Skip to main content
NCBI home page
Virologica Sinica logoLink to Virologica Sinica
. 2026 Feb 10;41(1):172–181. doi: 10.1016/j.virs.2026.02.007

Desmoglein 2 (DSG2)-knockout human respiratory epithelial cell model to study species B adenovirus receptor usage

Nora Bahlmann a,1, Montaha Alshawabkeh a,1, Raphael Tsoukas a,2, Katrin Schröer a, Sebastian Schellhorn a, Mareike Sieler b, Thomas Dittmar b, Eric Ehrke-Schulz a, Anja Ehrhardt a,⁎, Wenli Zhang a,⁎
PMCID: PMC13007302  PMID: 41679545

Abstract

With an increasing number of human adenoviruses identified, the selection of potential therapeutic vectors broadens. For safety reasons, achieving cell-specific gene delivery is crucial to minimize off-target effects. Therefore, it is essential to gain a systematic understanding of adenovirus receptor-usage. Our aim is to establish a human-originated in vitro model for comparative analysis of human adenoviruses receptor usage. Based on our previous work of human CD46 and coxsackievirus and adenovirus receptor (CAR) knockout cell lines, we generated desmoglein 2 (DSG2) knockout cell lines using genome-engineering technology based on Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated protein 9 (CRISPR/Cas9). All together, we established a panel of cell lines that carry a single, double, or triple knockout of the three major human adenovirus receptors: CAR, CD46 and DSG2. Notably, cell proliferation speed was affected by the CAR-knockout, but not the DSG2-or CD46-knockouts. In addition, the spheroid formation ability was sharply reduced in CAR- or DSG2-knockout cells, but not the CD46-knockout cells. With this receptor-knockout model, we confirmed the receptor usage of nine species B adenoviruses. Furthermore, adenovirus vectors containing a previously identified DSG2-binding affinity-enhanced mutation showed DSG2-dependent cell entry within this cell model, which indicates that they are de-targeted from CD46 — the ubiquitously expressed receptor on all nucleated cells. Collectively, our findings show that the adenovirus major receptor knockout cell lines can serve as an in vitro model to help select adenovirus types suitable for individual applications and to better understand adenovirus infection biology.

Keywords: Adenovirus, Cell model, CRISPR/Cas9, Desmoglein 2 (DSG2), Receptor knockout

Highlights

  • •

    A panel of stable receptor knockout cell lines was generated using the CRISPR/Cas9 technology.

  • •

    These cell lines carry a single, double, or triple knockout of the three major human adenovirus receptors: CAR, CD46 and DSG2.

  • •

    Receptor knockout alters the cell proliferation speed and spheroid formation ability.

  • •

    This knockout cell model could be applied for rational vector design and basic virology studies.

Introduction

Adenoviruses are being increasingly used as vectors in vaccines, gene therapies and cancer treatments. The recent success of commercial vector ADSTILADRIN, an interferon expressing replication-deficient recombinant human adenovirus type 5 (Ad5) vector (also known as rAd-IFNa/Syn3) (Lee, 2023; Narayan et al., 2024), as well as the broad application of multiple adenovirus-based COVID-19 vaccines (Folegatti et al., 2020; Hardt et al., 2022; Lee, 2023), indicates the potential of adenoviruses as next generation therapeutic reagents. Currently, Ad5 is the only adenovirus-based gene therapy product among the over 40 FDA (The U.S. Food and Drug Administration) and EMA (The European Medicines Agency) approved cellular and gene therapy products (FDA, 2025; EMA, 2025). On the other hand, there are plenty of human adenovirus types identified (116 up-to-date) (Human Adenovirus Working Group, 2024; Kajon, 2024), with the potential to broaden the selection of therapeutic vectors. In the process of biomedicine product design and development, cell specific delivery is crucial to achieve efficacious therapy. Therefore, the cellular entry receptor profile is one of the major criteria for novel vector development.

Among all molecules responsible for adenovirus cell entry, coxsackievirus and adenovirus receptor (CAR) was the first identified. CAR belongs to the immunoglobulin superfamily and forms homodimers in epithelial cell-cell adhesions. It has been shown to bind fibers of adenovirus from species A, and C–G (Roelvink et al., 1998; Lenman et al., 2015; Bergelson et al., 1997). The second most commonly used receptor for adenoviruses is human CD46 (CD46), which is responsible for most of the species B and several species D adenoviruses cellular entry (Gaggar et al., 2003; Liu et al., 2018; Li et al., 2012; Camacho et al., 2014). CD46 belongs to the regulators of the complement activation protein family. It is expressed on all nucleated cells and functions to protect healthy cells from complement-mediated degradation. Meanwhile, CD46 is also known as a “pathogen” magnet, being a port of entry for several bacteria and viruses (Liszewski et al., 2005; Liszewski and Atkinson, 2025). The third major adenovirus receptor is human desmoglein 2 (DSG2), a calcium-binding transmembrane glycoprotein that functions as a cell-cell adhesion maintainer. DSG2 is also identified as a receptor for some species B adenoviruses cell entry (Wang et al., 2011; Zhang et al., 2021). Of the three adenovirus major receptors, CD46 and DSG2 are highly related regarding their function in species B adenoviruses. We previously observed that viruses with gain-of-function, namely, DSG2-binding affinity enhanced Ad3 fiber knob, result in loss of CD46 receptor usage (Bahlmann et al., 2022). Meanwhile, DSG2 is rising as a novel attractive target receptor for hematopoietic stem cell transduction (Wang et al., 2022; Yao et al., 2024).

To study receptor utilization of adenoviruses and to identify new receptors, Chinese Hamster Ovarian (CHO) cells over-expressing these receptors are most frequently used (Santis et al., 1999; Trinh et al., 2012). However, the transferability from the animal model to the human organism is limited, and it sometimes may be misleading with respect to false negatives in receptor identification (Marttila et al., 2005). Therefore, to gain a systematic understanding of adenovirus receptor usage, a proper human cell model is needed. Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated protein 9 (CRISPR/Cas9), the programmable restriction enzyme complex, has been intensively used in genetic engineering for both novel therapy and basic research. Applying the CRISPR/Cas9 technology, several adenovirus receptor knockout cell models have been developed, including single-knockout (CAR or CD46 or DSG2) and double-knockout (CAR-CD46) (Feng et al., 2020; Tsoukas et al., 2022). These models demonstrated strong power in adenovirus receptor studies, as well as translational research (Bahlmann et al., 2022; Sallard et al., 2024).

In the current study, to deepen our understanding of the role of CD46/DSG2 in adenovirus infection, we generated human lung carcinoma A549-based DSG2 knockout, DSG2-CD46 double knockout, and DSG2-CD46-CAR triple knockout cell lines. Cell proliferation speed and spheroid formation ability were evaluated, indicating certain influence from receptor knockout. By screening of our previously established adenovirus library with reporter-gene (GFP) expressing vectors (Zhang et al., 2017) in these receptor knockout cell models, we confirmed the receptor usage of nine species B adenoviruses.

Results

Major adenovirus receptor expression profile in A549 cells

Among the numerous molecules reported as adenovirus cellular entry receptors and adaptor molecules, CAR, CD46 and DSG2 are the three major receptors responsible for adenovirus cell entry (Fig. 1A). Therefore, in the current study, we focus on these three receptors, with the aim of generating a human cell-originated model for the adenovirus cellular entry study. We chose the A549 cell line, originating from a human alveolar basal epithelial adenocarcinoma, which was first described in 1973 (Giard et al., 1973). It is widely used as a lung epithelial cell model and as a host cell line of many respiratory viruses, including adenoviruses. Importantly, all three major receptors of our interest (CAR, CD46 and DSG2) are expressed on the surface of A549 cells at high levels (Fig. 1B–D).

Fig. 1.

Fig. 1

Open in a new tab

Molecules/receptors used for adenovirus cellular entry. A Major molecules/receptors involved in adenovirus cellular entry are schematically displayed here (from left to right): CAR, CD46, DSG2, integrins, sialic acid, HSPG (heparan sulfate proteoglycan). SCRs, short consensus repeat; Ca2+, calcium. Note that the diagram is not drawn to scale. Figures are created with BioRender. B–D The three major surface proteins involved in adenovirus cell entry are fully expressed on A549 cells: CD46 (B), CAR (C) and DSG2 (D).

Generation and characterization of DSG2-knockout A549 cell lines

We applied the CRISPR/Cas9 technology to generate stable DSG2-knockout cell lines based on A549. A previously published guide RNA pair (gRNAs) (Feng et al., 2020) targeting the signal peptide and extracellular domain 1 (EC1) (Fig. 2A) was inserted into the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9-T2A-PuroR (pShP-Cas9), which contains a Cas9 and puromycin resistance gene co-expression cassette. The transfected cells were maintained under puromycin selection for three days to deplete the non-transfected cells. After a week of recovery in culture, the cells were processed for further analysis and isolation (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

Exon structure of the DSG2 gene and the procedure to generate the knockout cell lines. A Arrows indicate the selected target sites for the gRNAs (Feng et al., 2020), the identified Ad3 interaction site (extracellular domain 3), EC3 (Vassal-Stermann et al., 2019b) and the DSG2 antibody (6D8) recognition site between EC3 and EC4 are also shown (Vassal-Stermann et al., 2019a). Note that the illustration is not drawn to scale. B Knockout was achieved by transfection of the plasmid pShP-Cas9 encoding Cas9, gRNA and a puromycin resistance gene. The puromycin selection was maintained from day 1 to day 3 to eliminate non-transfected cells. Cells were measured for DSG2 expression and separated via magnetic cell isolation after 10 days. The figure was generated using components from BioRender.

Knockout cell lines were constructed by introducing biallelic frameshift mutations into the exons of the DSG2 gene. An example of DSG2 detection during the DSG2-knockout cell line generation is shown in Fig. 3B. After two days of puromycin selection, around 1% of DSG2-negative cells were detected. Then the cells were recovered for another seven days until the first magnetic cell isolation, from which over 20% DSG2 negative cells were obtained (Fig. 3A and B). Repeated magnetic cell isolation increased the ratio of DSG2 negative cells to almost 80%. Therefore, after two rounds of magnetic cell isolation, the cells were diluted to single cells and seeded in 96-well plates for single-cell clone isolation (Fig. 3B). Each single-clone-originated cell culture was checked for DSG2-knockout. The chosen DSG2-knockout cell lines were further characterized at the genome level. Fig. 3C gives an example of a DSG2-knockout cell line generated from one single clone. An earlier stop codon and a frameshift were detected, which evidenced the successful DSG2-knockout (Fig. 3C).

Fig. 3.

Fig. 3

Open in a new tab

The identification of knockout cells. A DSG2 knockout cells were sorted by magnetic cell isolation. The figure was generated using components from BioRender. B DSG2 level was quantified at different selection stages. With 1% DSG2-negative cells detected directly after puromycin selection at day 3, 24% and 78% DSG2-negative cells were observed after the first and second magnetic cell isolation, and 100% in single clones. In the blue frame, Alexa Fluor 488-conjugated mouse anti-DSG2 antibody was used for DSG2 staining. The A549-WT without/with antibody staining was used as a negative/positive control. On the y-axis, the cell number (count) and on the x-axis, the fluorescence intensity (FITC) are displayed. C DSG2 knockout is confirmed at the genome level via Sanger sequencing, as indicated by the earlier stop codon formation in exon 1 and frameshift in exon 4.

Based on the wild-type A549 cell line (A549-WT), together with our previous work (Tsoukas et al., 2022), we generated a panel of stable receptor-knockout cell lines using the CRISPR/Cas9 technology (Fig. 4A). These cell lines carry single, double, or triple knockouts of the three major receptors (CAR, CD46, and DSG2). Cell morphology and receptor profile were monitored and confirmed until high passages (21–23 passages). To evaluate the effect of receptor knockout on cell proliferation ability, cell growth speed was measured using a cell viability assay measuring the metabolic activity of intracellular dehydrogenases. As shown, the CD46 and DSG2 knockouts have little influence on cell growth, while the CAR-knockout strongly reduced the cell growth rate. The double- or triple-knockout of all three major receptors also affects the cell proliferation to a great extent. This phenomenon was observed in both seeding concentrations with 1000 and 3000 cells per well (Fig. 4B).

Fig. 4.

Fig. 4

Open in a new tab

Characterization of all receptor knockout cell lines. A Summary of all receptor knockout cell lines and nomenclature from our previous work (Tsoukas et al., 2022) and the current study. In this figure and throughout the whole manuscript, we use CC-KO to represent CD46 (C) and CAR (C) double-knockout (KO) cells; CD-KO to represent CD46 (C) and DSG2 (D) double-knockout cells; CCD-KO to represent CD46 (C), CAR (C) and DSG2 (D) triple-knockout cells. B Cell proliferation measured via CCK8 assay. One day before the first measurement, 96 well plate were seeded with either 3000 (left) or 1000 (right) cells per well (cells/well) of individual cell line, the absorbance at 450 nm was measured 2 h (h) after WST-8/CCK8 tetrazolium adding. Data represents one of three independent experiments. C Cell spheroid formation capacity. Individual cell line was seeded at 1000 cells per well into ultra-low attachment U-bottom 96-well plates. At four-, six- and eight-days post-seeding, spheroid formation was monitored under a microscope. As confirmation, the spheroid/total cells were transferred to a normal flat 96-well plate, and the structure was checked 24 h after transfer. Representative bright-field images are shown for each cell line at the indicated time after seeding and transfer (n = 6). Scale bar, 200 μm.

As a member of the cadherin family, the major role of DSG2 is to better tolerate mechanical stress (Garrod and Chidgey, 2008). Since loss of desmosomal adhesion can disrupt tissue integrity, the loss of adhesion between cancer cells within a solid tumor may result in cancer invasion, dissemination, and metastasis (Chang et al., 2021). Here, we evaluated the influence of receptor knockout on spheroid formation to mimic the in vivo effect. Therefore, three-dimensional (3D) cell culture (spheroid culture) was performed. In our experience, A549-WT cells form tight spheroids four days post-seeding. Here, we observed that all receptor knockouts reduced the spheroid formation ability, but to different extents. At day 4, only the CD46-knockout cells formed a loose 3D-structure, while all other knockout cell lines remained discohesive. At day 6, compared to A549-WT, which had formed dense and solid spheroids with a clear boundary, CD46-knockout cells and CD46-DSG2 double-knockout cells (CD-KO) displayed a cohesive 3D-structure. In DSG2-knockout and CD46-CAR double-knockout (CC–KO) cell lines, cells connected in irregular shapes. In contrast, in CAR-knockout and triple-knockout cell lines, 3D-formation can hardly be seen. We observed a similar trend until day 8, spheroids were only obtained in A549-WT, CD46-knockout and CD46-DSG2 double-knockout (CD-KO) cell lines; while all other receptor knockout cell lines formed only irregular shaped 3D-structures (Fig. 4C).

Application examples of DSG2-knockout cell lines

Our previous study suggested that the single amino acid modification (V239D) on Ad3 fiber knob (also known as Junction opener 4, JO4) might enable the virus to escape CD46-binding (Bahlmann et al., 2022). For instance, the DSG2-negative cell line MIA PaCa-2 can resist the infection of JO4-containing Ad3. Here, we applied these previously generated viruses containing JO4 modification and the individual parental viruses (Table 1) to the DSG2-knockout cell lines, and measured the reporter (GFP) expression one day after infection (Fig. 5). While the JO4-viruses displayed 90% reduced transduction in DSG2-knockout cells compared to A549-WT, the reduction of the parental viruses (Ad3, Ad5/K3 and Ad5/F3) was only at 20%–50% (Fig. 5A and B). In sharp contrast, the transduction of all viruses was tightly restricted in CD46 and DSG2 double knockout cells (A549-CD-KO) (Fig. 5C). Next, we examined the virus dose-dependent transduction of Ad3 and Ad3-JO4 in WT- and DSG2-knockout cell lines. While in A549-WT, the increased virus dose confers the Ad3-JO4 transduction similar to that of Ad3 from 200 viral particles per cell (VPC) on, the transduction increase of Ad3-JO4 in DSG2-knockout cells was much slower than that of Ad3 (Fig. 5D). Only 20% of transduction was achieved with 1000 VPC of Ad3-JO4 in DSG2-knockout cells, compared to 80% with the wild-type Ad3. These data evidenced again the DSG2 and CD46 double-receptor usage of Ad3, but the single amino acid JO4-mutation can de-target the Ad3-JO4 from CD46, implying DSG2-specific targeting in translational approaches.

Table 1.

Adenoviruses used in this study.

Adenoviruses (Ad + type number X) Description
Ad3, Ad7, Ad11, Ad14, Ad16, Ad21, Ad34, Ad35, Ad50 Human adenoviruses containing E3 replacement with a GFP and luciferase expression cassette under the control of the CAG promoter, as AdX-GLN (Zhang et al., 2017)
Ad5/K3, Ad5/F3 First generation Ad5 with E1 deletion; E3 replaced by CMV-GFP; fiber knob replacement with that of Ad3 (Ad5/K3), and fiber replacement with that of Ad3 (Ad5/F3) (Richter et al., 2022)
Ad3-JO4, Ad5/K3-JO4, Ad5/F3-JO4 Ad3-GLN, Ad5/K3 and Ad5/F3 containing the single-point mutation at position 239 of the fiber knob amino acid sequence (V239D, JO4) (Bahlmann et al., 2022; Wang et al., 2013)
Open in a new tab

Fig. 5.

Fig. 5

Open in a new tab

DSG2 dependency of DSG2-binding affinity enhanced vectors. Wild-type A549 and DSG2-knockout cell lines were seeded one day prior to the infection assay. JO4 modified viruses (Ad3-JO4, Ad5/K3-JO4 and Ad5/F4-JO4) and individual parental viruses (Ad3, Ad5/K3 and Ad5/F4) were investigated. GFP-transgene positive cells were counted 24 h post-infection with a flow cytometer. A Transgene expression level of all six viral vectors in the wild-type A549 cell line with 1000 viral particles per cell (VPC). B Percentage of GFP-positive cells in DSG2-knockout A549 compared to A549-WT with 1000 VPC. Data represents one of three independent experiments as means ± SD. Statistical analyses were performed using the nonparametric Mann-Whitney U test (∗∗∗ indicates P < 0.001). C Percentage of GFP-positive cells in CD46−and DSG2-double knockout A549 compared to that of wild-type A549 with 1000 VPC. D Transgene expression levels of Ad3 and Ad3-JO4 in WT- and DSG2-knockout A549 cells with a wide range of infection ratios (n = 3).

Furthermore, to investigate the receptor usage of species B adenoviruses, we screened viruses from our virus library engineered and equipped with a GFP reporter gene (Zhang et al., 2017) in DSG2-knockout cell lines. Transduction efficiencies in the three cell lines: A549-WT (parental), DSG2-KO and CD46-DSG2-KO, were measured for each of the viral vectors by flow cytometer. A significant reduction in GFP-positive cells was observed for all tested species B viruses in CD46-DSG2-KO; while in DSG2-knockout cells only Ad3 and Ad7 showed strong transducing reduction, Ad11 and Ad14 showed around 20% reduction and the remaining viruses (Ad16, Ad21, Ad34, Ad35 and Ad50) showed no reduction (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

Evaluation of the receptor usage of species B adenoviruses in two DSG2-knockout cell lines. Wild-type A549 and DSG2-knockout cell lines were seeded one day prior to the infection assay. GFP-transgene positive cells were counted 24 h post-infection with a flow cytometer. Nine species B viruses were used for infection with 500 viral particles per cell (VPC). The percentage of GFP-positive cells in DSG2-knockout A549 cell lines compared to A549-WT is shown. DSG2-KO, DSG2 single knockout cell line; CD-KO, CD46 (C) and DSG2 (D) double-knockout cell line. Data represents one of three independent experiments as means ± SD.

Discussion

DSG2 is a calcium-binding transmembrane glycoprotein, and primarily functions as a cell adhesion protein embedded within desmosome junctions, enabling cells to better tolerate mechanical stress (Garrod and Chidgey, 2008). In epithelial cells of the respiratory tract, DSG2 functions as a high-affinity receptor for some species B human adenoviruses (Zhang et al., 2021; Wang et al., 2011). Although both human CD46 and DSG2 are the major receptors for species B human adenoviruses (Effantin et al., 2023; Feng et al., 2020), compared to the relatively “tissue-specific” expression of DSG2, CD46 is a ubiquitously expressed membrane cofactor protein that protects host cells from complement damage. Therefore, in the selection and development of viral vectors for therapeutic applications, DSG2 is of higher interest.

To better understand the role of different receptors in virus infection, we previously generated CAR-, CD46-single and double-knockout cell lines (Tsoukas et al., 2022). In the current study, DSG2 — the third important molecule involved in adenovirus infection — is included. In total, we expanded the knockout cell lines to three single-, two double- and one triple-knockout cell lines (Fig. 4A). The three receptors are encoded on different chromosomes (CAR on 21q21.1; CD46 on 1q32.2 and DSG2 on 18q12.1), and therefore it is highly unlikely that the knockout of one receptor may alter the expression of others. Meanwhile, we have regularly quantified the expression of all three receptors in each knockout cell line, and there is no divergence among groups.

While all knockout cell lines maintain a stable receptor profile for over 20 passages, certain cell functions, including proliferation and cell adhesion, are altered. We observed that the CAR-knockout extremely reduced the cell growth speed, but the CD46 and DSG2 knockout showed only a slight influence (Fig. 4B). Moreover, due to the role of CAR and DSG2 as junction proteins, it is no surprise that the knockout of these inhibited the spheroid formation (Fig. 4C).

In cancer research, DSG2 was also reported as a cancer cell function modulator and biomarker for survival outcomes (Myo et al., 2023). Recent research has proposed different mechanisms and roles of DSG2 in cancer progression. Saias and colleagues developed a protocol to quantify the kinetics of aggregation of tumor cell populations. Similarly, they observed that DSG2 coordinates collective cell aggregation (Saias et al., 2015). To study the role of DSG2 in breast cancer, Chang and colleagues observed the dynamic changes of DSG2 expression during breast cancer tumorigenesis and metastasis, suggesting that DSG2 may directly promote colonization and metastatic tumor growth via its role in cell adhesion (Chang et al., 2021). In fact, while DSG2 can promote cancer cell migration, invasion, adhesion and proliferation, the high expression is correlated with worse clinical outcomes of most cancer types, including melanoma, multiple myeloma, basal cell carcinoma, ovarian cancer and hepatocellular carcinoma (Chang et al., 2021; Ebert et al., 2022; Jin et al., 2020; Kamekura et al., 2014; Qin et al., 2020). Therefore, DSG2 can be an important target molecule for cancer therapy. For instance, the in vivo administration of Ad3 fiber knob-containing recombinant junction opening proteins (JO) can increase the efficacy of chemotherapeutic drugs, thereby reducing the drug resistance and inhibiting tumor growth (Beyer et al., 2011; Pitner et al., 2019). As promising candidates for cancer therapy, oncolytic adenoviruses can selectively replicate within tumor cells, thereby effectively killing malignant cells while sparing healthy cells. Our previous data suggested that Ad3 with fiber containing DSG2 affinity increased mutations (JO4) can decrease the CD46 mediated cell targeting while maintaining DSG2 usage (Bahlmann et al., 2022). Here, we confirmed the DSG2 dependence of these JO4-containing vectors, potentially opening a new path for CD46-detargeting vector development for cancer therapy and hematopoietic gene therapy (Fig. 5).

Moreover, the transduction of DSG2-knockout cell lines revealed that Ad3 and Ad7 need both CD46 and DSG2 for efficient cell transduction, while Ad11 and Ad14 are highly dependent on CD46. As to Ad16, -21, -34, -35 and -50, CD46 is absolutely the key player (Fig. 6). This observation is consistent with previous studies (Wang et al., 2011; Trinh et al., 2012). Recently, several new species B adenoviruses have been isolated (Ad55, -66, -68, -76–79, -106 and -114), mostly identified with inter-type recombination of genomes (hexon, penton and fiber) based on existing types (Kajan et al., 2018; Ganzenmueller et al., 2025). For Ad55, both DSG2 and CD46 have been demonstrated to be mediators of infection, but DSG2 plays the major role (Feng et al., 2020; Zhang et al., 2021). It would be of interest to identify the receptors of the other species B adenoviruses using our DSG2-knockout cell lines. Moreover, the largest group of human adenoviruses is identified within species D; for most of them, the cell entry receptors are still unknown. We believe that with the development of receptor knockout cell lines, we are on the way to drawing a clearer landscape of the adenovirus receptor profile.

Conclusions

In this study, we generated a panel of stable receptor-knockout cell lines using the CRISPR/Cas9 technology. These receptor-knockout cell lines displayed stable long-lasting receptor properties. However, the proliferation speed and spheroid formation ability were reduced in most of them, which need to be taken into consideration in certain experimental designs to adjust the cell number or physical structure. According to this cell model, the receptor usage of nine species B adenoviruses could be confirmed. Moreover, we demonstrated the CD46 de-targeting effect of a DSG2-affinity enhanced mutation on the Ad3-knob, suggesting the potential utility for cell-specific targeting with DSG2. Future studies should focus on the receptor profiles of the newly identified species B and -D adenoviruses. This research contributes an in vitro human cell model to better understand adenovirus infection and sheds light on the rational design of novel adenoviral vectors.

Materials and methods

Cells and cell culture

The HEK293 cell line (immortalized human embryonic kidney cells) was obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ). The A549 cell line (adenocarcinomic human alveolar basal epithelial cells) used to generate all the knockout cell lines was supplied by Carsten Rudolph (Ludwig-Maximilians-University Munich, Munich, Germany) and was certified by PCR-single-locus-technology for authentication (Eurofins Genomics Germany GmbH). Single-knockout (CAR or CD46) and double-knockout (CAR-CD46) cell lines were generated in our previous study (Tsoukas et al., 2022). All cell lines were maintained in Dulbecco's Modified Eagle's Medium (DMEM) (P04-035911, PAN Biotech, Germany), supplemented with 10% fetal bovine serum (FBS), (P40-37500, PAN Biotech, Germany) and 100 μg/mL penicillin/streptomycin (Pen/Strep, P06-07100, PAN Biotech, Germany). All cells were maintained in a humidified atmosphere at 37 °C and 5% CO2. Mycoplasma contamination testing was carried out regularly by PCR using the mycoplasma detection Kit Venor®GeM Classic (11–1025, Minerva Biolabs GmbH, Berlin, Germany).

To form spheroids, approximately 1000 cells per well of each cell line were seeded into U-bottom 96-well plates (650979, Greiner Bio-One, Germany). Brightfield images were taken with a Leica DM IL LED Fluor Microscope (Leica Mikrosysteme Vertrieb GmbH, Wetzlar, Germany).

Adenoviruses

All human adenoviruses used in this study have been previously described; detailed information is summarized in Table 1. All viruses were produced in HEK293 cells or A549 cells, purified with a cesium chloride (CsCl, 8627.5, Roth, Germany) gradient-based ultracentrifugation method, followed by a desalting step based on disposable PD-10 desalting columns (17085101, GE Healthcare, Germany). Purified viruses were stored at − 80 °C, and adenovirus particle concentrations were determined by measuring the optical density at 260 nm and expressed as viral particles (vps) per milliliter as described previously (Jager et al., 2009).

Customization of CRISPR/Cas9 plasmid

To generate a plasmid containing both, a Cas9 coding sequence coupled to a puromycin resistance gene via a self-cleaving 2A peptide coding sequence and a guide RNA delivery cassette, commercial plasmids pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230, Addgene, USA) and pSpCas9(BB)-2A-Puro (PX459) v2.0 (#62988, Addgene, USA) were used. Both plasmids were digested with enzymes FseI and NotI-HF according to the manufacturer's instructions. The reaction was stopped with 6 × Gel Loading Dye, and the samples were run on an agarose gel. A voltage of 80 V was applied for 1 h 20 min, and the required fragments were then cut out on a UV table using a scalpel. The DNA fragments were extracted from the gel using the NucleoSpin® Gel and PCR Clean-Up Kit (11992242, Macherey-Nagel, Germany) according to the manufacturer's instructions; the concentrations of the purified samples were determined photometrically and the required mass of the insert was calculated for a molar ratio of insert:vector of 3:1. For the ligation, a reaction mixture was prepared according to the manufacturer's instructions for T4 DNA ligase (EL0011, Thermo Fisher Scientific, USA) and incubated for 1 h at room temperature. Afterwards, 2.5 μL of the preparation was used for transformation into chemically competent cells and after isolation of bacterial clones and purification of different vector clones from overnight cultures, several plasmids were analyzed by restriction digestion and sequencing. The newly generated plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9-T2A-PuroR (short name as pShP-Cas9) contains the Cas9 gene controlled by the same promoter as the puromycin resistance encoding region for selection in eukaryotes. For the DSG2 knockout, we separately inserted two gRNAs with the respective overhangs into the plasmid: DSG2-sgRNA1, GCAGGGCGTACGCGCGTCCC and DSG2-sgRNA2, GGGATTACAGAGCCACCTTT (Feng et al., 2020). Both gRNAs represent binding sites on different exons of the DSG2 gene: sgRNA1 binds to exon 1, sgRNA2 binds to exon 4 (Fig. 2A).

Transfection of A549 cells and selection for CRISPR/Cas9 plasmid containing cells

A549 cells were transfected using jetOPTIMUS® kit (101000006, Polyplus, France) according to the manufacturer's instructions. In detail, cells in a 6 cm dish of 80% confluence were transfected with a mixture of 4.5 μL jetOPTIMUS® reagent and 3000 ng of plasmid-DNA (pShP-Cas9-gRNA1 and pShP-Cas9-gRNA2 with 1:1 ratio) that was previously diluted in 200 μL of jetOPTIMUS® buffer. After 24 h of incubation at 37 °C and 5% CO2, the medium was exchanged with medium containing 2 μg/mL puromycin and 4% FBS, then the cells were maintained under puromycin-selection for the next 48 h. At 72 h post-transfection, an aliquot of cells was used for total DNA isolation and DSG2 expression check; the leftover cells were cultured in growth medium for further procedures.

Isolation of knockout cells

On day 10 post-transfection, cells were sorted by magnetic cell isolation. 2 × 106 cells diluted in 1 mL of Dulbecco's Phosphate Buffered Saline (PBS) (P04-361000, PAN Biotech, Germany) were incubated with 2 μg of Alexa Fluor 488-conjugated mouse anti-human DSG2 antibody (CSTEM28) (53-9159-82, Thermo Fisher, Germany) for 10 min at 7 °C. After washing, cells were resuspended in 1 mL isolation buffer, and Dynabeads™ Pan Mouse IgG (11041, Thermo Fisher Scientific, USA) were added. The sample was incubated for 30 min at 7 °C while being gently tilted and rotated. The tube was placed in a magnet for 2 min. The supernatant with unbound cells was transferred to a cell culture dish for further cultivation. Thereby, negative cells without DSG2-receptor expression were separated from positive cells. Magnetic cell isolation was repeated several times. Cell populations with more than 70% receptor-negative cells (via flow cytometry) were dissociated, expanded, and re-evaluated.

Immunostaining for receptor detection

To detect receptor expression on the cell surfaces, cells were trypsinized, washed with PBS and resuspended in 100 μL PBS/BSA and 1 μL of individual antibody. The PE-conjugated rabbit anti-hCAR antibody (AB_2860231, Sino biological, Germany), the PE-conjugated mouse anti-human CD46 antibody (12-0469-42, Thermo Fisher, USA) and the Alexa Fluor 488-conjugated mouse anti-DSG2 antibody (CSTEM28) (53-9159-82, Thermo Fisher, USA) were used to detect the surface expression of CAR, CD46 and DSG2, respectively. Following an incubation step at 4 °C for 1 h, cells were washed again with PBS/FBS to remove unbound antibodies and resuspended in 100 μL PBS for flow cytometry (Beckman Coulter Life Sciences).

Cell viability assay

To monitor the cell proliferation after receptor knockout, a CCK-8 assay was performed (ab228554, Abcam, UK). The cells seeded in 96 well plates were measured at different time points. The absorbance representing the active cell number was measured 2 h after substrate (WST-8/CCK8 tetrazolium) adding in a plate reader at 450 nm (Infinite F Plex Tecan, Maennedorf, Switzerland).

Analyzing transduction efficiencies via GFP positive cells

To detect the transduction efficiencies in cell lines with different receptor profiles, cells were analyzed with flow cytometry. First, respective cells were seeded in 24 or 48 well plates. After overnight incubation, cells were counted again and infected with certain viral particles per cell (vp/c). At 24 h (h) post-infection, cells were washed once with PBS (P04-361000, PAN Biotech, Germany) and detached with trypsin-EDTA (P10–0231SP, PAN Biotech, Germany). Cells were resuspended in DMEM containing 10% FBS, followed by a centrifugation step (500 g, 3 min, room temperature), and washed in PBS before fixation in 2% paraformaldehyde (PFA) for 10 min. Fluorescence profiles were obtained by analyzing at least 10,000 viable cells on a CytoFlex flow cytometer (Beckman Coulter Life Sciences, Krefeld, Germany). A background signal was obtained by analyzing the negative control consisting of uninfected cells. The percentage of GFP-expressing cells was determined by selecting the region of fluorescence above the background of autofluorescence from uninfected cells.

Statistics

Statistical analyses were conducted with GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA). We used the nonparametric Mann-Whitney U test to identify significant differences between the JO4-containing viruses and their individual parental viruses (Ad3 vs. Ad3-JO4, Ad5/K3 vs. Ad5/K3-JO4, Ad5/F3 vs. Ad5/F3-JO4). ∗ indicates P < 0.05, ∗∗ indicates P < 0.01, and ∗∗∗ indicates P < 0.001.

Data availability

All the data generated during the current study are included in the manuscript.

Ethics statement

This article does not contain any studies with human or animal subjects performed by any of the authors.

Author contributions

Nora Bahlmann: conceptualization, investigation, data curation, formal analysis, writing-review and editing. Montaha Alshawabkeh: investigation, data curation, formal analysis, validation, writing-review and editing. Raphael Tsoukas: resources, methodology. Katrin Schröer: software, writing-review and editing. Sebastian Schellhorn: software. Eric Ehrke-Schulz: resources, methodology. Mareike Sieler: resources, methodology, writing-review and editing. Thomas Dittmar: resources, writing-review and editing. Anja Ehrhardt: funding acquisition, conceptualization, supervision, writing-review and editing. Wenli Zhang: funding acquisition, conceptualization, supervision, formal analysis, resources, validation, writing-original draft, writing-review and editing. All the authors read and approved the final version of the manuscript.

Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgements

We thank Dr. Hongjie Wang and Prof. Andre Lieber (University of Washington) for providing the pfgAd5F/kn3 plasmids. We thank Prof. Florian Kreppel (ZBAF) for his constructive suggestion. This work was supported by the Internal Research Funds from Witten/Herdecke University (IFF2017-17, WZ), and DFG grant (EH 192/5-1, AE).

Contributor Information

Anja Ehrhardt, Email: anja.ehrhardt@uni-wh.de.

Wenli Zhang, Email: wenli.zhang@uni-wh.de.

References

  1. Bahlmann N.A., Tsoukas R.L., Erkens S., Wang H., Jonsson F., Aydin M., Naumova E.A., Lieber A., Ehrhardt A., Zhang W. Properties of adenovirus vectors with increased affinity to DSG2 and the potential benefits of oncolytic approaches and gene therapy. Viruses. 2022;14:1835. doi: 10.3390/v14081835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bergelson J.M., Cunningham J.A., Droguett G., Kurt-Jones E.A., Krithivas A., Hong J.S., Horwitz M.S., Crowell R.L., Finberg R.W. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science. 1997;275:1320–1323. doi: 10.1126/science.275.5304.1320. [DOI] [PubMed] [Google Scholar]
  3. Beyer I., van Rensburg R., Strauss R., Li Z., Wang H., Persson J., Yumul R., Feng Q., Song H., Bartek J., Fender P., Lieber A. Epithelial junction opener JO-1 improves monoclonal antibody therapy of cancer. Cancer Res. 2011;71:7080–7090. doi: 10.1158/0008-5472.CAN-11-2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Camacho Z.T., Turner M.A., Barry M.A., Weaver E.A. CD46-mediated transduction of a species D adenovirus vaccine improves mucosal vaccine efficacy. Hum. Gene Ther. 2014;25:364–374. doi: 10.1089/hum.2013.215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chang P.H., Chen M.C., Tsai Y.P., Tan G.Y.T., Hsu P.H., Jeng Y.M., Tsai Y.F., Yang M.H., Hwang-Verslues W.W. Interplay between desmoglein2 and hypoxia controls metastasis in breast cancer. Proc. Natl. Acad. Sci. U. S. A. 2021;118 doi: 10.1073/pnas.2014408118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Ebert L.M., Vandyke K., Johan M.Z., Denichilo M., Tan L.Y., Myo Min K.K., Weimann B.M., Ebert B.W., Pitson S.M., Zannettino A.C.W., Wallington-Beddoe C.T., Bonder C.S. Desmoglein-2 expression is an independent predictor of poor prognosis patients with multiple myeloma. Mol. Oncol. 2022;16:1221–1240. doi: 10.1002/1878-0261.13055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Effantin G., Hograindleur M.A., Fenel D., Fender P., Vassal-Stermann E. Toward the understanding of DSG2 and CD46 interaction with HAdV-11 fiber, a super-complex analysis. J. Virol. 2023;97 doi: 10.1128/jvi.00910-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. EMA. 2025. Gene Therapy Medicinal Products in EU [Online]. Available: https://www.pei.de/EN/medicinal-products/atmp/gene-therapy-medicinal-products/gene-therapy-node.html [Accessed 25 September 2025].
  9. FDA. 2025. Approved Cellular and Gene Therapy Products [Online]. Available: https://www.fda.gov/vaccines-blood-biologics/cellular-gene-therapy-products/approved-cellular-and-gene-therapy-products [Accessed 25 September 2025].
  10. Feng Y., Yi C., Liu X., Qu L., Su W., Shu T., Zheng X., Ye X., Luo J., Hao M., Sun X., Li L., Liu X., Yang C., Guan S., Chen L., Feng L. Human Desmoglein-2 and human CD46 mediate human adenovirus type 55 infection, but human Desmoglein-2 plays the major roles. J. Virol. 2020;94 doi: 10.1128/JVI.00747-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Folegatti P.M., Ewer K.J., Aley P.K., Angus B., Becker S., Belij-Rammerstorfer S., Bellamy D., Bibi S., Bittaye M., Clutterbuck E.A., Dold C., Faust S.N., Finn A., Flaxman A.L., Hallis B., Heath P., Jenkin D., Lazarus R., Makinson R., Minassian A.M., Pollock K.M., Ramasamy M., Robinson H., Snape M., Tarrant R., Voysey M., Green C., Douglas A.D., Hill A.V.S., Lambe T., Gilbert S.C., Pollard A.J., Oxford C.V.T.G. Safety and immunogenicity of the ChAdOx1 nCoV-19 vaccine against SARS-CoV-2: a preliminary report of a phase 1/2, single-blind, randomised controlled trial. Lancet. 2020;396:467–478. doi: 10.1016/S0140-6736(20)31604-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gaggar A., Shayakhmetov D.M., Lieber A. CD46 is a cellular receptor for group B adenoviruses. Nat. Med. 2003;9:1408–1412. doi: 10.1038/nm952. [DOI] [PubMed] [Google Scholar]
  13. Ganzenmueller T., Wolf M., Wolfram L., Gkioule C., Steinbruck L., Heim A. An epidemic of respiratory and ocular infections caused by the reemergence of a recombinant human adenovirus, the novel type HAdV-B114 (P7H3F3) J. Med. Virol. 2025;97 doi: 10.1002/jmv.70464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Garrod D., Chidgey M. Desmosome structure, composition and function. Biochim. Biophys. Acta. 2008;1778:572–587. doi: 10.1016/j.bbamem.2007.07.014. [DOI] [PubMed] [Google Scholar]
  15. Giard D.J., Aaronson S.A., Todaro G.J., Arnstein P., Kersey J.H., Dosik H., Parks W.P. In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst. 1973;51:1417–1423. doi: 10.1093/jnci/51.5.1417. [DOI] [PubMed] [Google Scholar]
  16. Hardt K., Vandebosch A., Sadoff J., Le Gars M., Truyers C., Lowson D., van Dromme I., Vingerhoets J., Kamphuis T., Scheper G., Ruiz-Guinazu J., Faust S.N., Spinner C.D., Schuitemaker H., van Hoof J., Douoguih M., Struyf F., Group E.S. Efficacy, safety, and immunogenicity of a booster regimen of Ad26.COV2.S vaccine against COVID-19 (ENSEMBLE2): results of a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Infect. Dis. 2022;22:1703–1715. doi: 10.1016/S1473-3099(22)00506-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Human Adenovirus Working Group. 2024. Assigned Human Adenovirus Genotype [Online]. Available: http://hadvwg.gmu.edu/ [Accessed 25 September 2025].
  18. Jager L., Hausl M.A., Rauschhuber C., Wolf N.M., Kay M.A., Ehrhardt A. A rapid protocol for construction and production of high-capacity adenoviral vectors. Nat. Protoc. 2009;4:547–564. doi: 10.1038/nprot.2009.4. [DOI] [PubMed] [Google Scholar]
  19. Jin R., Wang X., Zang R., Liu C., Zheng S., Li H., Sun N., He J. Desmoglein-2 modulates tumor progression and osimertinib drug resistance through the EGFR/Src/PAK1 pathway in lung adenocarcinoma. Cancer Lett. 2020;483:46–58. doi: 10.1016/j.canlet.2020.04.001. [DOI] [PubMed] [Google Scholar]
  20. Kajan G.L., Lipiec A., Bartha D., Allard A., Arnberg N. A multigene typing system for human adenoviruses reveals a new genotype in a collection of Swedish clinical isolates. PLoS One. 2018;13 doi: 10.1371/journal.pone.0209038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kajon A.E. Adenovirus infections: new insights for the clinical laboratory. J. Clin. Microbiol. 2024;62 doi: 10.1128/jcm.00836-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kamekura R., Kolegraff K.N., Nava P., Hilgarth R.S., Feng M., Parkos C.A., Nusrat A. Loss of the desmosomal cadherin desmoglein-2 suppresses colon cancer cell proliferation through EGFR signaling. Oncogene. 2014;33:4531–4536. doi: 10.1038/onc.2013.442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lee A. Nadofaragene firadenovec: first approval. Drugs. 2023;83:353–357. doi: 10.1007/s40265-023-01846-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lenman A., Liaci A.M., Liu Y., Ardahl C., Rajan A., Nilsson E., Bradford W., Kaeshammer L., Jones M.S., Frangsmyr L., Feizi T., Stehle T., Arnberg N. Human adenovirus 52 uses sialic acid-containing glycoproteins and the coxsackie and adenovirus receptor for binding to target cells. PLoS Pathog. 2015;11 doi: 10.1371/journal.ppat.1004657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li H., Rhee E.G., Masek-Hammerman K., Teigler J.E., Abbink P., Barouch D.H. Adenovirus serotype 26 utilizes CD46 as a primary cellular receptor and only transiently activates T lymphocytes following vaccination of rhesus monkeys. J. Virol. 2012;86:10862–10865. doi: 10.1128/JVI.00928-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liszewski M.K., Atkinson J.P. The multiverse of CD46 and oncologic interactions. J. Clin. Investig. 2025;135 doi: 10.1172/JCI188355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liszewski M.K., Kemper C., Price J.D., Atkinson J.P. Emerging roles and new functions of CD46. Springer Semin. Immunopathol. 2005;27:345–358. doi: 10.1007/s00281-005-0002-3. [DOI] [PubMed] [Google Scholar]
  28. Liu J., Boehme P., Zhang W., Fu J., Yumul R., Mese K., Tsoukas R., Solanki M., Kaufmann M., Lu R., Schmidtko A., Stewart A.F., Lieber A., Ehrhardt A. Human adenovirus type 17 from species D transduces endothelial cells and human CD46 is involved in cell entry. Sci. Rep. 2018;8 doi: 10.1038/s41598-018-31713-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Marttila M., Persson D., Gustafsson D., Liszewski M.K., Atkinson J.P., Wadell G., Arnberg N. CD46 is a cellular receptor for all species B adenoviruses except types 3 and 7. J. Virol. 2005;79:14429–14436. doi: 10.1128/JVI.79.22.14429-14436.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Myo MIN, K K., Ffrench C.B., Mcclure B.J., Ortiz M., Dorward E.L., Samuel M.S., Ebert L.M., Mahoney M.G., Bonder C.S. Desmoglein-2 as a cancer modulator: friend or foe? Front. Oncol. 2023;13 doi: 10.3389/fonc.2023.1327478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Narayan V.M., Boorjian S.A., Alemozaffar M., Konety B.R., Shore N.D., Gomella L.G., Kamat A.M., Bivalacqua T.J., Montgomery J.S., Lerner S.P., Busby J.E., Poch M., Crispen P.L., Steinberg G.D., Schuckman A.K., Downs T.M., Mashni J., JR., Lane B.R., Guzzo T.J., Bratslavsky G., Karsh L.I., Woods M.E., Brown G., Canter D., Luchey A., Lotan Y., Inman B.A., Williams M.B., Cookson M.S., Chang S.S., Sankin A.I., O'Donnell M.A., Sawutz D., Philipson R., Parker N.R., Yla-Herttuala S., Rehm D., Jakobsen J.S., Juul K., Dinney C.P.N. Efficacy of intravesical nadofaragene firadenovec for patients with bacillus calmette-guerin-unresponsive nonmuscle-invasive bladder cancer: 5-year Follow-Up from a phase 3 trial. J. Urol. 2024;212:74–86. doi: 10.1097/JU.0000000000004020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pitner R., Kim J., Davis-Bergthold J., Turner C., Vassal-Stermann E., Wang H., Adams J., Carter L., Ahlgren J.A., Fender P., Lieber A., Carter D., Gray S.A. Structure-based design of JOC-x, a conjugatable tumor tight junction opener to enhance cancer therapy. Sci. Rep. 2019;9:6169. doi: 10.1038/s41598-019-42229-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Qin S., Liao Y., Du Q., Wang W., Huang J., Liu P., Shang C., Liu T., Xia M., Yao S. DSG2 expression is correlated with poor prognosis and promotes early-stage cervical cancer. Cancer Cell Int. 2020;20:206. doi: 10.1186/s12935-020-01292-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Richter M., Wang H., Lieber A. Role of fiber shaft length in tumor targeting with Ad5/3 vectors. Genes. 2022;13:2056. doi: 10.3390/genes13112056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Roelvink P.W., Lizonova A., Lee J.G., Li Y., Bergelson J.M., Finberg R.W., Brough D.E., Kovesdi I., Wickham T.J. The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F. J. Virol. 1998;72:7909–7915. doi: 10.1128/jvi.72.10.7909-7915.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Saias L., Gomes A., Cazales M., Ducommun B., Lobjois V. Cell-cell adhesion and cytoskeleton tension oppose each other in regulating tumor cell aggregation. Cancer Res. 2015;75:2426–2433. doi: 10.1158/0008-5472.CAN-14-3534. [DOI] [PubMed] [Google Scholar]
  37. Sallard E., Fischer J., Schroeer K., Dawson L.M., Beaude N., Affes A., Ehrke-Schulz E., Zhang W., Westhaus A., Cabanes-Creus M., Lisowski L., Ruszics Z., Ehrhardt A. ADEVO: proof-of-concept of adenovirus-directed EVOlution by random peptide display on the fiber knob. Mol. Ther. Oncol. 2024;32 doi: 10.1016/j.omton.2024.200867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Santis G., Legrand V., Hong S.S., Davison E., Kirby I., Imler J.L., Finberg R.W., Bergelson J.M., Mehtali M., Boulanger P. Molecular determinants of adenovirus serotype 5 fibre binding to its cellular receptor CAR. J. Gen. Virol. 1999;80(Pt 6):1519–1527. doi: 10.1099/0022-1317-80-6-1519. [DOI] [PubMed] [Google Scholar]
  39. Trinh H.V., Lesage G., Chennamparampil V., Vollenweider B., Burckhardt C.J., Schauer S., Havenga M., Greber U.F., Hemmi S. Avidity binding of human adenovirus serotypes 3 and 7 to the membrane cofactor CD46 triggers infection. J. Virol. 2012;86:1623–1637. doi: 10.1128/JVI.06181-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tsoukas R.L., Volkwein W., Gao J., Schiwon M., Bahlmann N., Dittmar T., Hagedorn C., Ehrke-Schulz E., Zhang W., Baiker A., Ehrhardt A. A human in vitro model to study adenoviral receptors and virus cell interactions. Cells. 2022;11:841. doi: 10.3390/cells11050841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vassal-Stermann E., Effantin G., Zubieta C., Burmeister W., Iseni F., Wang H., Lieber A., Schoehn G., Fender P. CryoEM structure of adenovirus type 3 fibre with desmoglein 2 shows an unusual mode of receptor engagement. Nat. Commun. 2019;10:1181. doi: 10.1038/s41467-019-09220-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Vassal-Stermann E., Hutin S., Fender P., Burmeister W.P. Intermediate-resolution crystal structure of the human adenovirus B serotype 3 fibre knob in complex with the EC2-EC3 fragment of desmoglein 2. Acta Crystal. Struc. Biol. Commun. 2019;75:750–757. doi: 10.1107/S2053230X19015784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang H., Germond A., Li C., Gil S., Kim J., Kiem H.P., Lieber A. In vivo HSC transduction in rhesus macaques with an HDAd5/3+ vector targeting desmoglein 2 and transiently overexpressing cxcr4. Blood Adv. 2022;6:4360–4372. doi: 10.1182/bloodadvances.2022007975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang H., Li Z.Y., Liu Y., Persson J., Beyer I., Moller T., Koyuncu D., Drescher M.R., Strauss R., Zhang X.B., Wahl J.K., 3Rd, Urban N., Drescher C., Hemminki A., Fender P., Lieber A. Desmoglein 2 is a receptor for adenovirus serotypes 3, 7, 11 and 14. Nat. Med. 2011;17:96–104. doi: 10.1038/nm.2270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang H., Yumul R., Cao H., Ran L., Fan X., Richter M., Epstein F., Gralow J., Zubieta C., Fender P., Lieber A. Structural and functional studies on the interaction of adenovirus fiber knobs and desmoglein 2. J. Virol. 2013;87:11346–11362. doi: 10.1128/JVI.01825-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Yao J., Atasheva S., Wagner N., Di Paolo N.C., Stewart P.L., Shayakhmetov D.M. Targeted, safe, and efficient gene delivery to human hematopoietic stem and progenitor cells in vivo using the engineered AVID adenovirus vector platform. Mol. Ther. 2024;32:3743–3745. doi: 10.1016/j.ymthe.2024.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang J., Ma K., Wang X., Jiang Y., Zhao S., Ou J., Lan W., Guan W., Wu X., Zheng H., Yang B., Wan C., Zhao W., Wu J., Zhang Q. Desmoglein 2 (DSG2) is A receptor of human adenovirus type 55 causing adult severe community-acquired pneumonia. Virol. Sin. 2021;36:1400–1410. doi: 10.1007/s12250-021-00414-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhang W., Fu J., Liu J., Wang H., Schiwon M., Janz S., Schaffarczyk L., von der Goltz L., Ehrke-Schulz E., Dorner J., Solanki M., Boehme P., Bergmann T., Lieber A., Lauber C., Dahl A., Petzold A., Zhang Y., Stewart A.F., Ehrhardt A. An engineered virus library as a resource for the spectrum-wide exploration of virus and vector diversity. Cell Rep. 2017;19:1698–1709. doi: 10.1016/j.celrep.2017.05.008. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All the data generated during the current study are included in the manuscript.

Articles from Virologica Sinica are provided here courtesy of Wuhan Institute of Virology, Chinese Academy of Sciences

RESOURCES