronounced log2FC, suggesting a potentially stronger biological relevance in MM pathogenesis.
m6A modification of ETV1 enhances its mRNA levels
To substantiate the mechanism underlying ETV1 upregulation in MM, we employed a comprehensive approach combining bioinformatic prediction and experimental validation. Initial analysis using the SRAMP database revealed multiple high-probability m6A modification sites on ETV1 mRNA, suggesting potential regulation through this epigenetic mechanism (Fig. 2A). Subsequent m6A RIP-qPCR analysis in MM cell lines confirmed significantly elevated m6A modification levels of ETV1 (Fig. 2B). Bioinformatic screening through the RM2Target database identified METTL3 as a potential m6A methyltransferase responsible for ETV1 m6A modification. This prediction was experimentally confirmed by RIP-PCR, which demonstrated direct binding between METTL3 and ETV1 mRNA in both MM cells (Fig. 2C). To establish a functional relationship, we generated METTL3-overexpressed MM cells through plasmid transfection. After 48 h, successful overexpression of METTL3 was confirmed by qPCR (Fig. 2D). As reflected, overexpression of METTL3 enhanced ETV1 m6A modification levels, as well as elevated ETV1 mRNA and protein expression levels (Fig. 2E-F). In addition, MM cells were treated with 5 µM actinomycin D for 0 h, 3 h and 6 h, and the mRNA levels of ETV1 was detected by qPCR. The results indicated that METTL3 overexpression enhanced ETV1 mRNA stability (Fig. 2G). Altogether, these results unveiled that METTL3-mediated m6A modification played a crucial role in stabilizing ETV1 expression in MM cells, providing mechanistic insight into ETV1 upregulation in this malignancy.
Fig. 2.
m6A modification of ETV1 enhances its mRNA levels. (A) The SRAMP database was used to display potential m6A modification sites on ETV1 mRNA. (B) m6A RIP-qPCR was employed to detect the m6A modification levels of ETV1 in MM cells. (C) RIP-PCR was applied to determine ETV1 mRNA binding to METTL3 in MM cells. (D) The overexpression efficiency of METTL3 in MM cells was verified by qPCR. (E) m6A RIP-qPCR was used to measure the m6A modification levels of ETV1 in METTL3-overexpressed cells. (F) The expression of ETV1 in METTL3-overexpressed cells was examined by qPCR and western blot. (G) Cells were treated with 5 µM actinomycin D for different time periods (0 h, 3 h, 6 h), and qPCR was applied to detect the levels of ETV1 mRNA in MM cells. Data are mean ± SD. #, p < 0.05; ##, p < 0.001; ###, p < 0.001; ####, p < 0.0001
ETV1 promotes MM cell proliferation and cell cycle progression
To elucidate the functional role of ETV1 in MM progression, we established stable ETV1-overexpressed and ETV1-silenced MM cell lines through lentiviral infection of RPMI8226 and KMS11 cells. The infection efficiency of ETV1 was successfully validated at both transcriptional and protein levels (Supplementary Fig. 1A). Subsequent functional assays revealed that ETV1 overexpression significantly enhanced MM cell proliferation, as demonstrated by increased cell viability and greater colony formation capacity (Fig. 3A-B). Cell cycle analysis further showed that ETV1 upregulation promoted cell cycle arrested in S phase (Fig. 3C). Western blot results showed that overexpression of ETV1 upregulated the protein levels of cyclinD1 (Fig. 3D). Conversely, ETV1 knockdown produced opposing effects, effectively suppressing proliferation and cell cycle progression (Fig. 3A-D). Taken together, these findings provided compelling evidence supporting the oncogenic role of ETV1 in MM pathogenesis.
Fig. 3.
ETV1 promotes MM cell proliferation and cell cycle progression. (A) Cell viability was measured by CCK-8 assay. (B) Cell proliferation was determined by colony formation assay. (C) Cell cycle distribution was detected by flow cytometry. (D) The expression of cyclinD1 in MM cells was tested by western blot. Data are mean ± SD. ##, p < 0.01; ###, p < 0.001; ####, p < 0.0001
MM cell-derived ETV1 fosters M2 polarization of TAMs
To explore the potential effect of ETV1 on M2 polarization of TAMs, we first differentiated THP-1 cells into M0 macrophages by treatment with 350 nM PMA for 24 h. Light microscopy examination revealed successful morphological differentiation of THP-1 cells into M0 macrophages following PMA treatment (Fig. 4A). Flow cytometry analysis further confirmed the differentiation efficiency, showing that approximately 85% of the cells expressed the macrophage marker CD68 (Fig. 4B). Using a Transwell co-culture system (Fig. 4C), we assessed the impact of ETV1 on macrophage polarization. Given the established role of CCL2 in macrophage recruitment and M2 polarization, we further examined whether ETV1 regulates CCL2 secretion. Our data revealed that ETV1 overexpression remarkably enhanced CCL2 production, while ETV1 knockdown reduced its secretion (Fig. 4D). Furthermore, our results demonstrated that M2 polarization of TAMs depends on CCL2 secreted by MM cells overexpressing ETV1, as evidenced by increased mRNA expression of M2 markers (CD163, Arg-1 and CD206) and a higher percentage of CD206 + cells and mean fluorescence intensity (MFI) (Fig. 4E-F, Supplementary Fig. 2A-B). Conversely, ETV1 knockdown effectively suppressed M2 polarization of TAMs (Fig. 4E-F, Supplementary Fig. 2A-B). Overall, these findings demonstrated that ETV1 played a pivotal role in promoting M2 polarization of TAMs within the MM microenvironment, potentially through modulation of CCL2 secretion.
Fig. 4.
MM cell-derived ETV1 fosters M2 polarization of TAMs. (A) THP-1 cells were incubated with 350 nM PMA for 24 h to induce M0 macrophage differentiation. The morphology of M0 macrophages was photographed with a microscope. (B) The proportion of CD68 + cells in M0 macrophages were detected by flow cytometry. (C) M2 polarization of TAMs was measured by Transwell co-culture system. M0 macrophages were seeded into the lower chamber, and MM cells were seeded into the upper chamber. (D) The levels of CCL2 in MM cells was tested by qPCR and ELISA. (E) After 48 h of co-culture, the expression of CD163, Arg-1 and CD206 in M0 macrophages was determined by qPCR. (F) The proportion of CD206 + cells and MFI in M0 macrophages were examined by flow cytometry. Data are mean ± SD. #, p < 0.05; ##, p < 0.01; ###, p < 0.001; ####, p < 0.0001
ETV1 facilitates tumor growth and M2 polarization of macrophages in vivo
To determine the role of ETV1 in MM tumorigenesis and M2 macrophage infiltration in vivo, we established xenograft models by intravenously injecting NOG mice with RPMI8226 cells stably overexpression or knockdown of ETV1. At 24 days post-injection, in vivo fluorescence imaging revealed that ETV1 overexpression greatly enhanced tumor growth, whereas ETV1 knockdown markedly suppressed it (Fig. 5A). Consistent with these findings, histological analysis through H&E staining demonstrated more pronounced tumor formation in the bone tissues of ETV1-overexpression mice, while ETV1 knockdown exhibited the opposite effect (Fig. 5B). Immunohistochemical staining further confirmed elevated human ETV1 expression in bone marrow tissues from the overexpression group and reduced expression in the knockdown group (Fig. 5C).
Fig. 5.
ETV1 facilitates tumor growth and M2 polarization of macrophages in vivo. (A) The development of tumors was determined by the in vivo fluorescence imaging system. (B) H&E staining was used to detect tumor formation in bone tissues of mice. (Scale bar = 100 μm). (C) Immunohistochemical staining was used to examine the expression of human ETV1 in bone marrow tissues. (Scale bar = 50 μm). (D) Flow cytometry was used to test the proportion of mouse-derived M2 phenotypic macrophages (F4/80 + CD206+/F4/80+) in M0 macrophages (F4/80+) in bone marrow tissues. (E) The expression of human CCL2 in bone marrow tissues was detected by western blot. Data are mean ± SD. ##, p < 0.01; ###, p < 0.001; ####, p < 0.0001
Subsequently, we verified whether ETV1 affects infiltration of macrophages. Flow cytometry analysis showed a substantial increase in the proportion of mouse-derived M2 macrophages (F4/80 + CD206+/F4/80+) in macrophages (F4/80+) within bone marrow tissues from ETV1-overexpressing mice, with a corresponding decrease observed in the knockdown mice (Fig. 5D). Western blot analysis demonstrated that ETV1 overexpression upregulated human CCL2 expression in bone marrow tissues, while ETV1 knockdown downregulated its expression (Fig. 5E). Collectively, these results defined that ETV1 promoted MM tumor growth and M2 polarization of macrophages in vivo.
ETV1 activates RBMS1 transcription
To investigate the potential transcriptional regulation of RBMS1 by ETV1, we performed a series of experiments to examine their functional relationship. Initially, we assessed the impact of ETV1 on RBMS1 expression levels. Notably, ectopic expression of ETV1 led to a significant upregulation of RBMS1, while ETV1 knockdown resulted in decreased RBMS1 expression (Fig. 6A-B), suggesting a positive regulatory relationship between them. To further elucidate the mechanistic basis of this regulation, we conducted luciferase reporter assay, which demonstrated that ETV1 overexpression markedly enhanced the transcriptional activity of the RBMS1 promoter (Fig. 6C). Through promoter analysis, we identified a critical ETV1-responsive region (-1500 to -2000 bp upstream of the transcription start site) that was essential for RBMS1 transcriptional activation (Fig. 6C). Subsequent ChIP assay using RPMI8226 cells transfected with His-tagged ETV1 confirmed the direct binding of ETV1 to the RBMS1 promoter region (Fig. 6D). Hence, these observations underscored that ETV1 functioned as a transcriptional activator of RBMS1 through direct promoter binding, establishing a novel regulatory axis in MM.
Fig. 6.
ETV1 activates RBMS1 transcription. (A-B) The expression of human RBMS1 in mouse bone marrow tissues and MM cells was verified by qPCR and western blot. (C) The luciferase reporter vectors containing the full-length or truncated promoter sequences of RBMS1 were inserted into pGL3-Basic plasmid and co-transfected with the ETV1 overexpression plasmid into RPMI8226 cells. After 48 h, the luciferase activity was measured by the kit. (D) The binding of exogenous ETV1 and RBMS1 promoter was detected by ChIP-PCR. Data are mean ± SD. ##, p < 0.01; ###, p < 0.001; ####, p < 0.0001
RBMS1 knockdown counteracts the effect of ETV1 overexpression on MM cell proliferation and M2 polarization of TAMs
To ascertain the potential role of RBMS1 as a downstream effector of ETV1, we first performed siRNA-mediated knockdown of RBMS1 in RPMI8226 cells. qPCR analysis confirmed the efficient silencing of RBMS1 at 48 h post-transfection (Fig. 7A). Additionally, the results showed that RBMS1 knockdown decreased CCL2 mRNA levels (Supplementary Fig. 2A), suggesting that RBMS1 modulated CCL2 transcription. Subsequently, siRNA-3-RBMS1 was transfected into stable ETV1-overexpressed cells to conduct functional rescue experiments. CCK-8 assays and flow cytometry analysis revealed that RBMS1 knockdown abolished the ETV1-induced enhancement of cell viability and cell cycle progression (Fig. 7B-C). Western blot analysis showed that RBMS1 silencing reversed the upregulation of cyclinD1 expression caused by ETV1 overexpression (Fig. 7D). ELISA indicated that RBMS1 knockdown normalized the elevated CCL2 secretion in ETV1-overexpressed cells (Fig. 7E). Most notably, RBMS1 knockdown abrogated the ETV1-driven M2 polarization of TAMs, as evidenced by decreased expression of CD163 and CD206 markers and reduced proportion of CD206 + cells among M0 macrophages (Fig. 7F-G). These comprehensive findings collectively established that RBMS1 served as a crucial downstream of ETV1’s biological functions, particularly in influencing MM cell proliferation and M2 polarization of TAMs (Fig. 8).
Fig. 7.
RBMS1 knockdown counteracts the effect of ETV1 overexpression on MM cell proliferation and M2 polarization of TAMs. (A) siRNAs targeting RBMS1 were transfected into RPMI8226 cells. After 48 h, the knockdown efficiency of RBMS1 in cells was verified by qPCR. (B) Cell viability was measured by CCK-8 assay. (C) Cell cycle distribution was detected by flow cytometry. (D) The expression of cyclinD1 in cells was detected by western blot. (E) The levels of CCL2 in the cell supernatant were determined by ELISA. (F) M2 polarization of TAMs was tested by Transwell co-culture system. M0 macrophages were seeded into the lower chamber, and MM cells were seeded into the upper chamber. After 48 h of co-culture, the expression of CD163 and CD206 in M0 macrophages were determined by qPCR. (G) The proportion of CD206 + cells and MFI in M0 macrophages were examined by flow cytometry. Data are mean ± SD. #, p < 0.05; ##, p < 0.01; ###, p < 0.001; ####, p < 0.0001
Fig. 8.
Schematic diagram demonstrating the mechanism of ETV1 and RBMS1 to promote MM progression and M2 polarization of TAMs
Discussions
In this study, we identified ETV1 as a key regulator of both MM cell proliferation and M2 polarization of TAMs. Mechanistically, we demonstrated that METTL3-mediated m6A methylation epigenetically upregulated ETV1 expression. Furthermore, our findings revealed that ETV1 exerted its oncogenic effects in MM through transcriptional activation of RBMS1. These results provided important insights into the molecular pathogenesis of MM and suggested that targeting the METTL3/ETV1/RBMS1 axis may represent a promising therapeutic strategy for MM patients.
METTL3-mediated m6A modification is a ubiquitous post-transcriptional regulatory mechanism that governs gene expression through multifaceted control of RNA metabolism, including processing, localization, translation, and stability [28, 29]. Emerging evidence has established the critical involvement of this epigenetic modification in MM pathogenesis. Specifically, METTL3 has been shown to promote MM progression by mediating m6A methylation of key oncogenic targets such as THRAP3, RBM25 and USP4 [30]. Furthermore, METTL3 enhanced MM tumorigenesis through m6A-dependent stabilization of YY1 mRNA [23]. Building upon these findings, our present study demonstrated that METTL3 upregulated ETV1 expression through m6A modification, thus explaining the reason for the elevated expression of ETV1 in MM.
The oncogenic role of ETV1 in tumor development has been well-established across various cancer types, including hepatocellular carcinoma [14], gastrointestinal stromal tumor [31] and colorectal cancer [32]. Although numerous studies have extensively verified the tumor-promoting functions of ETV1, its specific role in MM progression remains poorly understood. Our functional experiments revealed that ETV1 overexpression significantly enhanced cell viability and accelerated cell cycle progression in MM cells, whereas ETV1 knockdown produced opposing effects. These findings were consistent with previous reports of ETV1’s oncogenic properties, further substantiating its cancer-promoting role in MM pathogenesis.
Macrophages, key components of the innate immune system, constitute up to 30–50% of infiltrating immune cells in certain cancers [33]. TAMs are particularly abundant in the tumor microenvironment and exhibit functional similarities to M2-polarized macrophages, contributing significantly to tumor pathogenesis in many cancers [34]. Notably, TAMs have been implicated in promoting tumor progression, conferring drug resistance, and serving as negative prognostic indicators in MM [6]. A previous literature has indicated that ETV1 enhanced TAM infiltration in esophageal squamous cell carcinoma [16]. Therefore, we further investigated whether ETV1 also influences M2 polarization of TAMs. The results revealed that ETV1 overexpression led to increased expression of M2 polarization markers and a higher abundance of CD163-positive cells. These findings suggested that ETV1 played a promotive role in driving M2 polarization of TAMs within the MM microenvironment.
RBMS1 is an RNA-binding protein that has been proven to play a pro-tumorigenic role in multiple cancers. In gastric cancer, RBMS1 facilitated metastasis by activating the IL-6/JAK2/STAT3 signaling pathway [25]. Similarly, in triple-negative breast cancer, RBMS1 depletion enhanced antitumor immunity, suggesting its immunosuppressive function in the tumor microenvironment [26]. Additionally, RBMS1 derived metastasis in non-small cell lung cancer by augmenting the translation of S100P [27]. Notably, analysis of JASPAR database revealed potential ETV1 binding sites in the RBMS1 promoter region, implying that ETV1 may contribute to tumorigenesis, potentially in MM, through transcriptional activation of RBMS1. To experimentally validate the regulatory relationship between ETV1 and RBMS1 in MM, we first examined the impact of ETV1 on RBMS1 expression at both transcriptional and translational levels. Our results demonstrated that ETV1 significantly upregulated RBMS1 expression in MM cells. Subsequent luciferase reporter assay confirmed the binding of ETV1 to the promoter region of RBMS1, a finding that was further substantiated by ChIP experiment. These compelling data strongly suggested that ETV1 transcriptionally activated RBMS1, revealing a novel ETV1/RBMS1 signaling axis that may play a critical role in MM pathogenesis. To explore whether ETV1 exerted its oncogenic functions in MM through RBMS1, we performed functional rescue experiments. Remarkably, siRNA-mediated knockdown of RBMS1 abolished the proliferative advantage conferred by ETV1 overexpression in MM cells, as well as the ability to promote M2 polarization of TAMs. These findings provided definitive evidence that RBMS1 served as a crucial downstream effector of ETV1-mediated oncogenic signaling in MM.
Although our study elucidates the functional role and molecular mechanisms of ETV1 in MM, several limitations should be acknowledged. First, we did not validate ETV1 expression in clinical MM samples. Future studies should address this gap, as such validation would provide critical translational evidence supporting ETV1 as a therapeutic target in MM. Additionally, while we demonstrated that METTL3-mediated m6A modification increased ETV1 expression, other regulatory mechanisms contributing to ETV1 upregulation still deserve further exploration. Moreover, our findings established ETV1’s role in promoting MM cell proliferation and M2 polarization of TAMs. However, its potential involvement in other oncogenic processes, such as angiogenesis, glucose metabolism reprogramming and apoptosis resistance, warrants further mining. Despite these limitations, our study provided compelling evidence for the oncogenic function of ETV1 in MM, laying the foundation for developing novel targeted therapies against this malignancy.
Conclusions
In this study, we discover the pivotal role of ETV1 in promoting cancer cell proliferation and M2-polarized TAMs in MM. In addition, we demonstrate that METTL3 enhances the m6A methylation of ETV1, further upregulating its expression. Mechanistically, ETV1 exerts its oncogenic effects in MM through the transcriptional regulation of RBMS1. Collectively, our findings highlight ETV1 as a promising therapeutic target for MM treatment.
Supplementary Information
Below is the link to the electronic supplementary material.
Author contributions
Yan Liu and Yueqi Geng did experiments, collected data and wrote the manuscript. Boyang Zheng, Aijia Zhang and Kerou Yang performed data analysis and summarized the results. Yinling Mao and Li Jiang designed experiment and revised the manuscript. All authors have read and approved the manuscript.
Funding
This research was funded by Heilongjiang Provincial Natural Science Foundation of China (grant number PL2024H160), Haiyan Foundation of Harbin Medical University Cancer Hospital (grant number JJMS2021-28) and XinRui Cancer Support Treatment Project of China Primary Health Care Foundation (grant number cphcf-2022-226).
Data availability
Data generated or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethical approval
All animal procedures were approved by the Ethics Committee of the Harbin Medical University and were conducted in accordance with the Guide for the Care and Use of Laboratory Animals.
Conflict of interest
The authors declare no potential conflicts of interest.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Yan Liu and Yueqi Geng contributed equally to this work.
Contributor Information
Yinling Mao, Email: 830216@hrbmu.edu.cn.
Li Jiang, Email: 601935@hrbmu.edu.cn.
References
- 1.Medical Masterclass c, Firth J. Haematology: multiple myeloma. Clin Med (Lond). 2019;19:58–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Joshua DE, Bryant C, Dix C, Gibson J, Ho J. Biology and therapy of multiple myeloma. Med J Aust. 2019;210:375–80. [DOI] [PubMed] [Google Scholar]
- 3.Xiang P, Yeung YT, Wang J, Wu Q, Du R, Huang C, Jia X, Gao Y, Zhi Y, Guo F, et al. miR-17-3p promotes the proliferation of multiple myeloma cells by downregulating P21 expression through LMLN Inhibition. Int J Cancer. 2021;148:3071–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nakamura K, Smyth MJ, Martinet L. Cancer immunoediting and immune dysregulation in multiple myeloma. Blood. 2020;136:2731–40. [DOI] [PubMed] [Google Scholar]
- 5.Kamal M, Shishido SN, Mason J, Patel K, Manasanch EE, Orlowski RZ, Kuhn P. Single-cell proteomic analysis reveals multiple myeloma heterogeneity and the dynamics of the tumor immune microenvironment in precursor and advanced States. Neoplasia. 2025;66:101189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Sun J, Corradini S, Azab F, Shokeen M, Muz B, Miari KE, Maksimos M, Diedrich C, Asare O, Alhallak K, et al. IL-10R Inhibition reprograms tumor-associated macrophages and reverses drug resistance in multiple myeloma. Leukemia. 2024;38:2355–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Sun J, Park C, Guenthner N, Gurley S, Zhang L, Lubben B, Adebayo O, Bash H, Chen Y, Maksimos M et al. Tumor-associated macrophages in multiple myeloma: advances in biology and therapy. J Immunother Cancer. 2022;10. [DOI] [PMC free article] [PubMed]
- 8.Uckun FM. Overcoming the immunosuppressive tumor microenvironment in multiple myeloma. Cancers (Basel). 2021;13. [DOI] [PMC free article] [PubMed]
- 9.Xu R, Li Y, Yan H, Zhang E, Huang X, Chen Q, Chen J, Qu J, Liu Y, He J, et al. CCL2 promotes macrophages-associated chemoresistance via MCPIP1 dual catalytic activities in multiple myeloma. Cell Death Dis. 2019;10:781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sizemore GM, Pitarresi JR, Balakrishnan S, Ostrowski MC. The ETS family of oncogenic transcription factors in solid tumours. Nat Rev Cancer. 2017;17:337–51. [DOI] [PubMed] [Google Scholar]
- 11.Hsing M, Wang Y, Rennie PS, Cox ME, Cherkasov A. ETS transcription factors as emerging drug targets in cancer. Med Res Rev. 2020;40:413–30. [DOI] [PubMed] [Google Scholar]
- 12.Jane-Valbuena J, Widlund HR, Perner S, Johnson LA, Dibner AC, Lin WM, Baker AC, Nazarian RM, Vijayendran KG, Sellers WR, et al. An oncogenic role for ETV1 in melanoma. Cancer Res. 2010;70:2075–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Heeg S, Das KK, Reichert M, Bakir B, Takano S, Caspers J, Aiello NM, Wu K, Neesse A, Maitra A, et al. ETS-Transcription factor ETV1 regulates stromal expansion and metastasis in pancreatic cancer. Gastroenterology. 2016;151:540–e553514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhang T, Wang Y, Xie M, Ji X, Luo X, Chen X, Zhang B, Liu D, Feng Y, Sun M, et al. HGF-mediated elevation of ETV1 facilitates hepatocellular carcinoma metastasis through upregulating PTK2 and c-MET. J Exp Clin Cancer Res. 2022;41:275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Shen X, Zhou C, Feng H, Li J, Xia T, Cheng X, Zhao R, Zou D. ETV1 positively correlated with immune infiltration and poor clinical prognosis in colorectal cancer. Front Immunol. 2022;13:939806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Han T, Guo X, Xie J, Tong W, Zhang L. SUMO modified ETV1 promotes M2-polarized tumor-associated macrophage infiltration and cancer progression by facilitating CCL2 transcription in esophageal squamous cell carcinoma cells. Cancer Immunol Immunother. 2025;74:87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Oerum S, Meynier V, Catala M, Tisne C. A comprehensive review of m6A/m6Am RNA methyltransferase structures. Nucleic Acids Res. 2021;49:7239–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chen D, Gu X, Nurzat Y, Xu L, Li X, Wu L, Jiao H, Gao P, Zhu X, Yan D, et al. Writers, readers, and erasers RNA modifications and drug resistance in cancer. Mol Cancer. 2024;23:178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Tong Y, Chen Z, Wu J, Huang Q, He Y, Shang H, Xia D, Peng E, Wang Z, Liang X, Tang K. METTL3 promotes an immunosuppressive microenvironment in bladder cancer via m6A-dependent CXCL5/CCL5 regulation. J Immunother Cancer. 2025;13. [DOI] [PMC free article] [PubMed]
- 20.Chen Y, Pan C, Wang X, Xu D, Ma Y, Hu J, Chen P, Xiang Z, Rao Q, Han X. Silencing of METTL3 effectively hinders invasion and metastasis of prostate cancer cells. Theranostics. 2021;11:7640–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhang C, Yang T, Chen H, Ding X, Chen H, Liang Z, Zhao Y, Ma S, Liu X. METTL3 Inhibition promotes radiosensitivity in hepatocellular carcinoma through regulation of SLC7A11 expression. Cell Death Dis. 2025;16:9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zhu ZM, Huo FC, Shi C, Li MT, Zhou Y, Zhang LS, Pei DS. METTL3-mediated m6A modification of PAK6 drives cervical cancer progression through activating MAPK14. Int J Biol Macromol. 2025;309:142880. [DOI] [PubMed] [Google Scholar]
- 23.Che F, Ye X, Wang Y, Wang X, Ma S, Tan Y, Mao Y, Luo Z. METTL3 facilitates multiple myeloma tumorigenesis by enhancing YY1 stability and pri-microRNA-27 maturation in m(6)A-dependent manner. Cell Biol Toxicol. 2023;39:2033–50. [DOI] [PubMed] [Google Scholar]
- 24.Huang X, Yang Z, Li Y, Long X. m6A methyltransferase METTL3 facilitates multiple myeloma cell growth through the m6A modification of BZW2. Ann Hematol. 2023;102:1801–10. [DOI] [PubMed] [Google Scholar]
- 25.Liu M, Li H, Zhang H, Zhou H, Jiao T, Feng M, Na F, Sun M, Zhao M, Xue L, Xu L. RBMS1 promotes gastric cancer metastasis through autocrine IL-6/JAK2/STAT3 signaling. Cell Death Dis. 2022;13:287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Zhang J, Zhang G, Zhang W, Bai L, Wang L, Li T, Yan L, Xu Y, Chen D, Gao W, et al. Loss of RBMS1 promotes anti-tumor immunity through enabling PD-L1 checkpoint Blockade in triple-negative breast cancer. Cell Death Differ. 2022;29:2247–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sun Y, Chen D, Sun S, Ren M, Zhou L, Chen C, Zhao J, Wei H, Zhao Q, Qi Y, et al. RBMS1 coordinates with the m(6)A reader YTHDF1 to promote NSCLC metastasis through stimulating S100P translation. Adv Sci (Weinh). 2024;11:e2307122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wei W, Ji X, Guo X, Ji S. Regulatory role of N(6) -methyladenosine (m(6) A) methylation in RNA processing and human diseases. J Cell Biochem. 2017;118:2534–43. [DOI] [PubMed] [Google Scholar]
- 29.Lee Y, Choe J, Park OH, Kim YK. Molecular mechanisms driving mRNA degradation by m(6)A modification. Trends Genet. 2020;36:177–88. [DOI] [PubMed] [Google Scholar]
- 30.Chen CJ, Huang JY, Huang JQ, Deng JY, Shangguan XH, Chen AZ, Chen LT, Wu WH. Metformin attenuates multiple myeloma cell proliferation and encourages apoptosis by suppressing METTL3-mediated m6A methylation of THRAP3, RBM25, and USP4. Cell Cycle. 2023;22:986–1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Xu K, Zhang Q, Chen M, Li B, Wang N, Li C, Gao Z, Zhang D, Yang L, Xu Z, et al. N(6)-methyladenosine modification regulates Imatinib resistance of Gastrointestinal stromal tumor by enhancing the expression of multidrug transporter MRP1. Cancer Lett. 2022;530:85–99. [DOI] [PubMed] [Google Scholar]
- 32.Oh S, Song H, Freeman WM, Shin S, Janknecht R. Cooperation between ETS transcription factor ETV1 and histone demethylase JMJD1A in colorectal cancer. Int J Oncol. 2020;57:1319–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhou J, Tang Z, Gao S, Li C, Feng Y, Zhou X. Tumor-Associated macrophages: recent insights and therapies. Front Oncol. 2020;10:188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Cencini E, Fabbri A, Sicuranza A, Gozzetti A, Bocchia M. The role of tumor-associated macrophages in hematologic malignancies. Cancers (Basel). 2021;13. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data generated or analyzed during the current study are available from the corresponding author on reasonable request.