Wheat levels have minor effects on the progression of coccidiosis in turkey poults

Abstract

Coccidiosis, a major poultry disease caused by Eimeria species, compromises intestinal health and challenges nutrient utilization. Wheat is widely used in poultry diets worldwide and can serve as an effective alternative energy source. While several studies have highlighted the beneficial effects of wheat in poultry, evidence of its role under the Eimeria challenge remains limited. Therefore, this study was performed to better understand the effect of two dietary wheat levels on Eimeria-challenged turkey poults. A total of 240 one-day-old male turkey poults were divided into four treatments for 22 days. NC, non-challenged negative control receiving a diet with 0% wheat; T1, challenged and fed a diet with 0% wheat; T2, challenged and fed a diet with 15% wheat; T3, a group challenged and fed a diet with 30% wheat. The Eimeria challenge was accomplished on day 16. One-way ANOVA was performed, and the Tukey post hoc test was applied to determine significant differences among treatments. On d 22, the NC group had a higher body weight (682 g), and T1 had the lowest (562 g); Among the challenged groups, T2 showed the highest body weight (P < 0.0001). Ileal digesta viscosity increased linearly with wheat inclusion, whereas duodenum and cecal lesions were reduced with inclusion of wheat, and gut leakage was significantly lower in T2 compared to the other challenged treatments. Histological parameters differed among the treatments at d 22 in almost all parts of the intestine except the ileum, where birds fed wheat-containing diets showed greater ileal villus height than the 0% wheat challenged group. Eimeria infection markedly elevated proinflammatory cytokine expression in the jejunum and altered microbial communities in the ceca. Among the challenged groups, birds fed 30% wheat showed lower cecal lesion scores and differences in cecal microbial composition, including higher relative abundance of Bacteroidota and Bacteroidaceae and lower Bacillota at d 22. In conclusion, moderate wheat inclusion (15%) improved performance before Eimeria challenge. However, because body weight differences were already present before challenge and histology, gene expression, and microbiota were assessed only at d 22, post-challenge differences should be interpreted cautiously and cannot be attributed solely to dietary wheat effects on the response to Eimeria.

Introduction

Coccidiosis is an intestinal disease caused by Eimeria spp. and remains an important health and production challenge in poultry (Cervantes et al., 2020; Mathis et al., 2024). In turkeys, seven Eimeria species have been identified, with E. meleagrimitis, E. adenoeides, and E. gallopavonis considered the major causes of clinical disease in commercial flocks (Chapman, 2008; Durairaj et al., 2023; Rafieian-Naeini et al., 2025b). Infection damages the intestinal tract and can reduce feed intake, impair nutrient absorption, and increase susceptibility to secondary infections (Rafieian-Naeini et al., 2025b).

Control of coccidiosis has traditionally relied on anticoccidial drugs and vaccination. Ionophores remain widely used, but their use is restricted in raised-without-antibiotics and no-antibiotics-ever programs, where vaccines or non-antibiotic chemical anticoccidials are often the only available options (Milbradt et al., 2014; Cervantes and McDougald, 2023). In addition, some ionophores may interact adversely with other drugs or cause toxicity in turkeys (Weisman et al., 1983; Potter et al., 1986; Griffiths et al., 1989; Van Assen, 2006). Although vaccination is a useful alternative, variable protection and practical limitations have encouraged interest in complementary nutritional strategies for managing coccidiosis (Soutter et al., 2020).

Wheat is widely used in poultry diets worldwide and can serve as an effective alternative energy source to corn; however, its non-starch polysaccharide (NSP) content may influence digesta characteristics and gut function, which should be considered during diet formulation. Despite this, wheat remains one of the primary cereals used in broiler feed formulations across Northwest Europe, the Americas, and Australasia (Azhar, 2020). Wheat is widely included in commercial turkey feed formulations as a valuable source of energy, and research has shown that multi-grain feeding results in more consistent and satisfactory growth performance compared to feeding single grains alone (Waldroup et al., 1967). Moderate inclusion of wheat (up to 22.5%) in turkey diets has been shown to enhance gastrointestinal function, increase gizzard weight, lower gizzard pH, and improve feed conversion without affecting final bodyweight (Jankowski et al., 2012).

Interest in wheat feeding during Eimeria challenge has been driven by the idea that enhanced gizzard development and grinding activity might affect oocyst integrity and thereby influence disease progression (Singh et al., 2015). However, the literature has produced conflicting results. Some earlier studies suggested that whole grain feeding may alter the course of coccidiosis, often using oocyst output as the main indicator of infection severity. Yet those beneficial effects were not consistently confirmed in later studies (Waldenstedt et al., 2000; Banfield et al., 2002). In contrast, Gabriel et al. (2003) reported in broilers that whole wheat feeding during challenge with Eimeria acervulina, E. maxima, and E. tenella increased lesion severity, oocyst counts, mortality, and overall clinical expression of coccidiosis compared with ground wheat diets. These authors proposed that greater gizzard development does not necessarily protect the host; rather, the mechanical activity of the gizzard, lower gizzard pH, increased pancreatic secretion, and associated changes in digesta flow may facilitate excystation and increase the severity of infection (Singh et al., 2015). Additional work has shown that whole wheat feeding can increase pancreas weight and modify gastrointestinal secretory processes, which may further affect the excystation process and host response to Eimeria (Svihus et al., 2004). Importantly, however, these outcomes have varied widely across studies, likely due to differences in bird species and strain, age at infection, Eimeria species and dose, wheat inclusion level, physical form of the grain, and the criteria used to assess infection severity (Yvorĕ et al., 1980; Khan and Line, 2010; Singh et al., 2015).

Despite the broad use of wheat in poultry feeding programs, limited information is available on how graded dietary wheat inclusion influences coccidiosis-related outcomes in turkeys. Most previous studies have focused either on wheat effects on gastrointestinal function under non-challenged conditions or on whole wheat feeding in broilers during Eimeria infection, leaving an important gap in turkeys under experimentally controlled challenge conditions. Therefore, We hypothesized that dietary wheat inclusion would modify gastrointestinal conditions, including digesta characteristics and gut function, but would have limited effects on the overall progression of coccidiosis in turkey poults under the conditions of this study. Thus, the objective of the present study was to evaluate the effects of graded dietary wheat inclusion on growth performance, intestinal characteristics, selected immune-related gene expression, and cecal microbiota in turkey poults pre and post challenge with E. meleagrimitis and E. adenoeides.

Materials and methods

The Institutional Animal Care and Use Committee of the University of Georgia approved all the animal experimentation methods utilized in this work (A2024 06-021).

Birds, diets, management, and growth performance

A total of 240 one-day old male turkey poults (Nicholas, Aviagen) were randomly allocated into four treatments with five replicated cages of 12 birds/cage for 22 days of the experimental period. Birds were housed in battery cages (40 × 14 × 16 inches) equipped with nipple drinkers and suitable feeders. The experimental treatments included: an unchallenged negative control receiving a diet with 0% wheat (NC); a group challenged with Eimeria and fed a diet with 0% wheat (T1); challenged with Eimeria and fed a diet with 15% wheat (T2); and a group challenged with Eimeria and fed a diet with 30% wheat (T3). Birds in the challenged groups were inoculated with 8,000 oocysts of E. meleagrimitis and E. adenoeides on d 16. Details of the treatments and challenge schedule are provided in Table 1.

Table 1.

Treatments and Eimeria challenge schedule.

Treatment1	Challenge2	Wheat level3
NC	None	0%
T1	Eimeria	0%
T2	Eimeria	15%
T3	Eimeria	30%

¹NC (control), 0% wheat, NO challenge; T1, 0% wheat, EM challenge (positive control); T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. With five replicates/treatment and 12 birds/replicate.

²Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

³All experimental diets were provided from d 0, and the details of the diet compositions are presented in Table 2.

Temperature and lighting were controlled following the breeder's guidelines (Aviagen Turkey, 2021). The diets were formulated to meet or exceed the nutrient requirements specified in the guide for male turkey poults (Aviagen Turkeys, 2024), as shown in Table 2. On d 12, 16, and 22, the body weight (BW) was recorded, and the daily feed intake (DFI) was measured. Average weight gain (AWG) and feed conversion ratio (FCR) were then calculated for the non-challenged period (d 0–16), the challenged period (d 17–22), and the entire experimental period (d 0–22).

Table 2.

Ingredients and nutrient composition of diets (as-fed basis).

Ingredients		NC and T1	T2	T3
Corn		40.21	23.36	10.66
Soybean Meal −48%		44.66	44.11	42.21
Wheat		0	15	30
Meat & Bone meal		5.84	5	5
Soybean Oil		3.96	5.94	6.39
Dicalcium phosphate		2.10	2.36	2.50
Limestone		1.39	1.39	1.39
DL-Methionine		0.518	0.507	0.492
L-Lysine HCl		0.471	0.482	0.526
Sodium chloride		0.38	0.38	0.38
L-Threonine		0.192	0.199	0.206
L-Arginine		0.062	0.037	0.047
Phytase (5,000 FTU/g)		0.02	0.02	0.02
Sand		0	1.035	0
Mineral Premix1		0.075	0.075	0.075
Vitamin Premix2		0.1	0.1	0.1
Total		100	100	100
Calculated values
M.E.	Kcal/kg	3.020	3.020	3.020
CP	%	28.02	28.03	28.05
E.E.	%	6.61	8.16	8.41
Ca	%	1.64	1.63	1.67
Avail. Phos.	%	0.76	0.79	0.83
Cl	%	0.27	0.27	0.28
Na	%	0.21	0.20	0.20
ARG	%	1.79	1.75	1.76
ILE	%	1.07	1.08	1.08
LYS	%	1.67	1.67	1.67
MET	%	0.85	0.84	0.83
TSAA	%	1.13	1.13	1.13
THR	%	1.05	1.05	1.05
TRP	%	0.25	0.30	0.30
VAL	%	1.16	1.16	1.16

¹Vitamin premix: Supplemented per kg of diet: thiamin mononitrate, 2.4 mg; nicotinic acid, 44 mg; riboflavin, 4.4 mg; d-Ca pantothenate, 12 mg; vitamin B12 (cobalamin), 12.0 g; pyridoxine HCl, 4.7 mg; d-biotin, 0.11 mg; folic acid, 5.5 mg; menadione sodium bisulfite complex, 3.34 mg; choline chloride, 220 mg; cholecalciferol, 27.5 g; transretinyl acetate, 1,892 g; alpha tocopheryl acetate, 11 mg; ethoxyquin, 125 mg.

²Mineral premix: Supplemented as per kg of diet: manganese (MnSO4.H2O), 60 mg; iron (FeSO4.7H2O), 30 mg; zinc (ZnO), 50 mg; copper (CuSO4.5H2O), 5 mg; iodine (ethylene diaminedihydroiodide), 0.15 mg; selenium (NaSeO3), 0.3 mg.

Amino acid values are expressed on a standardized ileal digestible basis.

Preparation of inoculum for eimeria challenge

The Eimeria challenge inoculum was prepared using Immucox®T turkey coccidiosis vaccine (Ceva, Libourne, France), which contains sporulated oocysts of E. meleagrimitis and E. adenoeides. After centrifugation at 3,000 G for 10 minutes, the oocysts were counted with a hemocytometer under a microscope (Carl Zeiss, Promenade, Germany) and diluted with distilled water to achieve the desired concentrations (8,000 oocysts: 4,000 E. meleagrimitis and 4,000 E. adenoeides) (Rafieian-Naeini et al., 2025b).

Ileal digest viscosity and gut permeability

On d 22, three birds per replicate were randomly selected and euthanized by cervical dislocation. The small intestine was removed, and ileal contents were collected from the segment between Meckel’s diverticulum and the ileo-cecal junction. Samples were placed into 15 mL tubes, labeled, and centrifuged at 3,000 x G for 10 minutes. The supernatant was collected, and the viscosity of a 0.5 mL aliquot was measured at 40°C using a Brookfield Digital Viscometer (Model LVDV-II+CP, Brookfield Engineering Laboratories, Middleboro, MA). Viscosity measurements were expressed as treatment means in millipascal-seconds (mPa) (Tejeda and Kim, 2021).

Intestinal permeability was assessed on d 22 by orally gavaging one bird per pen with fluorescein isothiocyanate–dextran (FITC-d; 4.4 mg/kg body weight, MW 4000; Sigma-Aldrich, St. Louis, MO). Two hours post-gavage, birds were euthanized, and blood was immediately collected via cardiac puncture (Goo et al., 2024; Shi et al., 2024a; Rafieian-Naeini et al., 2026). Following the method described by Tompkins et al. (2023), blood samples were centrifuged at 1,000 × g for 15 min using an Eppendorf Centrifuge 5430R (Eppendorf, Hamburg, Germany). Serum FITC-d concentrations were determined from 100 µL of each sample, using a standard curve generated from serial dilutions of FITC-d, which demonstrated a strong linear relationship (R² = 0.9936) (Shi et al., 2024b; Rafieian-Naeini et al., 2025a)

Mineral apposition rate and body composition

On d 16, one bird per pen was tagged and injected intraperitoneally with 20 mg/kg calcein solution, with a second injection administered on d 20. Tibiae were subsequently collected on d 22, immersed in 70% ethanol, and sectioned at 0.5 mm from the mid-diaphysis. Sections were mounted on glass slides and examined under a fluorescent microscope. The distance between calcein double-label bands was measured to evaluate bone growth. The schematic procedure is illustrated in Fig. 1 (Tompkins et al., 2023; Goo et al., 2025).

Fig. 1.

Schematic representation of the calcein labeling procedure for bone formation analysis.

On d 22, One bird per pen was euthanized and scanned using a Dual-Energy X-ray Absorptiometry (DEXA, GE Healthcare, Madison, WI, USA) for bone mineral density (BMD) and bone mineral content (BMC) (Chen et al., 2020).

Eimeria lesion scores and oocyst shedding

On d 22, three birds' duodenum and cecal tissue per replicate were collected, and lesion scores were assessed using a 4-point scale (Gadde et al., 2020; Teng et al., 2023). Litter samples were taken from multiple locations within each pen and thoroughly homogenized. Five grams of litter were mixed with 40 mL of tap water and left at room temperature overnight to soften hardened fecal particles. The mixture was then vortexed and diluted tenfold with a saturated salt solution. Oocysts of Eimeria meleagrimitis and E. adenoeides were quantified using a McMaster Counting Chamber (Chalex, LLC, USA).

Intestinal histology

On d 22, approximately 2 cm sections of the duodenum, jejunum, ileum, and cecum were excised, rinsed with PBS, and fixed in 10% neutral-buffered formalin. Following fixation, the tissues were embedded in paraffin and were sectioned into 7 µm-thick sections (Rafieian-Naeini et al., 2021). Hematoxylin and eosin were used to stain the sections. Each sample's intestinal morphology was observed and photographed under a light microscope with 2X and 4X magnifications (BZ X800, Keyence Inc., Itasca, IL). Using the methods described by Rafieian‐Naeini et al. (2024) and Irani et al. (2023), the villus height (VH), crypt depth (CD), villus height to crypt depth ratio (VH:CD), and ceca muscular thickness (MT) were determined.

mRNA relative abundance

On d 22, jejunal tissues (one bird/replicate) were collected and rapidly frozen in liquid nitrogen. One hundred mg of samples were homogenized using a MiniBeadBeater 16 (BioSpec Products Inc., Bartlesville, OK), and total RNA was extracted with QIAzol Lysis Reagent (Qiagen, Germantown, MD) following the manufacturer’s protocol. RNA concentration was then determined with a NanoDrop Eight spectrophotometer (Thermo Fisher Scientific, MA; Teng et al. (2021)). High-capacity cDNA synthesis kits (Applied BioSystems, Life Technologies, CA) were used to reverse-transcribe the isolated RNA samples after diluting them to a consistent concentration. Real-time PCR was performed in duplicate using a StepOne thermocycler with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA), cDNA templates, and gene-specific forward and reverse primers. The qPCR method, including cycling conditions, was based on Teng et al. (2021). Primers were obtained from Integrated DNA Technologies (IDT, Coralville, IA, USA) and prepared according to the manufacturer’s specifications so that each primer was used at a final concentration of approximately 0.5 µM in the qPCR reaction. The primer sequences used for cytokines and tight junction proteins are listed in Table 3. Target gene expression was normalized to the housekeeping genes, gapdh and actb, and relative mRNA abundance was calculated using the 2^-ΔΔCt method described by Livak and Schmittgen (2001). The NC group was used as the calibrator; therefore, gene expression values are presented as fold change relative to NC, with NC set to 1.

Table 3.

List of primer sequences used for real-time PCR.

Gene 1	Accession no	Sequences	Amplicon (bp)
actb	NM_001303173.1	F: CTGGCACCTAGCACAATGAA	103
		R: GCTGGAAGGTGGACAGAGAG
gapdh	NM_001303179.1	F: GCAGATGCAGGTGCTGAGTA	135
		R: CACAAACATGGGAGCATCAG
il6	XM_003207130.4	F: CGCCTTTCAGACCTATCTGG	137
		R: TGACCACTTCATCGGGATTT
il-1rn	NM_001303218.1	F: GCTCTCCTGGAGGAGGTTTT	132
		R: CACGAAGCACTTCTGGTTGA
il18	XM_003212757.4	F: AGAGCATGGGAAAATGGTTG	114
		R: GCTTTGGAGCTGCAAGATGT
nfκb1	XM_010710046.2	F: GCTGGGTCTTGGCATTCTTA	125
		R: CCATTTGTCTCAAAGCAGCA
tjp1	XM_031555212.1	F: CGATTCGAATTGGCAAGAAT	112
		R: CCTCCTGCTGTCTTTGGAAG
muc2	XM_010711133.3	F: GTACCTCGGTGGCTGCTTAT	147
		R: AAGGTGCTCCACAGGGTTTA
cldn1	XM_003209130.4	F: GGCATGAAATGCATGAAGTG	135
		R: AGCCACTCTGTTGCCATACC

¹gapdh (Glyceraldehyde 3-phosphate dehydrogenase) and actb (β-Actin), Housekeeping genes; il6 and il18, interleukin 6 and 18; il-1rn, interleukin 1 receptor antagonist; nfκb1, nuclear factor kappa B subunit 1; tjp1, tight junction protein 1; muc2, mucin 2; cldn1, claudin 1.

Microbiome analysis

On d 22, cecal contents were collected and immediately frozen in liquid nitrogen, then stored at −80°C for future analysis. DNA was extracted from the cecal contents using QIAamp® DNA stool mini kits (Qiagen GmbH, Hildesheim, Germany) following the manufacturer's instructions. After assessing the quality and quantity with a NanoDrop eight spectrophotometer (Thermo Fisher Scientific), the samples were sent to LC Sciences (Houston, TX, USA) for 16S rRNA gene sequencing (Wang et al., 2021; Rafieian-Naeini et al., 2025a). Raw sequence data were processed through a series of steps, including demultiplexing, adapter trimming, quality filtering, error correction, and chimera removal. Amplicon sequence variants (ASVs) were inferred using the DADA2 pipeline implemented in the QIIME 2 environment. Taxonomic classification was carried out using the SILVA reference database (v138.2). Alpha diversity indices, including Chao1, Shannon, and Faith’s phylogenetic diversity (Faith_PD), were calculated using QIIME 2 and visualized with GraphPad Prism (v10.4.2).

Statistical analysis

Data were analyzed using JMP Pro 18 (SAS Institute Inc.). Normality of the data was assessed with the Shapiro–Wilk test. One-way ANOVA was performed, and Tukey’s post hoc test was applied to determine significant differences among treatment groups. Data were expressed as mean and standard error of the mean (SEM), and P < 0.05 was considered a statistically significant difference. Lesion score distributions were analyzed by excluding the NC group (No-lesions) and comparing the Eimeria-challenged groups using a Chi-square test of independence to examine differences in lesion severity frequencies among treatments. In addition, a one-way ANOVA was performed to assess differences in mean lesion scores across treatment groups. Statistical differences in alpha diversity among groups were assessed using one-way ANOVA. Beta diversity was also evaluated in QIIME 2, and ordination was visualized using principal coordinate analysis (PCoA) in R software (v4.4.3). Taxonomic composition at the phylum and family levels was obtained through QIIME 2, and intergroup differences in relative abundance were analyzed using one-way ANOVA in GraphPad Prism.

Results

Growth performance

As shown in Table 4, body weight differed significantly among the treatments throughout the experiment. At d 12, poults in the T2 and T3 groups had higher BW compared with NC and T1 (P = 0.006). By d 16, the T2 group maintained the highest BW, whereas T1 remained significantly lower than T2 and T3 treatments. At d 22, the NC group reached the highest BW (681.14 g; P < 0.001), while T1 had the lowest (562.50 g). Both T2 and T3 displayed intermediate BW, higher than T1 but lower than NC. Feed intake (FI) was not different among groups during d 0–16 (P > 0.05). However, from d 17–22, NC poults consumed more feed than all challenged groups (P < 0.0001). Over the 22 d period, the NC maintained the highest cumulative FI (788.96 g; P = 0.002), while T1 and T3 had the lowest FI.

Table 4.

Effect of different dietary levels of wheat on body weight, feed intake, body weight gain (BWG), and feed conversion ratio (FCR) on d 12, 16, and 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

Treatments		Body weight (g)			Feed intake (g)			BWG (g)			FCR
		d 12	d 16	d 22	d 0-16	d 17-22	d 0-22	d 0-16	d 17-22	d 0-22	d 0-16	d 17-22	d 0-22
NC		244b	378bc	682a	398	390a	79a	322b	303a	625a	1.24a	1.29b	1.26b
T1		244b	374c	562c	398	322b	720b	319b	188b	506c	1.25a	1.72a	1.42a
T2		263a	408a	615b	414	331b	745ab	352a	206b	558b	1.17b	1.61a	1.33ab
T3		263a	406ab	608bc	399	323b	723b	350ab	202b	551bc	1.15b	1.61a	1.32b
SEM1		4.52	7.46	11.35	6.26	7.49	11.43	7.51	9.31	11.26	0.02	0.04	0.02
P-value		0.006	0.006	<0.0001	0.21	<0.0001	0.002	0.007	<0.0001	<0.0001	0.01	<0.0001	0.001

^a,bMeans in the same column with different superscripts are statistically different (P < 0.05).

¹Values shown are pooled standard errors of the mean.

Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Body weight gain (BWG) differed significantly among treatments (Table 4). In the pre-challenge period (d 0–16), poults fed the T2 diet had significantly higher BWG (352.20 g; P = 0.007) compared to the NC and T1. During the post-challenge period (d17–22), the NC poults maintained the greatest BWG (303.10 g) compared to the other groups (P < 0.0001). Across the 22 d experimental period, the NC achieved the highest cumulative BWG (624.70 g), and the T1 had the lowest (506.50 g), while the T2 showed significantly higher cumulative BWG compared to the T1 (P < 0.0001). Dietary treatments also influenced the feed conversion ratio (FCR). During the pre-challenge period (d 0–16), poults in the T2 and T3 groups had improved FCR compared with the NC and T1 (P = 0.01). In the post-challenge period (d 17–22), the NC had the lowest FCR (1.29; P < 0.0001), while all challenged groups (T1–T3) showed poorer FCR compared to the NC (≥1.61). Over the 22 d period, NC and T3 had significantly better (lower) FCR compared with T1 (P = 0.001), which showed the highest and least efficient FCR (1.42), while T2 exhibited an intermediate value that differed from both NC/T3 and T1.

Digesta viscosity, gut permeability, and bone characteristics

The effects of different wheat levels on ileal digesta viscosity, bone formation rate, bone mineral density (BMD), bone mineral content (BMC), and gut permeability of E. meleagrimitis and E. adenoeides challenged turkey poults are presented in Table 5. Viscosity of the ileal digesta was affected by treatments (P = 0.04). The highest viscosity was observed in T3 (4.05 mPa·s), which was significantly higher than T1 (3.34 mPa·s), whereas NC (3.76 mPa·s) and T2 (3.96 mPa·s) showed intermediate values. Serum FITC-d concentration was significantly affected by treatments. The highest value was observed in T1 (271.81 ng/mL), which was significantly greater than NC (30.96 ng/mL), T2 (97.78 ng/mL), and T3 (142.98 ng/mL). NC birds exhibited the lowest gut permeability.

Table 5.

Effect of different dietary levels of wheat on ileal digesta viscosity, bone formation rate, bone mineral density, bone mineral content, and gut permeability at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

Treatments		Viscosity (mPa·s)	Calcein (um)	BMD (g/cm²)	BMC (g)	Gut permeability (FITC-d, ng/mL)
NC		3.8ab	390.4	0.16	10.5	31.0
T1		3.3b	241.4	0.16	10.0	271.8a
T2		4.0ab	285.8	0.16	10.4	97.8bc
T3		4.1a	303.5	0.16	10.6	143.0b
SEM1		0.17	52.90	0.004	0.56	15.51
P-value		0.04	0.20	0.82	0.85	<0.0001

^a,bMeans in the same column with different superscripts are statistically different (P < 0.05).

¹Values shown are pooled standard errors of the mean.

Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Calcein labeling (Mineral apposition rate: MAR) did not differ significantly among the treatments (P = 0.20). The slides in Fig. 2 illustrate the calcein-labeled bones under a fluorescent microscope in different treatments. Mean values ranged from 241.39 µm in T1 to 390.43 µm in NC, with T2 (285.84 µm) and T3 (303.47 µm) showing intermediate levels. No significant differences were detected in bone mineral density (BMD) (P = 0.82) or bone mineral content (BMC) (P = 0.85) among the treatments. BMD values ranged from 0.156 g/cm² in T3 to 0.162 g/cm² in T1, while BMC values ranged from 9.98 g in T1 to 10.62 g in T3.

Fig. 2.

Effect of different dietary levels of wheat on bone formation rate by Calcein injection on d 16 to 20 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Eimeria lesion scores and oocyst shedding

Duodenal lesion scores did not differ among the treatments (P = 0.40; Fig. 3A). The mean lesion score was highest in T1 (1.73), followed by T2 (1.60), and lowest in T3 (1.46). Cecal lesion scores were significantly affected by treatments (Fig. 3B). Birds in T3 (1.00) had significantly lower cecal lesion score compared to those in T1 (1.74), while T2 (1.33) showed intermediate values. No significant differences were observed among the treatments for E. meleagrimitis oocyst shedding (P = 0.37; Fig. 3C). The highest oocyst shedding was recorded in T1 (3.64 log₁₀ OPG). Similarly, E. adenoeides oocyst shedding was not significantly different across treatments (P = 0.49; Fig. 3D). Mean oocyst shedding was 3.53 log₁₀ OPG in T1, 3.28 log₁₀ OPG in T2, and 3.27 log₁₀ OPG in T3.

Fig. 3.

Effect of different dietary levels of wheat on intestinal lesion score (A-B) and Eimeria oocyst shedding (C-D) at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

^a,b bars with different superscripts are statistically different (P < 0.05). Note: T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Intestinal histology

The effects of different wheat levels on E. meleagrimitis and E. adenoeides challenged turkey poults on intestinal histology parameters are presented in Table 6 and Fig. 4. Duodenal villus height (VH) was significantly affected by treatments. The highest VH was observed in the NC group (2429.58 µm), which was significantly higher than T1 (1650.20 µm), T2 (1551.29 µm), and T3 (1530.39 µm). Crypt depth (CD) also differed among the treatments (P < 0.0001), with T1 (187.99 µm), T2 (172.91 µm), and T3 (167.98 µm), showing increased depths by challenge compared to NC (93.61 µm). Consequently, the VH/CD ratio was higher in NC (26.31) than one in the challenged groups (P < 0.0001).

Table 6.

Effect of different dietary levels of wheat on intestinal histology parameters at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

Treatments	Duodenum			Jejunum			Ileum			Ceca
	VH (µm)	CD (µm)	VH/CD	VH (µm)	CD (µm)	VH/CD	VH (µm)	CD (µm)	VH/CD	MT (µm)
NC	2429.58a	93.61b	26.31a	1219.90a	107.73b	11.53a	887.24b	117.91	7.60b	416.43
T1	1650.20b	187.99a	8.95b	869.12b	138.00a	6.39b	970.76ab	118.58	8.28ab	446.48
T2	1551.29b	172.91a	9.08b	700.68c	134.34a	5.3b	1017.69a	118.32	8.81ab	370.97
T3	1530.39b	167.98a	9.14b	713.22c	149.10a	4.97b	1087.31a	119.39	9.32a	374.18
SEM1	82.67	6.73	0.91	38.19	6.64	0.48	30.71	6.38	0.40	24.14
P-value	<0.0001	<0.0001	<0.0001	<0.0001	0.0008	<0.0001	0.0005	0.99	0.03	0.10

^a,bMeans in the same column with different superscripts are statistically different (P < 0.05).

¹Values shown are pooled standard errors of the mean.

Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

VH: villus height, CD: crypt depth, VH/CD: villus height to crypt depth ratio, and MT: muscular thickness.

Fig. 4.

Effect of different dietary levels of wheat on intestinal histology on d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

^a,b Means in the same column with different superscripts are statistically different (P < 0.05). Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Meanwhile, jejunal villus height (VH) differed among treatments (P < 0.0001), being greatest in NC (1219.90 µm), significantly reduced in T1 (869.12 µm) compared to NC, and further decreased in T2 (700.68 µm) and T3 (713.22 µm), both of which differed from NC and T1. Jejunal crypt depth (CD) increased with challenge (P = 0.0008): NC: 107.73 µm vs. T1: 138.00 µm, T2: 134.34 µm, and T3: 149.10 µm. Consequently, the VH/CD ratio was highest in NC (11.53) and lower in T1–T3 (P < 0.0001). Ileal VH differed among treatments (P = 0.0005), with T3 (1087.31 µm) and T2 (1017.69 µm) exceeding NC (887.24 µm), while T1 was intermediate (970.76 µm). Ileal CD did not differ among treatments (P = 0.99). The ileal VH/CD ratio differed among treatments (P = 0.03), being lowest in NC (7.60), increased in T1 (8.28) and T2 (8.81), and highest in T3 (9.32), with T3 differing from NC. However, ceca muscular thickness (MT) did not differ among treatments (P = 0.10).

mRNA relative abundance

Jejunal mRNA relative abundance was significantly affected by dietary wheat levels in E. meleagrimitis and E. adenoeides challenged turkey poults at d 22 (Table 7). Compared with NC, expression of il18 was increased in T1 and T2, while T3 showed an intermediate value (P = 0.04). Expression of il-1rn was also higher in challenged treatments, with the greatest abundance observed in T1, followed by T2 and T3, compared with NC (P = 0.01). Similarly, il6 expression was elevated in challenged groups, with the highest value observed in T3, whereas NC had the lowest expression (P = 0.03). In contrast, nfkb1 was not affected by treatment (P = 0.61). Expression of muc2 was numerically higher in T1 than in the other treatments, but differences were not significant. Among tight junction-related genes, cldn1 expression was increased in challenged groups, with T3 showing the highest value and NC the lowest (P = 0.01), whereas tjp1 was not influenced by treatment (P = 0.65).

Table 7.

Effect of different dietary levels of wheat on jejunum gene expression at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults.

Treatments	il18	il-1rn	il6	nfκb1	muc2	cldn1	tjp1
NC	1b	1b	1b	1	1	1b	1
T1	2.17a	7.39a	3.64ab	0.71	1.23	2.55ab	1.41
T2	2.22a	5.80ab	2.94ab	0.70	0.73	2.97a	1.39
T3	1.47ab	4.54ab	3.76a	0.34	0.93	2.82a	0.87
SEM1	0.24	0.21	0.63	0.33	0.54	0.38	0.40
P-value	0.04	0.01	0.03	0.61	0.59	0.01	0.65

^a,bMeans in the same column with different superscripts are statistically different (P < 0.05).

¹Values shown are pooled standard errors of the mean.

NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Note: il6 and il18, interleukin 6 and 18; il-1rn, interleukin 1 receptor antagonist; nfκb1, nuclear factor kappa B subunit 1; tjp1, tight junction protein 1; muc2, mucin 2; cldn1, claudin 1.

Microbiome changes

Alpha diversity

Cecal microbiota alpha diversity on d 22 was significantly influenced by treatments (Fig. 5). Chao richness index (Fig. 5A) was significantly higher in the NC group compared with all challenged treatments (P < 0.05). NC birds had the greatest richness, while T1, T2, and T3 showed reduced values clustered around 200–300, with no differences among the challenged groups. Faith’s phylogenetic diversity (Fig. 5B) followed a similar trend, with NC showing significantly higher diversity compared with T1, T2, and T3. Shannon diversity index (Fig. 5C) was also significantly higher in NC (∼5.5–6.0) compared to T1 (∼3.5–4.0), T2 (∼3.5–4.2), and T3 (∼3.2–3.8; P < 0.05). However, the challenged groups did not differ significantly from each other.

Fig. 5.

Effect of different dietary levels of wheat on cecal microbiota alpha diversity at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults. (A) Chao1 richness index, (B) Faith’s phylogenetic diversity, (C) Shannon diversity index.

^a,b Means with different superscripts are statistically different (P < 0.05). Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Beta diversity

Cecal microbiota beta diversity was significantly affected by E. meleagrimitis and E. adenoeides challenge and dietary wheat inclusion on d 22 (Fig. 6). Unweighted UniFrac PCoA (Fig. 6A) revealed clear separation between the NC group and all challenged treatments, with PERMANOVA confirming significant differences (P = 0.001). NC samples clustered distinctly from T1, T2, and T3, while the challenged groups showed overlapping distributions. Weighted UniFrac PCoA (Fig. 6B) also indicated significant differences among treatments (P = 0.029). While some overlap was observed across groups, NC samples formed a separate cluster compared to challenged birds, and variation was evident among T1, T2, and T3.

Fig. 6.

Effect of different dietary levels of wheat on cecal microbiota beta diversity at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults. (A) Unweighted UniFrac principal coordinates analysis (PCoA), (B) Weighted UniFrac PCoA .

Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

phyla level

Cecal microbiota composition at the phylum level was altered by treatments at d 22 (Fig. 7). Relative abundance of the top 10 phyla (Fig. 7A) showed that Bacteroidota and Bacillota were the dominant phyla across all treatments, with Pseudomonadota present at lower levels, alongside minor contributions from Cyanobacteriota, Actinomycetota, Thermodesulfobacteriota, Verrucomicrobiota, Campylobacterota, Patescibacteria, and Acidobacteriota. Bacillota (Fig. 7B) abundance was significantly affected by treatments. NC birds had the highest proportion (∼60–85%), which was reduced in challenged groups. The lowest abundance was observed in T3 (∼15–20%), while T1 and T2 displayed intermediate levels (∼20–40%). Bacteroidota (Fig. 7C) abundance also differed (P < 0.05). NC birds had the lowest levels (∼30–40%), whereas T3 exhibited the highest abundance (∼75–85%). T1 and T2 were intermediate (∼55–70%).

Fig. 7.

Effect of different dietary levels of wheat on cecal microbiota composition at the phylum level at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults. (A) Relative abundance of the top 10 bacterial phyla across treatments, (B) Relative abundance of phylum Bacillota (formerly Firmicutes), (C) Relative abundance of phylum Bacteroidota (formerly Bacteroidetes).

^a,b Means with different superscripts are statistically different (P < 0.05). Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Family level

Cecal microbiota composition at the family level is shown in Fig. 8. Relative abundance of the top 10 bacterial families indicated that Bacteroidaceae was the dominant family across treatments, followed by Lachnospiraceae, Ruminococcaceae, and Enterobacteriaceae, along with several minor families. Bacteroidaceae abundance was significantly different, being lowest in NC (∼20–40%) and increasing in challenged groups, with the highest abundance in T3 (∼65–75%), while T1 and T2 were intermediate (∼50–65%). In contrast, Enterobacteriaceae abundance did not differ significantly among treatments (P > 0.05), remaining relatively low (<20%) across all groups.

Fig. 8.

Effect of different dietary levels of wheat on cecal microbiota composition at the family level at d 22 in E. meleagrimitis and E. adenoeides (EM) challenged turkey poults. (A) Relative abundance of the top 10 bacterial families across treatments, (B) Relative abundance of Bacteroidaceae, (C) Relative abundance of Enterobacteriaceae.

^a,b Means with different superscripts are statistically different (P < 0.05). Note: NC, 0% wheat, NO challenge; T1, 0% wheat, EM challenge; T2, 15%wheat, EM challenge; T3, 30%wheat, EM challenge. Eimeria (EM) challenge was performed on d 16 with 8,000 oocysts (4,000 E. meleagrimitis and 4,000 E. adenoeides).

Discussion

This study assessed growth performance and selected intestinal, immune, and microbial outcomes in turkey poults fed diets containing 15% or 30% wheat and later challenged with two common Eimeria species. Because dietary treatments began before challenge and several endpoint measurements were collected only at d 22, the findings under challenged conditions should be interpreted as treatment-associated differences rather than definitive evidence that wheat specifically altered the response to Eimeria. While wheat is an important energy source, its relatively high non-starch polysaccharide (NSP) content can impair nutrient utilization and gut function when included at elevated levels in poultry diets (Tufarelli et al., 2007). Therefore, diets containing high levels of wheat, particularly above 30%, are often supplemented with NSP-degrading enzymes such as xylanase or β-glucanase to mitigate these adverse effects (Çiftci et al., 2003). Accordingly, the 15% and 30% wheat inclusion levels used in the present study were chosen to reflect moderate and industry-relevant dietary inclusion rates, while avoiding higher levels that could introduce negative nutritional effects in diets without enzyme supplementation. In our experiment, wheat inclusion before challenge was associated with higher body weight and improved FCR, particularly in the 15% wheat group. Because these differences were already evident before inoculation, they likely contributed to the physiological status of poults entering the challenge phase. In addition to its practical use in poultry feeds, wheat has several nutritional characteristics that may support bird performance. Wheat starch can approach complete digestibility when adequately accessed, making it an important dietary energy source (Gutierrez-Alamo et al., 2008). Furthermore, compared with corn, wheat provides a more favorable amino acid balance, supplying relatively greater lysine, methionine, and threonine per unit of crude protein (Szuba-Trznadel et al., 2025). These nutritional attributes likely contribute to the suitability of wheat as a feed ingredient at moderate inclusion levels when diets are appropriately formulated.

The pre-challenge performance responses observed in the present study are consistent with previous turkey research showing that the effect of wheat depends strongly on inclusion level and diet formulation. In our study, poults fed 15% wheat showed improved body weight and feed conversion before challenge, whereas 30% wheat did not provide the same clear advantage, suggesting that moderate inclusion may support performance more effectively than higher inclusion under the present dietary conditions. This pattern agrees with Jankowski et al. (2012), who reported that modest wheat inclusion (8–18%) did not depress final body weight and improved FCR, and supported gastrointestinal function. They also observed improved dry matter, nitrogen, and energy utilization at lower wheat inclusion levels. In contrast, Bennett and Classen (2003) found that higher wheat dilution reduced body weight and breast yield and worsened feed efficiency, with only partial recovery after amino acid supplementation. Together, these findings suggest that the performance response to wheat depends not only on inclusion level, but also on whether wheat is incorporated as a balanced ingredient within an isonitrogenous diet or used in a manner that dilutes protein and essential amino acid density. The broader poultry literature supports this interpretation, as whole-cereal feeding can enhance gizzard development and gastrointestinal motility, potentially improving nutrient utilization, although responses remain dependent on grain form, inclusion level, and nutrient balance (Bennett et al., 2002; Hetland et al., 2002; Svihus et al., 2004; Ravindran et al., 2006; Amerah and Ravindran, 2008; Svihus et al., 2010). In this study, however, these pre-challenge performance differences did not translate into major differences in the progression of coccidiosis after Eimeria challenge.

In the current study, Eimeria-challenged birds fed with no wheat had ileal digesta with the lowest viscosity. However, as dietary wheat levels increased under challenge, viscosity rose in the opposite direction. Wheat contains NSPs that can form gels in the gastrointestinal tract, leading to higher digesta viscosity (Günal et al., 2004). This gel-like environment may add an extra protective mucosal layer in the intestine, which could help explain the reduced cecal lesion scores observed at higher wheat inclusions. However, the source of dietary ingredients and the viscosity induced by wheat or other supplements are important factors. For example, Waldenstedt et al. (2000) reported that increasing digesta viscosity by adding carboxymethyl cellulose to the diet slowed passage rate and reduced total tract digestibility of dry matter and gross energy in broilers under Eimeria challenge.

A broiler study reported that wheat-based diets can increase ileal viscosity by more than three-fold compared to non-wheat diets (Nguyen et al., 2021). It is well documented that Eimeria Spp. Infection in broilers substantially reduces intestinal viscosity, primarily due to epithelial damage and the resulting changes in the gastrointestinal tract’s osmotic balance and absorptive capacity (Crompton, 1976; Waldenstedt et al., 2000). However, in our study, oocyst output (OPG) did not differ across wheat inclusion levels, which is consistent with earlier reports showing that digesta viscosity has little to no effect on parasite replication (Waldenstedt et al., 2000). Eimeria oocyst shedding is governed mainly by the parasite’s intracellular development in the intestinal epithelium and the host immune response, rather than by the physical properties of digesta. Although higher levels of wheat increased ileal viscosity in Eimeria-challenged birds, this change likely influenced nutrient absorption and feed efficiency rather than the parasite's life cycle.

In the present study, MAR, BMD, and BMC differed only numerically among treatments, suggesting that graded wheat inclusion had limited effects on skeletal outcomes during the challenge period, although a general reduction in bone-related measurements was observed in the challenged groups. Bone-related measurements were included as exploratory outcomes because enteric infections may influence skeletal development through reduced nutrient utilization, intestinal barrier disruption, and systemic inflammatory responses (Shi et al., 2024a). Previous studies have shown that Eimeria infection can suppress bone formation and reduce bone mineral density and mineral content in broilers (Tompkins et al., 2023), and recent work in turkeys has also linked enteric challenge to impaired bone health (Rafieian-Naeini et al., 2025b). However, wheat inclusion does not consistently alter bone metrics; Wang et al. (2024b) found no differences in serum Ca and P or in tibia length and circumference across low, medium, and high wheat inclusion diets in broilers.

By d 5–6 post-challenge, Eimeria produced its most tremendous epithelial disruption (Teng et al., 2020), which explains the marked rise in FITC-dextran observed in the infected birds (6dpi). Notably, wheat inclusion blunted this leak, reaching significance at 15% wheat, despite no differences in OPG across wheat levels, indicating the effect reflects host digesta interactions rather than parasite load (Waldenstedt et al., 2000). Histology mirrored this pattern, while infection deteriorated duodenal and jejunal structure, wheat improved ileal histological parameters in 15% wheat and partially offset challenge-related damage. We propose two complementary mechanisms: (1) soluble NSPs in wheat increase luminal viscosity and create a gel-like phase that slows mass transport and limits paracellular flux of macromolecules such as FITC-D; and (2) better ileal mucosal integrity (villus/crypt metrics, mucus layer) strengthens the barrier and potential (Van Der Klis and de, 2013).

During Eimeria infections, the induction of a strong cell-mediated immunity response is a first step toward developing protective immunity against coccidiosis (Soutter et al., 2020). In our study, expressions of il18, il1rn, and il6 were significantly upregulated in Eimeria-challenged birds. Concurrent elevation of il6 and il18 indicates inflammasome-linked cytokine release under challenge. The rise in il1rn likely represents a compensatory anti-inflammatory feedback to limit tissue injury (Wang et al., 2007). Eimeria challenge studies often show altered tight-junction expression, frequently a compensatory upregulation consistent with acute inflammation and remodeling of junctional structure (Teng et al., 2020). This indicates that the upregulation cldn1 in our study was strongly driven by the Eimeria challenge (Rafieian-Naeini et al., 2025b). Moreover, the rise in il-18 aligns with previous findings showing increased expression in broilers co-challenged with Eimeria and Clostridium perfringens (Kitessa et al., 2014). However, within the constraints of the present design, wheat inclusion did not appear to markedly alter these immune and barrier-related outcomes at d 22, suggesting that the dominant signal in these measures was associated with the Eimeria challenge. Wang et al. (2024a) reported that varying wheat levels in broiler diets did not alter the expression of tight junction proteins such as claudin-1 and occludin, and our findings similarly suggest that wheat inclusion does not modify their expression under Eimeria infection.

The cecal microbiota is closely influenced by diet composition (Hamaker and Tuncil, 2014) and strongly linked to the bird’s immunonutritional status, particularly through fermentable fiber, which supports energy supply and short-chain fatty acid (SCFA) production (Ma et al., 2022). On the contrary, Eimeria infection has been shown to disrupt the cecal microbiota, reducing beneficial bacterial populations and creating conditions that favor pathogen overgrowth (Martynova-Van Kley et al., 2012; Choi and Kim, 2022; Choppa et al., 2025). Alpha diversity indices (Chao, Faith, Shannon) consistently declined under Eimeria challenge, regardless of wheat inclusion level. Wang et al. (2024a) reported that higher wheat substitution reduced cecal alpha diversity in non-challenged birds. Taken together, these results suggest that cecal microbiota structure at d 22 was more strongly associated with challenge status than with wheat level. However, because microbiota were assessed only at the end of the study and pre-challenge physiological differences were already present among groups, the present design does not allow clear separation of dietary wheat effects from challenge-related effects on microbial richness.

However, in the current study, there was a linear decrease in Bacillota (formerly Firmicutes) at the phylum level, accompanied by an increase in Bacteroidota (formerly Bacteroidetes) with increasing levels of dietary wheat. Under non-challenged conditions, dietary fiber is positively correlated with the abundance of Bacteroidetes and an increased Bacteroidetes/Firmicutes ratio (Chuang et al., 2021), which was also observed in our study. Bacteroidota and Bacillota differed among treatments at d 22, and these differences were more pronounced in the higher wheat groups. However, given the study design, it is not possible to determine whether these shifts reflect direct effects of dietary wheat, Eimeria challenge, or their combination. This shift was not limited to phylum-level taxa. At the family level, one of the dominant fiber-degrading microbial groups, Bacteroidaceae (Kaoutari et al., 2013), increased linearly with wheat inclusion. It has been demonstrated that fiber-degrading microbes such as Bacteroidaceae enhance the fermentation of complex polysaccharides, resulting in the production of short-chain fatty acids (SCFAs) that improve energy harvest and support intestinal health (Gamage et al., 2017). A limitation of the present study is that dietary treatments began at d 0, whereas the Eimeria challenge was administered at d 16, by which time differences in body weight had already emerged among groups. In addition, histology, jejunal gene expression, and cecal microbiota were assessed only at d 22. Therefore, the current design does not allow clear separation of pre-challenge dietary effects from post-challenge responses, nor definitive attribution of these endpoints to dietary wheat, Eimeria infection, or their interaction.

Conclusions

In conclusion, dietary wheat inclusion influenced turkey poult performance before Eimeria challenge, particularly at the 15% inclusion level, which supported improved growth performance during the pre-challenge period. However, under the current experimental design, the d 22 lesion, histomorphology, gene expression, and microbiota outcomes should be interpreted with caution because pre-challenge growth differences were already present and post-challenge tissues were collected only at the end of the experiment. Although some treatment-associated differences were observed in intestinal morphology, gut permeability, and cecal microbial composition, graded wheat inclusion showed only limited effects on the overall progression of coccidiosis under challenged conditions. Overall, most measured responses appeared to be more strongly associated with the Eimeria challenge itself than with dietary wheat level, indicating that moderate wheat inclusion had a clearer influence on early performance than on post-challenge host responses in turkey poults.

CRediT authorship contribution statement

Hamid Reza Rafieian-Naeini: Writing – original draft, Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Sai kumar reddy Ragyari: Writing – review & editing, Methodology, Investigation. Ahmed Kewan: Writing – review & editing, Methodology, Investigation. Daniel Junpyo Lee: Writing – review & editing, Methodology, Investigation. Hector M. Cervantes: Writing – review & editing, Methodology, Investigation, Conceptualization. Younghoon Kim: Writing – review & editing, Methodology, Investigation. Woo Kyun Kim: Writing – review & editing, Supervision, Resources, Project administration, Investigation, Funding acquisition, Data curation, Conceptualization.

Disclosures

There is no conflict of interest.