Abstract
Background
Acute myeloid leukemia with a normal karyotype (NK-AML) has been assigned to an intermediate prognostic risk group. However, there is a marked variability in outcome within this group of AML, suggesting a significant biological and molecular heterogeneity. Chromosomal abnormalities may be cryptic by metaphase cytogenetics, but still have an impact on the process of leukemogenesis and/or the clinical outcome of NK-AML. Therefore, we analyzed the genomic complement of NK-AML cases to search for the presence of submicroscopic genomic imbalances.
Methods
We applied high-resolution oligo-based aCGH analysis to a cohort of AML patients with a normal karyotype, and FISH to validate the aCGH findings. Relative gene expression levels were examined by qPCR.
Results
High-resolution aCGH analysis of 21 NK-AML patients revealed one patient with a rare submicroscopic deletion at 7q31.1. This female patient exhibited a rapid disease progression and a dismal outcome. The deletion was mono-allelic, approximately 189,1 kb in size, and encompassed the major 3′ part of the DOCK4 gene. The expression level of the DOCK4 gene in her leukemic cells was decreased when compared to CD34+ cells from healthy controls. When compared to AML patients with −7/del(7q) as the sole chromosomal anomaly, the DOCK4 expression level was found to be similarly low.
Conclusions
This is the first report of an acquired partial deletion of the DOCK4 gene in a patient with de novo NK-AML. DOCK4 is a strong tumor suppressor candidate, required for GTPase activation in signal transduction pathways controlling cellular proliferation, adhesion, migration and phagocytosis. Our findings may be relevant for understanding of the process of leukemogenesis and the response to therapy in a subset of NK-AML patients.
Electronic supplementary material
The online version of this article (doi:10.1007/s13402-013-0145-5) contains supplementary material, which is available to authorized users.
Keywords: NK-AML, Cryptic 7q deletion, High-resolution aCGH analysis, DOCK4 gene expression, Tumor suppressor gene, Signaling pathways
Introduction
Acute myeloid leukemia (AML) is the most common type of leukemia in adults. It is a genetically heterogeneous disease with a variable clinical presentation, cellular morphology, immunophenotype, therapeutic response and overall prognosis [1]. The diagnostic karyotype of a patient’s leukemic blasts is the most significant predictor of remission and survival rates [2, 3].
AML with a normal karyotype (NK-AML) is the single largest cytogenetic entity and has been assigned to the intermediate risk group. The variation in clinical outcome of patients in this group is larger than that in the other cytogenetic risk groups [4, 5]. Gene mutation analyses and gene expression profiling assays have begun to reveal new markers indicating which patients with a normal karyotype have better or worse prognosis [6, 7].
The large clinical variation in the NK-AML group may also be ascribed to imprecise cytogenetic assessments. Karyotyping is a relatively low-resolution whole genome test, which may be hampered by a poor quality of the metaphase chromosomes and an impaired banding resolution, especially in cancer genomes, usually yielding a resolution of ~5–15 Mb. Therefore, structural chromosomal changes of less than 5 Mb in size remain cryptic. Cryptic 7q deletions have, however, been detected using locus-specific FISH probes corresponding to 7q in 5–10 % of the patients with myeloid malignancies [8, 9]. This notion is important since such cryptic 7q deletions have a negative impact on the patient’s prognosis and require a more aggressive treatment, similar to that for patients with −7/del(7q) as detected by conventional karyotyping.
High-resolution array-based technologies have the advantage of detecting DNA copy number alterations in a high throughput mode. Accordingly, a number of studies have shown that cryptic chromosome abnormalities can be detected in myeloid malignancies, thus providing a more precise description of the genomic changes, also in cases with a normal karyotype [10–14].
In an initial effort to determine the frequency of cryptic imbalances in AML patients with a normal karyotype diagnosed at our institute, we retrospectively examined a cohort of 21 NK-AMLs using a high-resolution oligo-based 180 K Cancer Cytochip for aCGH analysis. In one of these AMLs we detected a cryptic deletion of ~189,1 kb in size affecting the DOCK4 gene at band 7q31.1. Here, we characterize and discuss the cellular impact of this deletion.
Materials and methods
Patient cohort
In a retrospective study aimed at identifying submicroscopic imbalances in de novo AML patients with a normal karyotype, we included 21 AML cases referred to our cytogenetic institute for conventional chromosome analysis in the period 01-07-2002 to 30-06-2012. The cases were randomly selected from our biobank. The experimental protocol was approved by the Central Denmark Region Committee on Biomedical Research Ethics. The clinical details of the included patients are listed in Supplementary Table 1.
Chromosome and FISH analyses
Chromosome analyses were performed on all 21 cases as part of routine diagnostic work-up for acute myeloid leukemia on G-banded chromosomes, prepared after un-stimulated short-term culturing of bone marrow cells at diagnosis [15]. Twenty-four-color karyotyping was performed on metaphase spreads using a 24XCyte human multicolor FISH (mFISH) probe kit according to the manufacturer’s instructions (MetaSystems, Altlussheim, Germany). Fluorescence in situ hybridization (FISH) analyses were performed according to manufacturer’s instructions on un-stimulated cultured bone marrow cells at diagnosis using the following directly labeled probes: RP11-260P7 (FITC-labeled from EmpireGenomics, Buffalo, N.Y., USA) and a centromere 7 probe (CEP 7) (Spectrum Orange labeled, Abbott Molecular, Germany). Chromosomes and nuclei were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) in all analyses.
High-resolution oligo-based aCGH analysis
Genomic DNA was purified from stored bone marrow cells frozen in DMSO at the time of diagnosis of all 21 AML cases included. High-resolution oligo-based array CGH (aCGH) analysis using a human Cancer CytoChip 180 K (BlueGnome, Cambridge, UK) and its visualization were performed as described before [15]. Regions of gain or loss within copy number variable regions (CNVs) were discarded. As reference genome the NCBI build 36.1 (hg18) was used. The limited availability of material precluded further analyses.
DOCK4 expression analysis by qPCR
Mononuclear cells isolated by Lymphoprep (Axis Shields PoC, Oslo, Norway) density centrifugation and subsequent cryopreservation in 10 % fetal bovine serum supplemented with 10 % DMSO or stored in mRNA lysis buffer (Roche Diagnostics, Basel, Switzerland) were used for RNA purification. RNA was isolated using a miRNeasy Mini Kit from Qiagen (Qiagen Nordic, Solna, Sweden) according to the manufacturer’s protocol and eluted in H2O. cDNA was synthesized using a SuperScript VILO cDNA synthesis Kit from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s protocol. The expression of DOCK4 was investigated using a Mx3000P RQ-PCR System (Stratagene, La Jolla, CA, USA) with TaqMan Universal Master Mix from Applied Biosystems (Carlsbad, CA, USA) according to the manufacturer’s protocol. Primer (500 nM final) and probe (250 nM final) sequences were as follows: forward: 5′ GGCGGAGTGGCAACTTTA 3′, reverse: 5′ CTCGCGGTATGTTTCGTCAC 3′ and probe: 5′ FAM-ACAGGTGGAAGCCAAGCTAATTGACA-BHQ1 3′. The output data were analyzed by the ∆Ct relative quantification model using B2M and ABL1 as reference genes and the relative expression was calculated as described Grubach et al. [16].
Case report
A 53-year-old woman, previously well, was admitted to our hematological department because of upper respiratory tract infections, increasing fatigue and dyspnea for 2–3 months. Two to three weeks before admission she also experienced sweating at night, loss of appetite and gingival hyperplasia with no bleeding. She had no previous history of hematological malignancies and no previous treatment with chemotherapy or radiation therapy. Seven years prior to this admission she had on one cheek a <0,5 cm in diameter basal cell carcinoma, which was surgically removed, without signs of spreading. Upon admission, physical examination showed no signs of hepato- or splenomegaly, no lymphadenopathy, and resting pulse of 125 min−1. Blood examination showed a hemoglobin level of 5,1 mmol/L, a white blood cell count of 205 × 109/L with >90 % blasts, and a platelet count of 141 × 109/L. A bone marrow aspirate showed hyper-cellularity with immature blasts positive for CD43 and CD117, but negative for CD3, CD10, CD20, CD23 and TdT. Immunophenotyping by flow cytometry showed HLA-DR+, CD13+ and CD33+. A diagnosis of de novo AML-M1 was made and she was enrolled in the AML-17 protocol (Trial Ref. ISRCTN55675535). According to the MRC prognostic classification she was assigned an intermediate risk prognosis, because initial cytogenetic analysis showed a normal female karyotype, 46,XX [17]. She was randomized to a standard treatment-arm: induction series 1 DA 3 + 10 (60 mg/m2 daunorubicin and 100 mg/m2 cytarabin) and induction series 2 DA 3 + 8 (50 mg/m2 daunorubicin and 100 mg/m2 cytarabin). According to the protocol she was also tested for the following gene mutations: FLT3-ITD, FLT3-D835, IDH1 R132, CEBPA, NPM1-ex12, and WT1-ex7. A FLT3-ITD mutation was found with an allelic burden of 35 % and, accordingly, she was assigned to high-risk AML. She was further randomized to CEP-701 (lestaurinib) treatment according to the protocol, except in reduced dosage due to treatment with antifungal drugs. After the first series of chemotherapy, on day 28 a bone marrow aspirate showed morphological remission. A hematopoietic stem cell transplantation (HSCT) was planned in the first complete remission (CR1) with a sibling as donor. While being in hematological and morphological remission, she developed bilateral pulmonary invasive aspergillosis, which was difficult to treat with relevant antifungal drugs. Four months later she experienced an AML relapse, and according to flow cytometry she had 60 % leukemic blasts in her bone marrow aspirate. Subsequently, she was dismissed from the AML-17 protocol. She received one series of chemotherapy according to the AML relapse protocol (12 mg/m2 mitoxantrone, etoposide 75 mg/m2, cytarabine 3 g/m2) and obtained a second complete remission (CR2). She succumbed to complicating systemic fungal infection approximately 3 weeks later while being in complete hematological and morphological remission.
Results
aCGH analysis of a NK-AML cohort
Twenty-one AML cases with a normal karyotype were screened for submicroscopic imbalances by high-resolution oligo-aCGH analysis at the single gene level. In one of the patients we detected a cryptic interstitial deletion in chromosome band 7q31.1 (see below) and we decided to characterize the leukemic cells of this patient in more detail.
Genomic and molecular karyotyping
Initial chromosome analysis by G-banding at the time of AML diagnosis indicated a normal female karyotype 46,XX in the patient with the cryptic 7q31.1 deletion [17] (Fig. 1a), which was confirmed by retrospective 24-color karyotyping, thereby excluding additional balanced cryptic aberrations (Fig. 1b). High-resolution aCGH analysis revealed a ~189,1 kb deletion in chromosome band 7q31.1 (Fig. 2a and b). The minimal region of deletion encompassed probes A_16_P01780332 to A_16_P38157086, mapping from 111,183,193 bp to 111,343,246 bp and the maximal region of deletion encompassed probes A_16_P18070535 to A_16_P01780634, mapping from 111,168,983 bp to 111,358,162 bp. The deleted region included the major 3′-part of the DOCK4 gene. Several alternative transcripts are known from the reverse strand and the BC043243 gene from the forward strand within this region (Fig. 2b). The 7q31.1 deletion was the only genomic copy number change detected in the patient.
Fig. 1.
Cytogenetic analyses. a G-banding analysis showed a normal karyotype 46,XX [17]. b 24-color karyotyping did not reveal any cryptic aberrations in 15 analyzed metaphases
Fig. 2.
Genome and FISH analyses. Panel a. High resolution 180 K array CGH analysis detected a submicroscopic deletion of approximately 189,1 kb at chromosome 7. Vertical blue lines indicate log2 ratios +0.24 and +0.60 and red lines indicate log2 ratios −0.24 and −1.0. The X-axis at the bottom indicates chromosomal position. Panel b. Zoom-in view of genomic profile at chromosome 7 showing the deleted region 7q31.1 as indicated by red shade. The insert at the top of the genome profile indicates genes in the zoomed-in region and their relative position to the deletion. The green bar indicates the position of the BAC probe RP11-260P7. Panel c. FISH using BAC probe RP11-260P7 (green) at 7q31.1 and centromeric probe D7Z1 (red) confirms the deletion on one of the chromosomes 7 in nuclei and metaphases from the patient at AML diagnosis (1G2R signal pattern). The chromosomal position of the probes is indicated on the ideogram of chromosome 7
Validation by FISH analysis
To validate the above findings we performed FISH analyses using BAC-probe RP11-260P7 and centromeric probe CEP 7. These analyses confirmed the mono-allelic nature of the deletion in both metaphases and interphase nuclei (Fig. 2c). After counting of 200 nuclei we found that 198 nuclei exhibited a 1G2R signal pattern, indicating that 99 % of the cells carried the deletion in the diagnostic sample. We also tested a bone marrow sample from CR2, and found that on this occasion 28 of 200 nuclei (14 %) were positive for the deletion.
Expression of DOCK4 in hematopoietic tissues
We assessed expression of the DOCK4 gene in the leukemic cells of our patient at the time of diagnosis and compared it with the DOCK4 expression in diagnostic samples from de novo AML patients with isolated −7 or del(7q) as detected by metaphase cytogenetics, in de novo AML patients with a normal karyotype (NK-AML) and, in addition, in CD34+ cells from healthy controls (Fig. 3). From the data obtained it is clear that the DOCK4 expression level in our patient is similarly low as in the group of −7/7q- AML patients, and that the degree of variability within this group is small. Also, DOCK4 expression was found to be lower in the −7/7q- group when compared to normal controls. When the DOCK4 expression levels were compared to those in the NK-AML patients, i.e. patients that by aCGH analysis showed no genomic aberrations, the mean values were found to be higher and a large variability in expression levels was noted (Fig. 3).
Fig. 3.
Relative DOCK4 expression in AMLs and healthy controls. DOCK4 expression was measured using qPCR. The relative expression is reported for the sample of interest (Δ DOCK4),, for other AMLs with −7/del(7q), for NK-AMLs (with no genomic aberrations detected by high resolution aCGH) and for healthy controls (Normal CD34+)
Comparison with 7q31.2 deletion
The probe commonly used to detect cryptic 7q deletions is the commercially available FISH probe mapping to D7S486/D7S522 on 7q31.2. However, with this probe we were not able to detect any deletion (Fig. 4a). This observation is in agreement with a more centromeric location of our patient’s deletion at 7q31.1 and, additionally, that the deletion is among the smallest yet identified in a de novo NK-AML patient (Fig. 4b).
Fig. 4.
a FISH analysis with the commonly used probes for the detection of cryptic 7q deletions (D7S486/D7S522/D7Z1) did not detect any deletion in our patient (2R2G signal pattern). b Partial 7q ideogram indicating relative postitions of common deleted regions in previous 7q-deletion mapping studies and present case. Red and green shades indicate the position of the commonly used commercial probes. Numbers in brackets indicate numbers in references
Discussion
We used high-resolution oligo-based aCGH analysis in a cohort of 21 NK-AML diagnostic samples, and detected one patient with a mono-allelic cryptic interstitial deletion of approximately 189,1 kb in size encompassing the major 3′ part of the DOCK4 gene. FISH with BAC-probe RP11-260P7 confirmed the deletion, and we found that 99 % of the cells carried the deletion at diagnosis. This percentage was reduced to 14 % in CR2. This significant reduction in CR2 indicates that the patient still had residual disease while being in hematological and morphological remission, and that the deletion is disease-related, i.e., not a harmless copy number variant. This deletion resulted in loss of exon 13 to exon 41–44, depending on the precise position of the deletion breakpoints (Fig. 5a). This precise position cannot be determined due to the limited resolution of oligo-based aCGH as compared to e.g. direct sequencing. The human DOCK4 gene is spread over ~480 kb on chromosome 7q31.1 and is transcribed from the reverse strand. It encompasses up to 52 exons, depending on isoform (Fig. 5b). Seventeen different transcripts have been detected, but it is not clear how the different transcripts are regulated or to what extent their level of expression varies in different tissues. In addition, the BC043243 gene is transcribed from the forward strand within the same region (Fig. 2a), but the significance of this gene is not known.
Fig. 5.
Cartoon showing the genomic and protein structure of the human DOCK4 gene. Panel a. Genomic structure of the DOCK4 gene with indicated relative sizes and positions of exons and introns. The solid grey bar indicates the relative position of the partial DOCK4 deletion in our case together with the indicated minimal size (broad solid bar) and maximal size (smaller extensions) of the deletion. Panel b. The full-length transcript of DOCK4 encodes a predicted 1,966 amino acid long protein (225 kDa) (NCBI 37.1, Aug. 2010). The wildtype DOCK4 polypeptide with known domains indicated as SH3, DHR-1, DHR-2 and PxxP. Part of the mRNA and amino acid sequences (in one letter code) are indicated together with the triplet (underlined) encoding glycin located in the splice junction between exons 12 and 13. Panel c. Predicted truncated polypeptides have retained the SH3-domain but lost the DHR-1, DHR-2 and PxxP domains
The deletion in our case results in a decreased expression of the DOCK4 gene to a level similarly low as observed in AML patients with isolated −7/del(7q). This is of particular interest because it provides new information that may be instrumental for defining a common deleted region at 7q31.1 involved in myeloid disorders. Since many years the delineation of the critical region of loss within 7q has been the focus of several investigations in hematopoietic neoplasms as well as in solid tumors [18–22]. In myeloid malignancies, deletions of chromosome 7 are typically large with a wide heterogeneity in the breakpoints. This has made it difficult to map a commonly deleted region (Fig. 4b) [12, 17, 20, 23–29]. FISH and allelotyping studies have led to the definition of at least three distinct regions that are frequently deleted: 7q22, 7q31.1 and 7q31.3 [20, 23, 30]. A recent SNP array study identified a common deleted region of 2,17 Mb within 7q22.1, harboring 49 RefSeq genes in de novo AML. Additional expression and molecular genetic analyses identified CUX1 as a haploinsufficient tumor suppressor gene located within this region [12].
Although recurrent 7q deletions have amply been defined, it is still unclear whether single genes located within these deletions are disease causing or whether a cooperative effect of several genes should be anticipated. Knockdown of DOCK4 in CD34+ stem cells impairs normal hematopoiesis and DOCK4 has been suggested to act as a candidate disease causing gene in myelodysplastic syndrome (MDS) [31]. In addition, DOCK4 has been identified as one of four other genes that are targeted by hypermethylation and genomic deletion in different MDS samples. Liang et al. [32] defined a 5,9 Mb critical region of loss between microsatellite markers D7S525 and D7S2502 where several genes including DOCK4 are localized, and found that the expression levels of DOCK4 in AML were reduced compared to normal CD34+ cells. DOCK4 was originally identified as a gene that is deleted during tumor progression and seems to have impact on several cancers, as both hetero- and homozygous mutations were detected in 5 out of 44 human cancer cell lines [33]. Mutations in DOCK4 or its promoter region have been associated with ovarian, prostate, brain, renal, colorectal and sporadic breast cancers [34]. Interestingly, direct evidence for tumor suppressor activity in 7q31 has previously been provided through reversion of tumorigenicity in nude mice by micro-cell hybrids containing human chromosome 7q31 fragments [35]. In our case we found an almost absence of DOCK4 expression as a result of its partial mono-allelic deletion. Collectively, these data support the notion that DOCK4 may act as a haploinsufficient tumor suppressor gene in myeloid malignancies.
DOCK4 is a member of the evolutionary conserved superfamily dedicator of cytokinesis (DOCK), also termed Dock180-related proteins [36, 37], and is characterized by the presence of two conserved protein domains termed Dock homology regions 1 and 2, DHR-1 and DHR-2, respectively. DOCK4 has two additional domains: a SH3 domain (Src3 homology) in its N-terminus and a proline-rich domain (PxxP) in its C-terminus (Fig. 5b). In silico analysis of the high-resolution aCGH data from our case predicts the presence of truncated polypeptides that have retained the SH3-domain but lost the DHR-1, DHR-2 and PxxP domains (Fig. 5c). Studies with truncated or mutated DOCK4 proteins have shown that DHR-2 contains the catalytic site for guanine nucleotide exchange factor (GEF) activity and that DHR-1 is required for downstream signaling and biological function [38, 39]. GEFs are regulatory nodes in intracellular signaling pathways that create a network between surface receptors and the nucleus by modulating GTP loading in small GTPases [38]. Classical GEFs harbor a Dbl homology-pleckstrin homology (DH-PH) domain. The Dock180-related family members are atypical GEFs that exert their activity through activation of the Rho (Ras homology) family of GTPases by facilitating the removal of GDP, thus allowing GTP binding to the Rho GTPases via binding of ELMO and RhoG [36, 40]. DOCK4 plays a central role in activating the Rho GTPases Rac1 [36] and Rap1 [41] and many physiological processes seem to be specifically regulated by these Rho GTPases in a variety of tissue types (Fig. 6). These processes involve changes in the actin cytoskeleton important for cell migration, adhesion, axonal polarization, tumor suppression, engulfment of apoptotic cells, phagocytosis of pathogens and endocytosis (reviewed in [42]). DOCK4 has also been shown to play important roles in at least two other signaling pathways: 1) DOCK4 interacts molecularly with the β-catenin pathway, specifically with GSK-3, a pathway that plays an important role in regulating stem cell function in hematopoiesis [43] and 2) an intracellular signaling pathway by which DOCK4 and Dynamin regulate cell migration through PDGF receptor endocytosis [44].
Fig. 6.
Schematic model of wildtype DOCK4 mediated Rac1 activation. The small GTPase RhoG is a key upstream regulator of Rac. RhoG activates Rac through its effector ELMO, which forms a complex with DOCK4 that serves as a functional GEF for Rac in intact cells. The interaction of RhoG with ELMO induces translocation of the ELMO-DOCK4 complex from the cytoplasm to the plasma membrane and activates Rac1 to promote e.g. lamellipodium formation and cell migration. The RHOG-Rac-ELMO-DOCK4 pathway affects other cellular functions via diverse subsets of effector molecules
Neutrophils are highly motile leucocytes playing important roles in the innate immune response to invading pathogens, and it might be speculated that an impaired motility of these neutrophils may lead to opportunistic infections being likely to occur and/or difficult to treat, as was seen in our patient. However, further studies are warranted before such a conclusion can be drawn.
One important feature of the present study is the application of high-resolution oligo-based aCGH analysis to ascertain the partial DOCK4 deletion. This notion is in agreement with similar studies showing that the application of aCGH or SNP-A in myeloid malignancies, with or without cytogenetic aberrations, enhances the diagnostic sensitivity and precision [10–14]. Our AML patient exhibited a normal karyotype and, therefore, was assigned an intermediate prognosis. If by aCGH analysis already at diagnosis the cryptic del(7)(q31.1q31.1) had been detected, the prognostic scoring would still be based on the normal karyotype. Future prognostic scoring systems may need to embrace new testing algorithms so that more accurate descriptions of the genomic abnormalities are taken into account.
An additional FLT-ITD mutation was detected in our patient with a tumor load of 35 % FLT3-ITD/FLT3-wt at the time of diagnosis, while the retrospectively identified cryptic del(7q) was present in 99 % of the leukemic cells as detected by locus-specific FISH. This suggests that the FLT3-ITD mutation was a secondary event, which is in concordance with the two-hit leukemogenic model in AML [45].
In conclusion, although the deletion was detected in only one out of 21 analyzed cases (4,8 %), it may provide novel clues to leukemia initiation, progression and response to therapy in at least a subset of NK-AML patients. Our data support the notion that DOCK4 is a strong candidate tumor suppressor gene located at 7q31.1, and a key regulator of important signaling pathways. In future studies, larger AML cohorts should be screened for cryptic loss of this genomic region and for mutations in the DOCK4 gene in order to substantiate its putative role in AML.
Electronic supplementary material
Below is the link to the electronic supplementary material.
(DOCX 70 kb)
Acknowledgements
We would like to thank biotechnologists Bente Madsen and Pia Kristensen for excellent technical assistance. The study was supported by the Danish Cancer Society.
Conflict of interest
The authors have no conflicts of interest to declare.
References
- 1.S.H. Swerdlow, WHO Classification of Tumours of Haematopoitic and Lymphoid Tissues, 4th edn. (International Agency for Research on Cancer (IARC), Lyon, 2008), pp. 109–147 [Google Scholar]
- 2.D. Grimwade, R.K. Hills, A.V. Moorman, H. Walker, S. Chatters, A.H. Goldstone, K. Wheatley, C.J. Harrison, A.K. Burnett, Refinement of cytogenetic classification in acute myeloid leukemia: determination of prognostic significance of rare recurring chromosomal abnormalities among 5876 younger adult patients treated in the United Kingdom Medical Research Council trials. Blood 116, 354–365 (2010) [DOI] [PubMed] [Google Scholar]
- 3.C. Schoch, W. Kern, S. Schnittger, T. Buchner, W. Hiddemann, T. Haferlach, The influence of age on prognosis of de novo acute myeloid leukemia differs according to cytogenetic subgroups. Haematologica 89, 1082–1090 (2004) [PubMed] [Google Scholar]
- 4.K. Mrozek, H. Dohner, C.D. Bloomfield, Influence of new molecular prognostic markers in patients with karyotypically normal acute myeloid leukemia: recent advances. Curr. Opin. Hematol. 14, 106–114 (2007) [DOI] [PubMed] [Google Scholar]
- 5.R. Mawad, E.H. Estey, Acute myeloid leukemia with normal cytogenetics. Curr Oncol Rep 14, 359–368 (2012) [DOI] [PubMed] [Google Scholar]
- 6.K. Mrozek, G. Marcucci, P. Paschka, S.P. Whitman, C.D. Bloomfield, Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: are we ready for a prognostically prioritized molecular classification? Blood 109, 431–448 (2007) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Z. Li, T. Herold, C. He, P.J. Valk, P. Chen, V. Jurinovic, U. Mansmann, M.D. Radmacher, K.S. Maharry, M. Sun, X. Yang, H. Huang, X. Jiang, M.C. Sauerland, T. Büchner, W. Hiddemann, A. Elkahloun, M.B. Neilly, Y. Zhang, R.A. Larson, M.M. Le Beau, M.A. Caligiuri, K. Döhner, L. Bullinger, P.P. Liu, R. Delwel, G. Marcucci, B. Lowenberg, C.D. Bloomfield, J.D. Rowley, S.K. Bohlander, J. Chen, Identification of a 24-gene prognostic signature that improves the European LeukemiaNet risk classification of acute myeloid leukemia: an international collaborative study. J. Clin. Oncol. 31, 1172–1181 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.R. Basirico, R. Pirrotta, F. Fabbiano, S. Mirto, L. Cascio, M. Pagano, G. Cammarata, S. Magrin, A. Santoro, Submicroscopic deletions at 7q region are associated with recurrent chromosome abnormalities in acute leukemia. Haematologica 88, 429–437 (2003) [PubMed] [Google Scholar]
- 9.V. Adema, J.M. Hernandez, M. Abaigar, E. Lumbreras, E. Such, A. Calull, E. Dominguez, L. Arenillas, M. Mallo, J. Cervera, I. Marugán, M. Tormo, F. García, T. González, E. Luño, C. Sanzo, M.L. Martín, M. Fernández, D. Costa, B. Blázquez, B. Barreña, F. Marco, A. Batlle, I. Buño, C. Martínez-Laperche, V. Noriega, R. Collado, D. Ivars, F. Carbonell, I. Vallcorba, J. Melero, E. Delgado, M.T. Vargas, J. Grau, M. Salido, B. Espinet, C. Melero, L. Florensa, C. Pedro, F. Solé, Application of FISH 7q in MDS patients without monosomy 7 or 7q deletion by conventional G-banding cytogenetics: does—7/7q- detection by FISH have prognostic value? Leuk. Res. 37, 416–421 (2013) [DOI] [PubMed] [Google Scholar]
- 10.A. Tyybakinoja, E. Elonen, K. Piippo, K. Porkka, S. Knuutila, Oligonucleotide array-CGH reveals cryptic gene copy number alterations in karyotypically normal acute myeloid leukemia. Leukemia 21, 571–574 (2007) [DOI] [PubMed] [Google Scholar]
- 11.R.N. Mackinnon, G. Kannourakis, M. Wall, L.J. Campbell, A cryptic deletion in 5q31.2 provides further evidence for a minimally deleted region in myelodysplastic syndromes. Cancer Genet 204, 187–194 (2011) [DOI] [PubMed] [Google Scholar]
- 12.M.E. Mcnerney, C.D. Brown, X. Wang, E.T. Bartom, S. Karmakar, C. Bandlamudi, S. Yu, J. Ko, B.P. Sandall, T. Stricker, J. Anastasi, R.L. Grossman, J.M. Cunningham, M.M. Le Beau, K.P. White, CUX1 is a haploinsufficient tumor suppressor gene on chromosome 7 frequently inactivated in acute myeloid leukemia. Blood 121, 975–983 (2013) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.H. Makishima, M. Rataul, L.P. Gondek, J. Huh, J.R. Cook, K.S. Theil, M.A. Sekeres, E. Kuczkowski, C. O'keefe, J.P. Maciejewski, FISH and SNP-A karyotyping in myelodysplastic syndromes: improving cytogenetic detection of del(5q), monosomy 7, del(7q), trisomy 8 and del(20q). Leuk. Res. 34, 447–453 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.R. Bajaj, F. Xu, B. Xiang, K. Wilcox, A.J. Diadamo, R. Kumar, A. Pietraszkiewicz, S. Halene, P. Li, Evidence-based genomic diagnosis characterized chromosomal and cryptic imbalances in 30 elderly patients with myelodysplastic syndrome and acute myeloid leukemia. Mol. Cytogenet. (2011). doi:10.1186/1755-8166-4-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.E. Kjeldsen, A.S. Roug, A novel unbalanced de novo translocation der(5)t(4;5)(q26;q21.1) in adult T-cell precursor lymphoblastic leukemia. Mol. Cytogenet. (2012). doi:10.1186/1755-8166-5-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.L. Grubach, C. Juhl-Christensen, A. Rethmeier, L.H. Olesen, A. Aggerholm, P. Hokland, M. Ostergaard, Gene expression profiling of Polycomb, Hox and Meis genes in patients with acute myeloid leukaemia. Eur. J. Haematol. 81, 112–122 (2008) [DOI] [PubMed] [Google Scholar]
- 17.E.J. Johnson, S.W. Scherer, L. Osborne, L.C. Tsui, D. Oscier, S. Mould, F.E. Cotter, Molecular definition of a narrow interval at 7q22.1 associated with myelodysplasia. Blood 87, 3579–3586 (1996) [PubMed] [Google Scholar]
- 18.C.L. Andersen, A. Gruszka-Westwood, M. Ostergaard, J. Koch, E. Jacobsen, E. Kjeldsen, B. Nielsen, A narrow deletion of 7q is common to HCL, and SMZL, but not CLL. Eur. J. Haematol. 72, 390–402 (2004) [DOI] [PubMed] [Google Scholar]
- 19.P. Tripputi, B. Cassani, R. Alfano, D. Graziani, D. Cigognini, P. Doi, M. Bignotto, G. Corneo, G. Coggi, Chromosome 7 monosomy and deletions in myeloproliferative diseases. Leuk. Res. 25, 735–739 (2001) [DOI] [PubMed] [Google Scholar]
- 20.H. Liang, J. Fairman, D.F. Claxton, P.C. Nowell, E.D. Green, L. Nagarajan, Molecular anatomy of chromosome 7q deletions in myeloid neoplasms: evidence for multiple critical loci. Proc. Natl. Acad. Sci. U. S. A. 95, 3781–3785 (1998) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.E.R. Velloso, L. Michaux, A. Ferrant, J.M. Hernandez, P. Meeus, J. Dierlamm, A. Criel, A. Louwagie, G. Verhoef, M. Boogaerts, J.L. Michaux, A. Bosly, C. Mecucci, H. van den Berghe, Deletions of the long arm of chromosome 7 in myeloid disorders: loss of band 7q32 implies worst prognosis. Br. J. Haematol. 92, 574–581 (1996) [DOI] [PubMed] [Google Scholar]
- 22.P. Greenberg, C. Cox, M.M. Lebeau, P. Fenaux, P. Morel, G. Sanz, T. Vallespi, T. Hamblin, D. Oscier, K. Ohyashiki, K. Toyama, C. Aul, G. Mufti, J. Bennett, International scoring system for evaluating prognosis in myelodysplastic syndromes. Blood 89, 2079–2088 (1997) [PubMed] [Google Scholar]
- 23.M.M. Le Beau, R. Espinosa 3rd, E.M. Davis, J.D. Eisenbart, R.A. Larson, E.D. Green, Cytogenetic and molecular delineation of a region of chromosome 7 commonly deleted in malignant myeloid diseases. Blood 88, 1930–1935 (1996) [PubMed] [Google Scholar]
- 24.M.B. Gonzalez, N.C. Gutierrez, J.L. Garcia, E.F. Schoenmakers, F. Sole, M.J. Calasanz, J.F. San Miguel, J.M. Hernandez, Heterogeneity of structural abnormalities in the 7q31.3 approximately q34 region in myeloid malignancies. Cancer Genet Cytogenet 150, 136–143 (2004) [DOI] [PubMed] [Google Scholar]
- 25.S. Tosi, S.W. Scherer, G. Giudici, B. Czepulkowski, A. Biondi, L. Kearney, Delineation of multiple deleted regions in 7q in myeloid disorders. Genes Chromosomes Cancer 25, 384–392 (1999) [DOI] [PubMed] [Google Scholar]
- 26.J. Kere, T. Ruutu, K.A. Davies, I.B. Roninson, P.C. Watkins, R. Winqvist, A. De La Chapelle, Chromosome 7 long arm deletion in myeloid disorders: a narrow breakpoint region in 7q22 defined by molecular mapping. Blood 73, 230–234 (1989) [PubMed] [Google Scholar]
- 27.S. Lewis, G. Abrahamson, J. Boultwood, C. Fidler, A. Potter, J.S. Wainscoat, Molecular characterization of the 7q deletion in myeloid disorders. Br. J. Haematol. 93, 75–80 (1996) [DOI] [PubMed] [Google Scholar]
- 28.K. Fischer, S. Frohling, S.W. Scherer, J. Mcallister Brown, C. Scholl, S. Stilgenbauer, L.C. Tsui, P. Lichter, H. Dohner, Molecular cytogenetic delineation of deletions and translocations involving chromosome band 7q22 in myeloid leukemias. Blood 89, 2036–2041 (1997) [PubMed] [Google Scholar]
- 29.K. Döhner, J. Brown, U. Hehmann, C. Hetzel, J. Stewart, G. Lowther, C. Scholl, S. Fröhling, A. Cuneo, L.C. Tsui, P. Lichter, S.W. Scherer, H. Döhner, Molecular cytogenetic characterization of a critical region in bands 7q35–q36 commonly deleted in malignant myeloid disorders. Blood 92, 4031–4035 (1998) [PubMed] [Google Scholar]
- 30.D. Cigognini, G. Corneo, E. Fermo, A. Zanella, P. Tripputi, HIC gene, a candidate suppressor gene within a minimal region of loss at 7q31.1 in myeloid neoplasms. Leuk. Res. 31, 477–482 (2007) [DOI] [PubMed] [Google Scholar]
- 31.L. Zhou, J. Opalinska, D. Sohal, Y. Yu, Y. Mo, T. Bhagat et al., Aberrant epigenetic and genetic marks are seen in myelodysplastic leukocytes and reveal Dock4 as a candidate pathogenic gene on chromosome 7q. J. Biol. Chem. 286, 25211–25223 (2011) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.H. Liang, P.D. Castro, J. Ma, L. Nagarajan, Finer delineation and transcript map of the 7q31 locus deleted in myeloid neoplasms. Cancer Genet Cytogenet 162, 151–159 (2005) [DOI] [PubMed] [Google Scholar]
- 33.V. Yajnik, C. Paulding, R. Sordella, A.I. Mcclatchey, M. Saito, D.C. Wahrer, P. Reynolds, D.W. Bell, R. Lake, S. van den Heuvel, J. Settleman, D.A. Haber, DOCK4, a GTPase activator, is disrupted during tumorigenesis. Cell 112, 673–684 (2003) [DOI] [PubMed] [Google Scholar]
- 34.A. Jalali, H. Ebrahimi, M. Ohadi, M. Karimloo, A.I. Shemirani, B. Mohajer, H.R. Khorshid, New variations in the promoter regions of human DOCK4 and RAP1A genes, and coding regions of RAP1A in sporadic breast tumors. Avicenna J Med Biotechnol 1, 117–123 (2009) [PMC free article] [PubMed] [Google Scholar]
- 35.J.C. Zenklusen, M. Oshimura, J.C. Barrett, C.J. Conti, Inhibition of tumorigenicity of a murine squamous cell carcinoma (SCC) cell line by a putative tumor suppressor gene on human chromosome 7. Oncogene 9, 2817–2825 (1994) [PubMed] [Google Scholar]
- 36.K. Hiramoto, M. Negishi, H. Katoh, Dock4 is regulated by RhoG and promotes Rac-dependent cell migration. Exp Cell Res 312, 4205–4216 (2006) [DOI] [PubMed] [Google Scholar]
- 37.J.F. Cote, K. Vuori, Identification of an evolutionarily conserved superfamily of DOCK180-related proteins with guanine nucleotide exchange activity. J Cell Sci 115, 4901–4913 (2002) [DOI] [PubMed] [Google Scholar]
- 38.V.M. Braga, GEF without a Dbl domain? Nat Cell Biol (2002). doi:10.1038/ncb0802-e188 [DOI] [PubMed] [Google Scholar]
- 39.J.F. Cote, K. Vuori, GEF what? Dock180 and related proteins help Rac to polarize cells in new ways. Trends Cell Biol. 17, 383–393 (2007) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.N. Hiramoto-Yamaki, S. Takeuchi, S. Ueda, K. Harada, S. Fujimoto, M. Negishi, H. Katoh, Ephexin4 and EphA2 mediate cell migration through a RhoG-dependent mechanism. J Cell Biol 190, 461–477 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.W.J. Pannekoek, M.R. Kooistra, F.J. Zwartkruis, J.L. Bos, Cell-cell junction formation: the role of Rap1 and Rap1 guanine nucleotide exchange factors. Biochim. Biophys. Acta 1788, 790–796 (2009) [DOI] [PubMed] [Google Scholar]
- 42.J.C. Mulloy, J.A. Cancelas, M.D. Filippi, T.A. Kalfa, F. Guo, Y. Zheng, Rho GTPases in hematopoiesis and hemopathies. Blood 115, 936–947 (2010) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.G. Upadhyay, W. Goessling, T.E. North, R. Xavier, L.I. Zon, V. Yajnik, Molecular association between beta-catenin degradation complex and Rac guanine exchange factor DOCK4 is essential for Wnt/beta-catenin signaling. Oncogene 27, 5845–5855 (2008) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.K. Kawada, G. Upadhyay, S. Ferandon, S. Janarthanan, M. Hall, J.P. Vilardaga, V. Yajnik, Cell migration is regulated by platelet-derived growth factor receptor endocytosis. Mol. Cell. Biol. 29, 4508–4518 (2009) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.D.G. Gilliland, Hematologic malignancies. Curr. Opin. Hematol. 8, 189–191 (2001) [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(DOCX 70 kb)






