The clinical characteristics and prognosis analysis of acute B-cell lymphoblastic leukemia with MEF2D fusions

Abstract

To investigate the clinical characteristics and prognosis of acute B-cell lymphoblastic leukemia (B-ALL) patients with MEF2D fusions. We retrospectively analyzed 15 newly diagnosed MEF2D-positive B-ALL patients admitted to The First Affiliated Hospital of Soochow University between January 2021 and December 2024, confirmed via targeted RNA sequencing (RNA-seq) or reverse transcription multiplex PCR. Immunophenotypic, cytogenetic, and molecular mutation profiles were assessed, along with treatment responses. Among the 228 patients initially diagnosed with high-risk B-ALL, 15 patients (6.58%) were positive for the MEF2D fusions. Of these positive cases, extramedullary infiltration was observed in 5 cases, with co-occurring mutations including KRAS (n = 6) and NRAS (n = 4); 4 patients had complex karyotypes. The MEF2D-positive group exhibited significantly inferior overall survival (OS) (P < 0.001) and event-free survival (EFS) (P < 0.001) compared to the MEF2D-negative cohort. After induction therapy, 13 patients achieved complete remission (CR), while 2 with partial response (PR) attained CR following venetoclax (VEN)-combined reinduction. Thirteen patients received immunotherapy, with 9 bridging to allogeneic hematopoietic stem cell transplantation (allo-HSCT). Moreover, one patient proceeded directly to allo-HSCT post-chemotherapy CR. The OS was significantly higher in the transplantation group compared to the non-transplantation group (P < 0.001), but there was no statistical difference between the two groups according to allo-HSCT as a time-dependent variable (P = 0.36). Case 12 achieved negativity for MEF2D with Chidamide incorporated into the preconditioning regimen. Case 3 experienced early post-transplant relapse but achieved transient remission after Ven-combined treatment. At the last follow-up, 10 patients (66.7%) relapsed and 10 patients (66.7%) died each, with a median OS of 14 (5–34)months. B-ALL with MEF2D fusions frequently demonstrates multilineage involvement, poor response to conventional chemotherapy, and extramedullary infiltration. Incorporating venetoclax and the histone deacetylase inhibitor chidamide into induction, salvage, or preconditioning regimens may probably improve outcomes for MEF2D-positive patients, though certainly required further clinical validation.

Acute B-cell lymphoblastic leukemia (B-ALL) represents a prevalent hematologic malignancy characterized by aberrant proliferation and accumulation of immature lymphocytes in bone marrow and lymphoid tissues. This disease exhibits remarkable biological diversity and considerable heterogeneity in clinical manifestations. In 2016, several groups identified three recurrent fusion gene clusters for the first time: MEF2D fusions, ZNF384 fusions, and DUX4-IGH fusions [1–5]. These fusion gene groups demonstrate distinct transcriptional signatures and immunophenotypic profiles, correlating with differential prognostic risk stratification (high-risk, intermediate-risk, and low-risk, respectively) [1]. Notably, patients harboring MEF2D fusions show the most unfavorable outcomes, with 5-year survival rates of merely 33.3% in pediatric cases and 15.6% in adults [1]. Myocyte enhancer factor 2D (MEF2D), constitutively expressed during B-cell differentiation, plays a critical role in B-lymphocyte development. Inactivation of MEF2D leads to developmental arrest at the pre-B cell stage. MEF2D fusions have been recognized as initiating events in B-ALL pathogenesis [6, 7]. Located at chromosome 1q22, MEF2D encodes a transcription factor. The formation of MEF2D chimeric proteins disrupts normal B-cell differentiation and drives proliferation during B-cell development [8, 9]. Fusion with various partner genes alters MEF2D’s expression pattern, consequently modifying regulatory networks of downstream target genes. Furthermore, MEF2D fusions frequently co-occur with hotspot mutations in NRAS, suggesting potential synergistic effects between these genetic events in leukemogenesis [2].

To date, 9 MEF2D fusion variants (BCL9, SS18, FOXJ2, CSF1R, DAZAP1, STAT6, HNRNPUL1, HNRNPH1, and HNRNPM) have been documented in international studies [2, 10]. Among these, MEF2D::HNRNPUL1 (MH) and MEF2D::BCL9 (MB) are the most prevalent subtypes. Literature reports indicate that B-ALL cases with MEF2D::BCL9 fusion may exhibit morphological similarities to Burkitt lymphoma [8].

This study presents a retrospective analysis of clinical characteristics and prognostic evaluation for 15 B-ALL patients with MEF2D fusions treated at our center.

Patients and methods

1. Clinical Data: We retrospectively analyzed the clinical characteristics of 15 newly diagnosed B-ALL patients with MEF2D fusion genes confirmed by targeted RNA sequencing (RNA-seq) or reverse transcription multiplex PCR (RT-mPCR) at the First Affiliated Hospital of Soochow University between January 2021 and December 2024. All patients underwent comprehensive diagnostic workup, including bone marrow morphology, immunophenotyping, cytogenetics, and molecular profiling (MICM classification), in accordance with clinical guidelines[11] for diagnosis and response assessment.

2. Targeted RNA-seq Analysis、quantitative PCR(qPCR) and flow cytometry: Total RNA was extracted using the TRIzol method. RNA-seq libraries were prepared via probe-based capture of target gene fragments, followed by sequencing on the NextSeq 550 platform to assess full exonic regions of 500 hematologic malignancy-associated genes. Bioinformatics analysis was performed, with all data meeting Q30 quality thresholds and a detection sensitivity of approximately 0.1%. Quantitative PCR(qPCR) is a molecular biology technique that enables real-time monitoring and precise quantification of DNA templates by detecting fluorescent signals during the PCR amplification process. The primers and probes for MEF2D are MEF2D (F): CAGCCAGCACTACAGAGGAACA; MEF2D (P): TGTGTCTCCTGGCCTGCCCCAGCGGCC; HNRNPUL1: AGATGTTGGGGACTTCCTGGA; BCL9: AACCCTTTCCCAGAACCCAC; HNRNPM: TGAATAAAGGCATCGGAATGG༛ARID1B: TGCTTCCAGGCACAACAGG. The normalization is performed as: (target gene / ABL reference gene) %. Flow cytometry is a technology that enables the rapid, multi-parametric analysis of single cells within a fluid. The protocol used for CMF includes taking 200ul of bone marrow or peripheral blood, lyse with ammonium chloride hemolysin (1:10), vortex, and incubate for 15 min. Wash twice with 4 ml PBS (5 min, 1500 rpm). Incubate the cell pellet (50–100ul ) with 10 membrane antibodies (based on LAIP/DFN) for 30 min at room temperature. Wash again with PBS, resuspend in 600ul PBS, and analyze. Minimal Residual Disease(MRD) is assessed by flow cytometry, while MEF2D-MRD is measured by qPCR.

3. Treatment Regimens: Among the 15 patients with MEF2D fusions, 13 received IVP ± CTX±L-Asp induction chemotherapy (idarubicin+vincristine+prednisone± cyclophosphamide ± L-asparaginase), while 2 were treated with Hyper-CVAD A (cyclophosphamide+vincristine+doxorubicin+dexamethasone) (Table 1). Immunotherapy was administered to 13 patients, including 4 who underwent CAR-T therapy (3 targeting CD19/CD22, 1 targeting CD19), 8 receiving blinatumomab, and 1 treated with combined CD19/CD22 CAR-T and blinatumomab. Allogeneic hematopoietic stem cell transplantation (allo-HSCT) was performed in 10 patients, with 7 receiving a modified BUCY (busulfan + cyclophosphamide) conditioning regimen. The remaining 3 patients received alternative regimens: BUCY + chidamide, TBI/CY (total body irradiation/cyclophosphamide), or TTBU (busulfan + thiptepa) .

4. Follow-up: Patients were followed via medical record review, outpatient visits, or telephone interviews until June 30, 2025. Overall survival (OS) was defined as the time from diagnosis to death from any cause or the last follow-up. Event-free survival (EFS) was calculated from diagnosis to hematologic relapse, death, or the last follow-up for censored patients.

5. Statistical Analysis: Statistical analyses were performed using SPSS 25.0. Continuous variables were expressed as median (range) and compared using the Mann-Whitney U test. Categorical variables were presented as percentages (%) and analyzed by chi-square test. Kaplan-Meier estimates were used for OS and EFS analysis, with between-group comparisons assessed by log-rank test. Extended Cox Proportional Hazards Model was also used for OS analysis. A two-sided P < 0.05 was considered statistically significant. Graphs were generated using GraphPad Prism 10.

Table 1.

Exploratory analysis of clinical characteristics of patients in the MEF2D(+) and MEF2D(-) high-risk B-ALL cohorts

Clinical features	MEF2D(+)(n = 15)	MEF2D(-)(n = 213)	P-value
Sex			0.130
male	5(33.3%)	114(53.5%)
emale	10(66.7%)	99(46.5%)
Age[year, median(range)]	37(16–49)	33(6–71)	0.979
WBC			0.558
≤ 30*10E9/L	7(46.7%)	116(54.5%)
> 30*10E9/L	8(53.3%)	97(45.5%)
Baseline marrow blasts by morphology, median(range)	88(71−98.5)%	83(24−98.5)%	0.020
Chromosome
Hyperdiploid	1(6.7%)	6(2.8%)	0.406
KMT2A-r	0(0%)	13(6.1%)	-
Ph and Ph-like	0(0%)	72(33.8%)	-
Hypodiploid	1(6.7%)	7(3.3%)	0.494
Complex	4(26.6%)	34(16.0%)	0.284
B-other	9(60.0%)	81(38.0%)	-
Induction chemotherapy			0.540
IVP ± CTX±L-Asp	13(86.7%)	195(91.5%)
Hyper-CVAD	2(13.3%)	14(6.6%)
Ven-combined	0(0%)	4(1.9%)
1 course of induction chemotherapy			0.808
CR	13(86.7%)	189(88.7%)
non CR	2(13.3%)	24(11.3%)
MRD after induction therapy			0.346
(-)	12(80.0%)	188(88.3%)
(+)	3(20.0%)	25(11.7%)
CR achieved within 3 months			0.045
Yes	8(53.3%)	163(76.5%)
No	7(46.7%)	50(23.5%)
Immunotherapy			0.296
Yes	13(86.7%)	159(74.6%)
No	2(13.3%)	54(25.4%)
Transplantation			0.728
Yes	10(66.7%)	151(70.9%)
No	5(33.3%)	62(29.1%)
Relapse			0.032
Yes	10(66.7%)	82(38.5%)
No	5(33.3%)	131(61.5%)
Stage at last follow-up			0.038
alive	5(33.3%)	129(60.6%)
dead	10(66.7%)	84(39.4%)

Results

• 6.Baseline features ofMEF2DFusion-Positive Patients: The 15 cases with MEF2D fusions[10 females, 5 males; median age 37 (16–49) years] were identified via targeted RNA-seq or RT-mPCR. Extramedullary involvement was observed in 5 patients (CNS: 3; kidney: 1; retroperitoneal lymph node: 1). Fusion subtypes included MEF2D::BCL9 (n = 8), MEF2D::HNRNPUL1 (n = 5), MEF2D::HNRNPM (n = 1), and MEF2D::ARID1B (n = 1) (Table 2). Co-occurring mutations frequently involved KRAS (6/15, 40.0%) and NRAS (4/15, 26.7%). The transplant cohort comprised 7 haploidentical HSCT (Haplo-HSCT) cases, 2 matched unrelated donor (URD-HSCT) transplants, and 1 matched sibling donor (Sibling-HSCT) procedure.
• 7.Comparison of Clinical Characteristics and Outcomes Between MEF2D Fusion-Positive and Negative Patients with high-risk B-ALL: From January 2021 to December 2024, a total of 228 patients were initially diagnosed with high-risk B-ALL (risk-stratified according to the 2024 NCCN guidelines [11] ) at the First Affiliated Hospital of Soochow University. Among them, 15 patients were positive for the MEF2D fusion gene, while the remaining 213 MEF2D-negative patients served as the control group. The two groups showed no significant differences in sex, age, initial WBC count, or cytogenetic profiles (all P > 0.05). While complete remission (CR) rates after first induction were comparable, the MEF2D-positive group had significantly lower CR rates within 3 months (P < 0.05). Notably, relapse and mortality rates were markedly higher in MEF2D-positive patients (P < 0.05). Detailed clinical comparisons are summarized in Table 1. Both overall survival (OS) (P < 0.001) and event-free survival (EFS) (P < 0.001) differed significantly between two groups (Fig. 1a-b).
• 8.Treatment Responses in B-ALL patients with MEF2D Fusions: Among the 15 B-ALL patients with MEF2D fusions included in this study, 13 (86.7%) achieved CR following initial induction therapy. Of these, post-remission therapies included one patient proceeded to consolidation therapy with chemotherapy, one directly underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT), and the remaining 11 received either CAR-T cell therapy or blinatumomab treatment, with 8 subsequently bridging to allo-HSCT. Cases 2 and 13 only achieved partial remission (PR) after initial induction therapy. They subsequently attained CR with venetoclax(VEN)-combined reinduction therapy, followed by consolidation immunotherapy. Case 13 later bridged to allogeneic hematopoietic stem cell transplantation (allo-HSCT)( Fig. 2).In Case 12, Chidamide was added to the preconditioning regimen, and MEF2D turned negative before stem cell infusion, with the patient remaining in sustained remission. Case 3 experienced early post-transplant relapse but achieved transient remission after salvage therapy with Ven-combined treatment.

Table 2.

Baseline features、clinical treatments and outcomes of MEF2D positive B-ALL patients

N	Age	Sex	MEF2D type	Extramedullary infiltration	Induction therapy	Response	Status post-induction	Consolidation therapy	Response	Status post-consolidation	CR achieved within 3 months	Immunotherapy	Status after Immunotherapy	Status before HSCT	HSCT	Outcome, OS(m)	The cause of death
1	42	F	MEF2D::HNRNPUL1	N	IVP	CR	MRD(-), MEF2D(-)	Hyper cvad b	CR	MRD(-), MEF2D(-)	Y	Blinatumomab	MRD(-), MEF2D(-)	MRD(-), MEF2D(-)	Y	Live, 14	/
2	33	F	MEF2D::BCL9	N	IVLP	PR	MRD(+), MEF2D(+)	CAV	CR	MRD(-), MEF2D(+)	N	Blinatumomab	MRD(+), MEF2D(+)	/	N	Die, 7	relapse
3	37	F	MEF2D::ARID1B	Y	VP	CR	MRD(-), MEF2D(-)	HD-Arac	CR	MRD(-), MEF2D(+)	Y	CD19/CD22 CART+Blinatumomab	MRD(-), MEF2D(+)	MRD(-), MEF2D(+)	Y	Die, 24	relapse
4	48	F	MEF2D::BCL9	N	IVP	CR	MRD(+), MEF2D(+)	HD-Arac + L-Asp	NR	MRD(+), MEF2D(+)	N	/	/	/	N	Die, 5	relapse
5	40	M	MEF2D::BCL9	Y	Hyper cvad a	CR	MRD(-), MEF2D(-)	Hyper cvad b	NR	MRD(+), MEF2D(+)	N	Blinatumomab	MRD(+), MEF2D(+)	MRD(+), MEF2D(+)	Y	Die, 16	relapse
6	47	F	MEF2D::HNRNPUL1	N	CIVP	CR	MRD(-), MEF2D(+)	CMOP	NR	MRD(+), MEF2D(+)	N	CD19 CART	MRD(-), MEF2D(+)	MRD(-), MEF2D(+)	Y	Die, 21	CMV viremia
7	34	F	MEF2D::HNRNPUL1	N	CIVP	CR	MRD(-), MEF2D(-)	CAM	CR	MRD(-), MEF2D(-)	Y	Blinatumomab	MRD(-), MEF2D(-)	MRD(-), MEF2D(-)	Y	Live, 8	/
8	37	F	MEF2D::BCL9	N	IVP	CR	MRD(-), MEF2D(-)	CAM	CR	MRD(-), MEF2D(-)	Y	Blinatumomab	MRD(-), MEF2D(-)	/	N	Live, 7	/
9	17	M	MEF2D::BCL9	Y	VDLP	CR	MRD(-), MEF2D(+)	CIVP	NR	MRD(+), MEF2D(+)	N	Blinatumomab	MRD(+), MEF2D(+)	/	N	Die, 8	relapse
10	34	M	MEF2D::HNRNPM	N	CIVLP	CR	MRD(-), MEF2D(+)	CIVP	PR	MRD(+), MEF2D(+)	N	CD19/CD22 CART	MRD(-), MEF2D(+)	MRD(-), MEF2D(+)	Y	Die, 12	septicemia
11	16	F	MEF2D::BCL9	N	VDLP	CR	MRD(-), MEF2D(+)	CAM	CR	MRD(-), MEF2D(+)	Y	CD19/CD22 CART	MRD(-), MEF2D(+)	MRD(-), MEF2D(+)	Y	Die, 26	relapse
12	46	M	MEF2D::HNRNPUL1	N	Hyper cvad a	CR	MRD(-), MEF2D(+)	Hyper cvad b	CR	MRD(-), MEF2D(+)	Y	Blinatumomab	MRD(-), MEF2D(+)	MRD(-), MEF2D(+)	Y	Live, 30	/
13	31	M	MEF2D::BCL9	N	VDP	PR	MRD(+), MEF2D(+)	VA	CR	MRD(-), MEF2D(+)	Y	CD19/CD22 CART	MRD(-), MEF2D(-)	MRD(-), MEF2D(-)	Y	Live, 34	/
14	18	F	MEF2D::HNRNPUL1	Y	IVLP	CR	MRD(-), MEF2D(+)	HD-Arac + L-Asp	NR	MRD(+), MEF2D(+)	N	/	/	MRD(-), MEF2D(+)	Y	Die, 16	relapse
15	49	F	MEF2D::BCL9	Y	IVP	CR	MRD(-), MEF2D(+)	HD-Arac + L-Asp	CR	MRD(-), MEF2D(+)	Y	Blinatumomab	MRD(+), MEF2D(+)	/	N	Die, 7	Relapse+ septicemia

Note: IVP ± CTX ± L-Asp:idarubicin+vincristine+prednisone ± cyclophosphamide ± L-asparaginase; Hyper-cvad a:cyclophosphamide+vincristine+doxorubicin+dexamethasone; Hyper-cvad b:cytarabine+methotrexate; HD-Arac:High-dose cytarabine; CAM:cyclophosphamide+doxorubicin+methotrexate; CMOP:cyclophosphamide+methotrexate+vincristine+prednisone; CAV: cladribine+cytarabine+venetoclax; VA:venetoclax+azacitidine; CR:complete remission; PR:partial remission; NR:No Remission;

Fig. 1.

Comparison of overall survival (OS) (a) and event-free survival (EFS) (b) between MEF2D fusion-positive and negative patients with high-risk B-ALL (P < 0.001, P < 0.001)

Fig. 2.

Treatment flowchart for 15 patients with MEF2D fusions

Case , 7, and 8 achieved MRD and MEF2D-MRD negativity in the early assessments (post-induction and post-consolidation) and subsequently demonstrated favorable prognoses. In contrast, the majority of patients who failed to achieve early MRD negativity had poor outcomes (Table 2). 10 patients underwent transplantation, of whom 9 achieved minimal residual disease (MRD) negativity pre-HSCT—yet 7 retained detectable MEF2D fusions (Table 2). Among these patients, there were 6 cases in the MRD (-) + MEF2D-MRD (+) pre-HSCT group and 3 cases in the MRD (-) + MEF2D-MRD (-) group, with no statistically significant difference in OS between the two groups (P = 0.13, Fig. 3a). Additionally, the overall survival rate of transplanted patients was higher than that of the non-transplanted group (P < 0.001, Fig. 3b), but there was no statistical difference between the two groups according to allo-HSCT as a time-dependent variable (P = 0.36, Fig. 3c). During the initial induction therapy, 13 patients (86.7%) achieved CR, but only 8 patients (53.3%) remained in remission within 3 months. At final follow-up, 10 (66.7%) experienced relapse, and 10 (66.7%) died, with median OS of 14 (5–34) months.

Fig. 3.

(a) Comparison of overall survival (OS) between MRD (-) + MEF2D-MRD (+) group and MRD (-) +MEF2D-MRD (-) group pre-HSCT in B-ALL patients with MEF2D fusions (P = 0.13). (b) Comparison of overall survival (OS) between transplanted and non-transplanted patients with MEF2D fusions (P < 0.001). (c) Comparison of OS between transplanted and non-transplanted patients according to allo-HSCT as a time-dependent variable (P = 0.36)

Discussion

The incidence of MEF2D fusions in B-ALL is relatively low, with a reported overall frequency of only 2.4% in the study by Kentaro Ohki et al. [12]. Patients harboring MEF2D fusions exhibit poor clinical outcomes, with prognosis even inferior to that of KMT2A-rearranged B-ALL, and typically demonstrate resistance to conventional therapeutic regimens [12]. Additionally, these patients are more prone to persistent MRD positivity or early relapse. Among MEF2D fusions, the two most prevalent subtypes are MEF2D::HNRNPUL1 (MH) and MEF2D::BCL9 (MB). Recently, a novel rearrangement, MEF2D::ARID1B, has also been documented in the literature [13]. The research team led by Chen Saijuan demonstrated that the knock-in of MEF2D::HNRNPUL1 (MH) in mice could induce B-cell precursor acute lymphoblastic leukemia (BCP-ALL) within 10–12 months. Furthermore, when co-expressed with NRAS^G12D, MH accelerated the onset of BCP-ALL, resulting in a more aggressive phenotype compared to leukemia induced by NRAS^G12D alone [14]. Irving, J.et al. [15] also discovered that Ras pathway mutations (particularly in KRAS/NRAS) are highly prevalent in relapsed ALL, and such patients are prone to early relapse, chemotherapy resistance, and central nervous system (CNS) infiltration. Ras mutations may synergize with MEF2D rearrangements, collectively contributing to the poor prognosis [15]. Considering the relapses we have also observed most frequently on CNS, we should add particular attention to central nervous system prophylaxis. Meanwhile, our study also found that MEF2D fusions are frequently associated with concurrent KRAS and NRAS mutations. In the present study, Case 3 harbored the MEF2D::ARID1B fusion. This patient experienced early relapse accompanied by extramedullary infiltration and aberrant expression of myeloid markers at relapse. The disease was refractory to both chemotherapy and immunotherapy, leading to a notably short overall survival.

Conventional chemotherapy demonstrates suboptimal long-term efficacy in B-ALL with MEF2D fusions, necessitating the exploration of novel combination therapies. Potential strategies include: (1) targeting dysregulated downstream signaling pathways (e.g., PI3K/HDAC) with specific inhibitors to counteract fusion-driven oncogenic effects [16]; and (2) incorporating immunotherapeutic approaches, such as CAR-T cell therapy, to enhance remission depth and durability in high-risk patients. Given the molecular pathogenesis of B-ALL with MEF2D fusions, therapeutic modulation of downstream effector genes—particularly histone deacetylase 9 (HDAC9)—may represent a promising avenue [14]. HDAC, a direct transcriptional target of MEF2D, is significantly upregulated in cases with MEF2D fusions, suggesting that histone deacetylase inhibitors (HDACi) could serve as a viable therapeutic intervention [17]. Currently, 5 HDAC inhibitors —Vorinostat(8, 2006), Romidepsin(3, 2009), Belinostat(15, 2014), Panobinostat (16, 2015), and Chidamide (29, approved in China in 2015)—have been approved by the FDA for cancer treatment, with approximately 30 others in clinical development [18]. Furthermore, preclinical studies indicate that venetoclax, a BH3-mimetic agent, effectively induces caspase-dependent proteolysis of MEF2D fusion proteins and promotes apoptosis in B-ALL cells with MEF2D fusions [19]. Mechanistically, venetoclax selectively inhibits anti-apoptotic proteins (e.g., BCL-2, BCL-w, and BCL-XL) by competitively binding BCL-2, thereby preventing its sequestration of pro-apoptotic factors such as BIM, BAD, and BAX. This disruption ultimately facilitates caspase activation and apoptotic cell death [20]. In our study, Case 2 and Case 13 achieved PR after initial conventional induction therapy and subsequently attained complete CR following VEN-combined reinduction therapy. Case 3 experienced early post-transplant relapse but achieved transient remission after salvage therapy with VEN-combined treatment. Additionally, Case 12 received the HDAC inhibitor chidamide as part of the preconditioning regimen. Currently, the patient exhibits undetectable MEF2D fusion gene and remains in sustained remission. Further investigation is warranted to evaluate the efficacy of integrating HDAC inhibitors with other targeted or immunotherapeutic approaches.

Anti-CD19 CAR T-cell therapy has demonstrated promising efficacy in pediatric and young adult patients with relapsed/refractory B-ALL, achieving a CR rate of 62%, with long-term follow-up data revealing a 90.3% MRD-negative remission rate among responders [21]. Similarly, blinatumomab, a bispecific T-cell engager (BiTE) targeting CD19 on B-cells and CD3 on T-cells, exhibits unique advantages in B-ALL by redirecting T-cell cytotoxicity against leukemic blasts [22]. However, B-ALL with MEF2D fusions represents a newly recognized high-risk subset characterized by a pro-B immunophenotype, intrinsic chemoresistance, and a heightened propensity for relapse. While CD19-directed CAR T-cell therapy has shown remarkable initial efficacy in relapsed/refractory B-ALL, a substantial proportion of patients experience antigen escape-mediated relapse due to CD19 downregulation or loss, posing a significant therapeutic challenge. Blinatumomab similarly faces limitations in cases with MEF2D fusions, with patients often relapsing shortly after transient responses and exhibiting poor control of extramedullary disease. In our cohort, 13 patients received CAR T-cell therapy or blinatumomab, of whom 9 (69.2%) achieved MRD negativity (Table 2). However, 9 (69.2%) retained detectable MEF2D fusion transcripts, suggesting persistent minimal residual disease(Table 2). Notably, two relapsed patients post-CAR T therapy demonstrated aberrant expression of myeloid markers (CD13/CD33), potentially reflecting lineage plasticity or clonal evolution in leukemia with MEF2D fusions. This phenomenon may underlie the suboptimal response to CD19-targeted immunotherapies in this subset.

Several previous studies have also reported the treatment regimen and clinical outcomes of patients with MEF2D fusions. Ohki, K, et al. [12] found that MEF2D fusion-positive ALL responds well to corticosteroid therapy but has a very poor prognosis (53.3% relapse rate with 100% mortality after relapse), and allogeneic hematopoietic stem cell transplantation was ineffective as a rescue therapy. Sun, J.et al. [23]reported that two cases of ALL with MEF2D fusions exhibiting Burkitt lymphoma/leukemia (BL)-like morphological features achieved short-term remission with the CIVP chemotherapy regimen. Leo, I.R.et al. [24] discovered that MEF2D-HNRNPUL1 is highly sensitive to the DAG analog Bryostatin-1 (a PKC activator) or PMA, and combination therapy with HDAC inhibitors or venetoclax may enhance its efficacy. In addition, B-ALL with MEF2D::BCL9 fusion [3, 8] respond poorly to conventional chemotherapy with a tendency for early relapse and poor prognosis. Accurate identification of this subtype can help in selecting targeted therapies (such as HDAC inhibitors and bortezomib) or intensified chemotherapy regimens, thereby improving patients outcomes.

At the last follow-up, in the MRD (-) + MEF2D-MRD (+) pre-HSCT group, there were 6 patients, with 5 deaths (83.3%); in the MRD (-) + MEF2D-MRD (-) pre-HSCT group, all 3 patients remained alive. However, Fig. 3a suggests that MEF2D clearance status before transplantation did not significantly impact OS (P = 0.13), which may be attributed to the limited sample size and shorter follow-up period. Further clinical validation is warranted.

Given these challenges, the management of B-ALL with MEF2D fusions necessitates a combined-modality approach, where immunotherapy can be effectively integrated with other treatment strategies to achieve synergistic effects. For newly diagnosed high-risk patients, early incorporation of blinatumomab post-chemotherapy-induced remission may deepen responses and facilitate subsequent HSCT. Future efforts should focus on exploring rational combination of “immunotherapy + targeted therapy” (such as CAR-T and/or blinatumomab combined with MEF2D downstream pathway inhibitors) to specifically counteract MEF2D-mediated immune escape and further improve long-term survival in this high-risk subtype.

Author contributions

LSZ analyzed the data and wrote the article; LSZ, ZBQ, QCS, LZ, CCS, WYJ, YZ treated patients and performed data collection; XMZ and XSL designed and rewiewed the paper; WDP designed, funded and supervised the research; All authors read and approved the final version of the article.

Funding

This work was supported by the grants from National Key R&D Program of China (2022YFC2502700),National Natural Science Foundation of China (82020108003、82330008), Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), Jiangsu Provincial Medical Innovation Center (CXZX202201).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethical approval

This study was conducted with the approval of the Research Ethical Review Committee of the First Affiliated Hospital of Soochow University, following institutional guidelines and in accordance with the principles outlined in the Declaration of Helsinki.

Competing Interests

The authors declare no competing interests.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.