Chitooligosaccharides Improves Severe Acute Pancreatitis by Reducing Intestinal Mucosal Injury and Regulating Intestinal Microbiota

Abstract

Severe acute pancreatitis (SAP), a widespread inflammatory condition impacting the abdomen with persistent organ dysfunction (> 48 h) and a high mortality rate, poses challenges due to its unclear pathogenesis and the absence of effective treatment options. Chitooligosaccharide (COS), a naturally occurring alkaline oligosaccharide, demonstrates robust anti-inflammatory, antioxidant, and regulating intestinal microbiota properties. However, the specific protective impact of COS on SAP remains to be fully elucidated. Maintaining intestinal microecological balance provides an effective method for modulating systemic infection in SAP. This study examined the effects of COS on the intestinal mucosal barrier and intestinal microbiota with SAP, and the possible mechanisms by which COS produces anti-inflammatory and antioxidant functions. The SAP model was established by injecting sodium taurocholate into the pancreaticobiliary ducts of Sprague–Dawley rats. Serum pancreatitis biomarkers, inflammatory factors, oxidative stress markers in intestinal tissue, and plasma intestinal permeability factors were measured to evaluate inflammation and intestinal injury. Western blot analysis was used to detect E-cadherin and Zonula occludens-1 (ZO-1) in intestinal tissue to assess intestinal integrity. The intestinal microbiota composition in feces was characterised through 16S rRNA sequencing. COS treatment (2.5–5 mg/mL) significantly decreased serum pancreatitis biomarkers and inflammatory factors, improved pancreatic and intestinal pathology, reduced inflammatory factors in intestinal tissues and intestinal permeability factors in plasma, increased antioxidant factors, and upregulated the protein expression of E-cadherin and ZO-1 in intestinal tissues compared to those in the normal saline treatment group. COS affected the diversity and richness of the intestinal microbiota. Oral gavage of 2.5–5 mg/mL COS improved the intestinal microflora balance and recovered intestinal barrier injury in SAP rats. Additionally, an in vitro cell model of intestinal inflammation was prepared by incubating NCM460 cells with 200 μg/mL lipopolysaccharide (LPS) for 48 h. Inflammatory factors, oxidative stress markers, and expression of p-P65-P65 were measured to explore possible mechanisms of the anti-inflammatory and antioxidant properties of COS. COS ameliorated SAP severity in our rat model by restoring intestinal barrier function and microbiota balance, suggesting potential as a therapeutic agent for SAP, pending further clinical evaluation.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12602-025-10679-z.

Introduction

Acute pancreatitis (AP) is a prevalent acute gastrointestinal disorder. The global incidence of AP has increased over time [1]. Despite advancements in healthcare access, imaging, and interventional techniques, AP still has a significant impact on patient morbidity and mortality. Although some drugs have been used as adjunctive therapy for AP, they can only serve to relieve symptoms—antibiotics, antioxidants, nonsteroidal anti-inflammatory drugs, somatostatin, octreotide, ulinastatin, etc. There are no ideal therapeutic agents to treat or prevent acute pancreatitis directly, so this highlights the need for new therapeutic approaches to address the pathogenesis of AP [2, 3]. In the early stages of AP, a substantial release of cytokines due to local pancreatic inflammation enters the bloodstream, triggering systemic inflammatory response syndrome (SIRS), which can progress to multiple organ dysfunction syndrome (MODS) [4]. During SIRS and MODS, the integrity of the intestinal barrier becomes severely compromised. Such damage is accompanied by the occurrence of gut-derived infections that forms a “second hit summit” through inflammatory overabundance [5]. The development of severe acute pancreatitis (SAP), which poses a life-threatening risk, further compounds the economic burden associated with AP [6–8]. SAP, often accompanied by gut-derived infections, accounts for 80% of all AP-related deaths [9]. Considerable evidence suggests that dysbiosis of the intestinal microbiota plays a crucial role in the development of the “second hit” caused by gut-derived infections in AP. Therefore, maintaining a balanced intestinal microecology may be an effective strategy for modulating systemic SAP infections.

Chitooligosaccharide (COS) is a polymer of β-(1–4)-linked D-glucosamine derived from chitin/chitosan through acid hydrolysis, enzymatic degradation, or both [10]. COS has exhibited a wide range of biological activities [11], including antimicrobial, antioxidant, anti-inflammatory, antitumour, immunostimulatory, and hypocholesterolemic properties. These activities are attributed to its water solubility, biocompatibility, and intestinal absorption [12–16]. In a study involving mice with SAP, the oral gavage of COS for four weeks led to reduced ileal injury and barrier dysfunction and improved the imbalance of the intestinal microbiota associated with SAP. Consequently, the severity of SAP significantly decreased, suggesting that COS may have potential as a prebiotic treatment for SAP [17]. However, the clinical application of preventive oral COS in SAP is currently limited. Furthermore, despite previous studies recommending COS concentrations [18, 19], the optimal therapeutic concentration of COS requires further discussion due to variations in the raw materials, preparation methods, and COS structures [10].

Therefore, in this study, we aimed to investigate the therapeutic effects of oral gavage of COS at the most appropriate concentration on pancreatic and intestinal inflammation in a rat model of SAP. Additionally, we will explore the associations among these effects, the restoration of intestinal barrier injury, and the maintenance of intestinal microbiota balance. Mechanistically, through establishing an intestinal inflammatory cell model, we explored the relationship between the role of COS production in alleviating inflammation and oxidative stress and the NF-κB signalling pathway.

Materials and Methods

Preparation of COS

COS (Mn 1000 Da, > 90% deacetylation degree) was obtained from the Institute of Metal Research, Chinese Academy of Sciences, using the enzymolysis method described by Du et al. [20]. COS doses (0.625–10 mg/mL, equivalent to ~ 31–500 mg/kg/day) were selected based on previous studies demonstrating biological effects of COS in gastrointestinal models [17, 21, 22], while spanning a range to identify potential optimal and supra-optimal concentrations.

Animals

Sixty male Sprague–Dawley rats (6–8 weeks old; weighing 260–300 g) with specific pathogen-free status were procured from the Zhejiang Provincial Animal Centre. After acclimatisation for one week in a specific pathogen-free animal facility [23], 12 rats were randomly assigned to the sodium taurocholate group or the normal saline group (6 rats in each group) for preexperimental SAP animal modelling (used solely for model validation). The remaining 48 rats were randomly divided into the SAP control group and five COS treatment groups (eight rats in each group). The General Hospital of Northern Theatre Command does not have facilities for animal studies. Therefore, all animal experiments were outsourced to and conducted by the licensed Contract Research Organisation (CRO), Jiangsu KeyGEN BioTECH Corp., Ltd., in strict accordance with their institutional guidelines. The study protocol was approved by the Jiangsu KeyGEN BioTECH Corp., Ltd. Animal Care and Use Committee (Approval No. IACUC-001–27) under animal licence number SYXK[SU] 2017–0040.

Rats were reared in CP-4 transparent rat cages (L × W × H: 490 mm × 278 mm × 260 mm) following a maximum feeding density of ≤ 4 rats per cage. The breeding environment conditions adhered to the national standard GB14925-2010 of the People’s Republic of China. The breeding environment control system utilised an automatic control fresh air central air conditioning system provided by Shenzhen Haojin Oubo Company. The breeding temperature was maintained at room temperature between 20 and 26 ℃, with a maximum daily temperature difference of ≤ 4 ℃. The relative humidity ranged from 40 to 70%. Artificial lighting was employed, featuring alternating 12-h periods of light and dark (lights on at 07:00 and off at 19:00). The bedding material used was corn cob padding supplied by Beijing Keao Xieli Feed Co., Ltd. Each batch of padding material was subjected to testing for pollutant content by the supplier, in accordance with the national standard GB14924.2–2001 of the People’s Republic of China. The rats were provided with maintenance feed for Co60-irradiated maintenance feed manufactured by Beijing Keao Xieli Feed Co., Ltd. This enterprise possesses a feed production licence (SCXK Beijing 2019–0003). The feeding method implemented was free intake. The nutritional components of the feed were tested for each batch, as per the national standard GB14924.3–2010. The supplier also conducted tests on the feed for pollutants based on the chemical pollutant indicators outlined in the national standard GB14924.2–2001 of the People’s Republic of China. The rats were provided with high-pressure sterilised experimental animal drinking water supplied in drinking bottles for free consumption. The water quality data adhered to the conventional water quality indicators specified in the national standard GB5749-2006 of the People’s Republic of China.

The rats were anaesthetised through the intraperitoneal injections of a pentobarbital solution at a dosage of 4 mg per 100 g of body weight before blood collection. The rat was positioned to receive minimal pain and discomfort on the operating table throughout the surgical operation. After a skin incision (approximately 1 cm) was made across the clavicle, the superficial musculature of the neck was opened. The jugular vein was punctured through the overlaying pectoral muscle. A 1-mL blood sample was quickly withdrawn into a plastic syringe (Vicole, 2.5 mL) preloaded with 0.5 mL of ACD anticoagulant. A powdered antibiotic was then applied to the neck incision, which was then closed with a single skin suture.

When a rat is euthanised, it is placed in a carbon dioxide anaesthesia box. CO₂ is injected into the euthanasia box at a rate of 30% of volume/minimum air displacement. After the rat faints and loses its ability to move, the gas flow rate is further increased, but the maximum flow rate cannot exceed 0.5 kPa. When the rat is observed to be not moving and not breathing and to have dilated pupils, the CO₂ supply is cut off, and the rat is observed for another 2 min to confirm that the rat was dead.

Establishment of the SAP Animal Model

The rats were subjected to a 12-h fast and allowed to freely consume water prior to surgery. For anaesthesia, the rats received intraperitoneal injections of a pentobarbital solution at a dosage of 4 mg per 100 g of body weight. Following laparotomy, a retrograde injection of 5% sodium taurocholate at a volume of 1 mL per 1000 g of body weight was administered along the pancreaticobiliary duct at a rate of 0.2 mL/min [23]. The control group received an injection of the same volume of normal saline. Once no hemorrhage, bile leakage, or other symptoms were observed for 5 min, the abdomen was closed. At 48-h post-injection, blood, pancreas, and intestinal tissues from the rats were collected to verify the successful establishment of the model.

After confirming the successful establishment of SAP in the rats, the rats in the five COS treatment groups were administered different concentrations of COS (10, 5, 2.5, 1.25, and 0.625 mg/mL COS dissolved in sterile water or approximately 500, 250, 125, 62.5, and 31.25 mg/kg/day, respectively) through oral gavage every 8 h, with a dosage of 5 mL each time, for 72 h. COS was administered via gavage. These groups were designated Groups A, B, C, D, and E, respectively, based on the concentration of COS, in descending order. The SAP control group received an equivalent volume of sterile water via oral gavage.

Randomisation was performed using a computer-generated sequence (SPSS 20.0). Rats were assigned unique identification numbers, and group assignments were kept confidential until data analysis. Outcome assessors (histopathology and biochemical testing) were unaware of group assignments.

Cell Culture and Treatment

The NCM460 cells were bought from Green Flag Biotechnology Development Company (Shanghai, China), and cultured in 90% DMEM medium + 10% fetal bovine serum (FBS) in a 37 °C incubator with 5% CO₂ and saturated humidity. The NCM460 cells were treated with 200 μg/mL LPS for 48 h. COS was administered to the NCM460 cells at a concentration of 0.625, 2.5, or 10 mg/mL for 24 h. The selected concentrations (0.625–10 mg/mL) align with noncytotoxic levels reported in intestinal cell studies [12, 21].

MTT Colorimetric Assay

NCM460 cells were seeded and maintained in 96-well plates with a density of 1000 cells. Thereafter, 10-μL MTT solution (5 mg/mL) was added to the cells and incubated for an additional 4 h at 37 °C. Then, the insoluble formazan crystals were dissolved in 150-μL dimethyl sulfoxide (DMSO). Subsequently, the absorbance of each well was measured on a microplate spectrophotometer at a 570-nm wavelength.

Flow Cytometry Assay

Firstly, cells were collected by digestion with 0.25% trypsin (without EDTA) and 5 × 10⁵ cells were collected by washing the cells twice with phosphate-buffered saline (centrifugation at 1000 rpm, 5 min). Secondly, 500 μL of a binding buffer was added, and gentle blowing was applied to form a single-cell suspension. Lastly, 5 μL of annexin V-APC and 5 μL of 7-AAD solution were added. The mixture was blown gently, left to react for 5–15 min at room temperature, and protected from light to determine the cell apoptotic percentage.

Histological Examination

Intestinal and pancreatic tissue specimens were fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and then subjected to hematoxylin and eosin (H&E) staining. Morphological changes were observed under a microscope (IX73, Olympus, Tokyo, Japan) equipped with a digital camera (DP80, Olympus, Tokyo, Japan) at a magnification of × 400. The severity of pancreatitis was evaluated using the Schmidt criteria [24], and intestinal pathological damage was graded according to Chiu’s standard [25].

Serum Amylase and Lipase Activities

The activities of serum amylase and lipase were determined using assay kits (Jian Cheng Bioengineering Institute, Nanjing, China) in accordance with the manufacturer’s protocol. Serum amylase levels are expressed as U/dL, and serum lipase levels are expressed as U/L.

Measurement of Inflammatory Cytokines

The levels of the inflammatory cytokines tumour necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) were measured using enzyme-linked immunosorbent assay (ELISA) kits (Jian Cheng Bioengineering Institute, Nanjing, China) following the manufacturer’s instructions. Serum cytokine levels are expressed as pg/mL. The concentration of serum endotoxin was quantified using a chromogenic endpoint TAL (Jian Cheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions and is expressed as IU/L.

Measurement of Antioxidant Property Indicators

The levels of the oxidative stress markers malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSPx) [23] in cellular model or intestinal tissue were evaluated using kits (Jian Cheng Bioengineering Institute, Nanjing, China), following the manufacturer’s instructions. MDA was expressed as nmol/L or nmol/mg protein, whereas SOD, CAT, and GSPx were expressed as U/mL or U/mg protein.

Measurement of Indicators of Intestinal Barrier Function

To assess the degree of damage and changes in intestinal mucosa permeability, D-lactate and diamine oxidase (DAO) in peripheral blood were examined [26, 27]. Plasma D-lactate levels were measured using an ELISA kit (Jian Cheng Bioengineering Institute, Nanjing, China) and are expressed as nmol/µL. DAO activity in plasma was assessed using a commercial kit from EterLife, Birmingham, UK, and the results are expressed as U/L.

Western Blot Analysis

Intestinal tissues were isolated and homogenised in lysis buffer (Beyotime Biotechnology, China) on ice. The homogenate was centrifuged (14,000 rpm, 15 min, 4 ℃), and the total supernatant protein concentration was measured using a BCA protein assay kit (Beyotime Biotechnology, China). After heating at 100 ℃ for 10 min, equal amounts of protein (20 µg) extracts were separated by SDS‒PAGE and transferred to PVDF membranes. The membranes were blocked in 5% skim milk at room temperature for 1 h and then incubated with primary antibodies in 5% BSA–TBST at 4 ℃overnight. The primary antibodies used were rabbit anti-zonula occludens-1 (ZO-1) (1: 1000), rabbit anti-E-cadherin (1: 1000), and rabbit anti-GAPDH (1: 1000) (Cell Signalling Technology, Danvers, MA). The membranes were then incubated with rabbit IgG-HRP secondary antibodies at 4 ℃ for 4 h. The proteins were visualised using an enhanced chemiluminescence (ECL) system. The protein bands were scanned and quantified using ImageJ software Version 1.34 (Wayne Rasband National Institute of Health), and GAPDH was used for normalisation.

Cell samples were lysed by a lysis buffer (Kaiji, Nanjing, China), and total proteins were extracted from the cells in the presence of protease inhibitors. The proteins from the NCM460 cells were isolated for protein extraction, separated via 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, sequentially transferred to nitrocellulose filter (NC) membranes, and blocked with 5% skimmed milk powder for 2 h. The NC membranes were subsequently incubated with primary antibodies, including p-P65 (1: 1000, ab86299; Abcam) and P65 (1: 1000, ab16502; Abcam), overnight at 4 °C, followed by incubation with secondary antibodies for 2 h at room temperature. Signals were detected using an enhanced luminol-based chemiluminescent kit. G:BOX chemiXR5 was utilised for imaging, and the results were analysed in grey scale by using Gel-Pro32 software.

Intestinal Microbiota Analysis

Microbial DNA was extracted using a HiPure Stool DNA Kit following the manufacturer’s protocols. The 16S rDNA V4 region of the ribosomal RNA gene was amplified by PCR (95 ℃ for 2 min, followed by 27 cycles at 98 ℃ for 10 s, 62 ℃ for 30 s, and 68 ℃ for 30 s and a final extension at 68 ℃ for 10 min) using the primers Arch519F (CAGCMGCCGCGGTAA) and Arch915R (GTGCTCCCCCGCCAATTCCT), with each sample having a unique eight-base barcode. M represents the alignment of the base to the base of the reference sequence, allowing for the inclusion of mismatches. This situation is the basis for SNP variant calling. PCRs were performed in triplicate using 50 µL mixtures containing 5 µL of 10 × KOD buffer, 5 µL of 2.5 mM dNTPs, 1.5 µL of each primer (5 µM), 1 μL of KOD polymerase, and 100 ng of template DNA.

Amplicons were extracted from 2% agarose gels and purified using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, U.S.) according to the manufacturer’s instructions. Quantification was performed using an ABI StepOnePlus Real-Time PCR System (Life Technologies, Foster City, USA). The purified amplicons were pooled in equimolar amounts and subjected to paired-end sequencing (2 × 250) on an Illumina platform following standard protocols.

Statistical Analyses

Statistical analyses were conducted using SPSS 20.0 software (SPSS, Inc., Chicago, IL, USA). The data are presented as the means ± standard deviations. Student’s t test and one-way analysis of variance (ANOVA) with post hoc Tukey’s tests were utilised to compare variables between groups. Differences were considered statistically significant if P < 0.05.

Results

Animal Clinical Outcomes

No mortality occurred in any experimental group during the 72-h treatment period. All rats survived until the scheduled endpoint. Body weight was monitored at baseline, 24 h, 48 h, and 72 h post-SAP induction. Rats in the SAP control group exhibited significant weight loss (mean decrease: 15.2 ± 2.1% at 72 h), reduced spontaneous activity, hunched posture, piloerection, and signs of abdominal guarding. In contrast, COS-treated groups (especially 2.5–5 mg/mL) showed dose-dependent improvements: weight loss was attenuated, activity levels increased, and pain-related behaviours were reduced.

Establishment and Assessment of SAP Rats

At 48-h post-injection, the levels of serum amylase and lipase were significantly greater in the sodium taurocholate group than in the normal saline group (P < 0.05) (Fig. 1a and 1b). No noteworthy pathological abnormalities were observed in the pancreas or intestine of the normal saline group. However, the sodium taurocholate group exhibited inflammatory cell infiltration, bleeding, damage to the pancreatic lobule structure, and high acinar cell necrosis in the pancreatic tissue (Fig. 1c). Additionally, intestinal tissue displayed edema and broadening of villi, villus shortening, and inflammatory cell infiltration (Fig. 1d). These results indicated that the injection of sodium taurocholate induced SAP in rats.

Fig. 1.

Assessment of severe acute pancreatitis (SAP) rats. (a) Serum amylase. (b) Serum lipase. (c) Histopathological changes in pancreatic tissue samples. Original magnification, 400 ×. Pancreatic histopathological scores were evaluated by using the Schmidt criteria. (d) Histopathological changes in intestinal samples. Original magnification, 400 ×. Intestinal histopathological scores were evaluated by using Chiu’s standard. ^*P < 0.05 vs. the SAP group. ^#P < 0.01 vs. the SAP group

COS Treatment Reduced Pathological Inflammation, Pancreatitis Biomarker Activity and Inflammatory Cytokine Levels in SAP Patients

H&E staining revealed that the morphology of pancreatic cells improved in the COS treatment groups, with reductions in pancreatic edema, inflammatory cell infiltration, and acinar necrosis compared to those in the SAP group (Fig. 2a). Animals treated with COS via oral gavage exhibited lower pathological scores than did those in the SAP group (Fig. 2b). Amylase and lipase are potential biomarkers of pancreatitis. Oral gavage of COS significantly decreased the serum amylase (Fig. 2c) and lipase (Fig. 2d) levels at 72 h post-treatment. Furthermore, COS treatment reduced the serum levels of TNFα, IL-1β, IL-6, and endotoxins (Fig. 2e–2h). These findings suggest that COS treatment can increase the levels of anti-inflammatory factors in SAP rats.

Fig. 2.

Effects of chitooligosaccharides (COS) on pathological inflammation, pancreatitis biomarkers and inflammatory cytokines in SAP rats. (a) Histopathological changes in pancreatic tissue samples. Original magnification, 400 ×. (b) Pancreatic histopathological scores were evaluated by using the Schmidt criteria. (c) Serum amylase levels in each group. (d) Serum lipase levels in each group. (e) Serum TNFα levels in each group. (f) Serum IL-1β levels in each group. (g) Serum IL-6 levels in each group. (h) Serum endotoxin levels in each group. ^*P < 0.05 vs. the SAP group. ^#P < 0.01 vs. the SAP group

COS Treatment Reduced Pathological Inflammation and Increased the Levels of Anti-Inflammatory Factors and Antioxidant Factors in the Intestine

The administration of COS through the stomach improved tissue edema, shortened intestinal villi, and reduced inflammatory cell infiltration in a dose-dependent manner (Fig. 3a). It also significantly reduced intestinal pathological scores Fig. 3b). The levels of TNFα, IL-1β, and IL-6 in the intestinal tissues of the treatment groups were lower than those in the intestinal tissues of the SAP group. TNFα significantly decreased, as did IL-1β and IL-6 (Fig. 3c–e).

Fig. 3.

Effects of COS on pathological inflammation, anti-inflammatory factors, and antioxidant factors in the intestine of SAP rats. (a) Histopathological changes in intestinal samples. Original magnification, 400 ×. (b) Intestinal histopathological scores were evaluated by using Chiu’s standard. (c) Intestinal tumour necrosis factor-α (TNF-α) levels in each group. (d) Intestinal interleukin-1β (IL-1β) levels in each group. (e) Intestinal interleukin-6 (IL-6) levels in each group. (f) Intestinal superoxide dismutase (SOD) levels in each group. (g) Intestinal catalase (CAT) levels in each group. (h) Intestinal glutathione peroxidase (GSPx) levels in each group. (i) Intestinal malondialdehyde (MDA) levels in each group. ^*P < 0.05 vs. the SAP group. ^#P < 0.01 vs. the SAP group

Furthermore, the treatment groups exhibited increased levels of SOD, CAT, and GSPx, whereas the level of MDA decreased in the intestinal tissues compared to that in the SAP group. SOD significantly increased, as did CAT and GSPx, and decreased MDA (Fig. 3f–3i). These results indicate that COS administration can enhance the antioxidant performance of the intestinal barrier in SAP rats.

COS Treatment Restored Intestinal Barrier Function

The plasma levels of intestinal barrier function indicators, namely, D-lactate (Fig. 4a) and DA (Fig. 4b), were lower in the COS treatment groups than in the SAP group. The reduction was more pronounced in the B group than in the other groups. E-cadherin (Fig. 4c) and ZO-1 (Fig. 4d) protein expression levels were greater in the COS treatment group than in the SAP group. These findings suggest that COS treatment restored intestinal barrier function in SAP rats.

Fig. 4.

Effects of COS on intestinal barrier function in SAP rats. (a) Plasma D-lactate levels in each group. (b) Plasma diamine oxidase (DAO) levels in each group. (c) Intestinal protein levels of E-cadherin and zonula occludens-1 (ZO-1) in each group. (d) Relative protein levels of E-cadherin were quantified relative to those of GAPDH. (e) Relative protein levels of ZO-1 were quantified relative to those of GAPDH. ^*P < 0.05 vs. the SAP group. ^#P < 0.01 vs. the SAP group

Effect of Oral Gavage of COS on the Intestinal Microbiota

Table 1 shows that the α (Shannon, Chao, and ACE) diversity indices were greater in the treatment group than in the SAP group. Both the Shannon and Chao1 species diversity indices were significantly greater in the A, B, C, and D groups than in the SAP group (P < 0.05), with the B group showing the greatest increase (P < 0.01). The species abundance index ACE was significantly greater in all the COS treatment groups than in the SAP group (P < 0.05), with the C group exhibiting the greatest increase (P < 0.01). Hierarchical clustering analysis using the Bray method was conducted to classify the bacterial communities in the SAP, A, and E groups, which resulted in clustering of these groups into one branch. Conversely, the B, C, and D groups were classified into another cluster (Fig. 5a). Principal coordinate analysis based on unweighted UniFrac distances yielded similar results (Fig. 5b). Linear discriminant analysis effect size (LEfSe) analysis was employed to identify altered bacteria. Our findings revealed significant changes in the composition of the intestinal microbiota from the phylum to the genus levels in the SAP and COS treatment groups (Fig. 5c). Notably, COS treatment enhanced the diversity of the intestinal microbial community in SAP rats.

Table 1.

The alpha diversity indexes of intestinal microflora determined by high-throughput sequencing

Groups	Shannon	Chao	ACE
A	6.30 ± 0.21*	2385.12 ± 165.41*	2472.02 ± 132.83*
B	6.72 ± 0.34#	2576.11 ± 197.12#	2581.82 ± 161.46*
C	6.41 ± 0.45*	2447.66 ± 121.09*	2620.86 ± 128.46#
D	5.68 ± 0.44*	2398.43 ± 107.51*	2483.11 ± 142.45*
E	5.01 ± 0.39	2277.81 ± 153.53	2334.51 ± 186.99*
SAP	4.95 ± 0.17	2227.21 ± 179.04	2286.40 ± 165.59

^*P < 0.05 vs. the SAP group and ^#P < 0.01 vs. the SAP group

Fig. 5.

Effects of COS on the intestinal microbiota in SAP rats. (a) Hierarchical clustering at the OTU level based on the Bray method. (b) Principal coordinate analysis of bacterial beta diversity based on unweighted UniFrac distance. (c) Cladogram of LEfSe for differentially abundant bacteria from the genus to the species level

The distribution of microorganisms at the genus level is depicted in Fig. 6a. The specific analysis of bacterial species revealed that the relative abundances of Alloprevotella, Blautia, Butyrimonas, and Coprococcus_2 (Fig. 6b–e) were higher in the COS treatment groups than in the SAP group. In addition, the relative abundances of Enterococcus, Escherichia-Shigella, Ruminococcus_1, and Rodentibacter (Fig. 6f–i) were lower in the COS treatment groups than those in the SAP group.

Fig. 6.

Effects of COS on the intestinal microbiota in SAP rats. (a) Relative abundances at the genus level for bacteria that exceeded 1% of the total bacteria. Comparison of the relative abundances of microorganisms at the genus level; (b) Alloprevotella; (c) Blautia; (d) Butyricimonas; (e) Coprococcus_2; (f) Enterococcus; (g) Escherichia–Shigella; (h) Ruminococcus_1; and (i) Rodentibacter. ^*P < 0.05 vs. the SAP group. ^#P < 0.01 vs. the SAP group. ^{^}P < 0.001 vs. the SAP group

COS Alleviates LPS-Induced Intestinal Inflammation by Inhibiting the NF-κB Signalling Pathway

An in vitro cell model of intestinal inflammation was prepared by incubating NCM460 cells with 200 μg/mL LPS for 48 h to reveal the effects of COS on intestinal inflammation. The NCM460 cells were then treated with different concentrations of COS (0.625, 2.5, and 10 mg/mL) for 24 h. The results showed that COS treatment was effective in alleviating the decrease in cell density caused by LPS and improving cell morphology (Fig. 7a). MTT colorimetric assay showed that COS treatment alleviated LPS-induced cell injury in a concentration-dependent manner (Fig. 7c), and effects of COS on LPS-induced NCM460 cells were detected. Flow cytometry (FCM) assay revealed that COS treatment suppressed the apoptosis of NCM460 cells caused by LPS in a concentration-dependent manner (Fig. 7b). The effect of COS on inflammation in the LPS-incubated NCM460 cells was examined. ELISA confirmed that COS treatment considerably reduced the levels of TNF-α and IL-6 in the LPS-induced NCM460 cells in a concentration-dependent manner (Fig. 7d). The levels of MDA and SOD, which can reflect the degree of oxidative stress, were measured to investigate the antioxidative stress effect of COS on the LPS-incubated NCM460 cells. The results revealed that the MDA levels decreased, and the SOD levels increased in a concentration-dependent manner in the LPS-incubated NCM460 cells after COS treatment (Fig. 7e). These results indicated that COS treatment alleviated cellular injury and reduced inflammation and oxidative stress in LPS-induced NCM460 cells. Subsequently, Western blot analysis results showed that COS treatment in the high-concentration group considerably reduced the expression of p-P65-P65 in the LPS-incubated NCM460 cells (Fig. 7f), indicating that COS treatment suppressed the NF-κB pathway in the LPS-treated NCM460 cells.

Fig. 7.

COS alleviates LPS-induced intestinal inflammation by inhibiting the NF-κB signalling pathway. (a) Effect of COS treatment on the cell number and cell morphology of LPS-induced NCM460 cells. (b) FCM assay showed the apoptosis of NCM460 cells with the indicated treatment; (c) MTT assay showed NCM460 cells’ viability with the indicated treatment. (d) ELISA showed the levels of TNF-α and IL-6 in NCM460 cells with the indicated treatment. (e) ELISA showed the levels of MDA and SOD in NCM460 cells with the indicated treatment. (f) Western blot assay showed the expression of p65 and the phosphorylation levels of p65 in NCM460 cells with the indicated treatment. Results are presented as the mean ± SD. LPS vs. control, ^#P < 0.05, ^##P < 0.01, and ^###P < 0.001. LPS + COS vs. LPS, ^*P < 0.05, ^**P < 0.01, and.^***P < 0.001

Discussion

This study examined the therapeutic effect of COS on sodium-taurocholate-induced SAP in rats from various perspectives. Our assessment of serum amylase and lipase levels, inflammatory markers, and histopathological findings in the pancreas demonstrated that compared with sterile water, COS administered intragastrically after 72 h at concentrations ranging from 2.5 to 5 mg/mL exhibited a more pronounced ability to regulate systemic infection in SAP patients. Additionally, COS ameliorated intestinal barrier injury, induced alterations in the intestinal microbiota, and maintained the intestinal microecology balance. Consequently, oral gavage of COS at a concentration of 2.5–5 mg/mL may hold promise for the treatment of SAP.

COS exhibits digestive stability in both fasting and diet modes, with no significant degradation observed in simulated digestive enzymes or extrusion behaviour during simulated digestion. In the diet mode, COS is expelled more rapidly through the upper gastrointestinal tract than in the fasting mode, resulting in a greater quantity of COS entering the colon [28, 29]. Furthermore, reproducible data from in vitro and in vivo animal studies have demonstrated that COS is well absorbed through the intestinal epithelium [30]. These findings confirm that COS can maintain stability in the upper gastrointestinal tract and exert its effects in the intestine, suggesting its potential use for the treatment of intestinal injury in SAP rat models through oral gavage.

Following the oral gavage of COS, we observed that COS treatment effectively restored the pathological changes associated with intestinal inflammation, enhanced the anti-inflammatory and antioxidant capacity of the intestinal tract, improved intestinal permeability, and restored the function of the intestinal barrier. For SAP-related rat models, comprehensive evaluations are conducted through blood and pathological examinations [31–33] without involving behavioural studies. Notably, the therapeutic effect of COS on the intestine and pancreas was most pronounced at concentrations ranging from 2.5 to 5 mg/mL. Previous studies on the preventive application of COS have also shown its beneficial effects on maintaining the physical integrity of the intestinal barrier, reducing intestinal permeability, and preventing bacterial translocation. These effects include reducing the number of necrotic intestinal epithelial cells and promoting the expression of intestinal tight junction proteins such as occludin and claudin-1 [17]. The previous research applied COS pre-treatment to the rats mainly for SAP prevention. In our study, COS was administered by gavage to the SAP rat model to explore this new treatment method and provide a research basis for the clinical application of COS. Our results further corroborate the therapeutic potential of COS in SAP. In light of the experimental findings on the recovery of intestinal barrier function following intragastric COS administration, we propose that the improvement in gut-derived infection may be one of the mechanisms underlying the therapeutic effects of COS in the treatment of SAP.

Numerous studies have confirmed that the intestinal microbiota can impact the progression of the systemic inflammatory response to SAP by influencing the biological, mechanical, and immune barriers of the intestine [34–36]. Consequently, the regulation of the intestinal microbiota may prove beneficial in reducing intestinal barrier injury during SAP. Prebiotics, which are dietary products that selectively promote the growth of probiotic strains, have been shown to have therapeutic benefits in SAP. These benefits include reducing the risk of organ failure and shortening hospital stays [37–40]. Additionally, the prebiotic COS has been reported to prevent SAP in rats through the regulation of the intestinal microbiota [11].

In our study, the abundance and biodiversity of the faecal flora in the COS treatment groups were significantly greater than those in the SAP group. These differences were especially pronounced in the groups treated with COS at concentrations ranging from 2.5 to 5 mg/mL. At both the phylum and genus levels, the composition of the intestinal microbiota in the COS treatment group exhibited significant changes. This finding aligns with a previous study that demonstrated significant differences in microbial community structure following treatment with COS of varying degrees of polymerisation [27]. These changes can be attributed to the spatial differences present within the COS. Our findings further emphasise that different concentrations of COS at the same degree of polymerisation have varying effects on the intestinal microflora in SAP rats. In this study, we employed 16S rRNA gene sequencing, which revealed greater species abundance indices and greater biodiversity of the faecal flora in the COS treatment groups, particularly in the 2.5–5 mg/mL COS treatment groups, than in the SAP treatment groups. These sequencing data also confirmed significant differences in the intestinal microbial community structure between the 1.25, 2.5, and 5 mg/mL COS treatment groups and both the SAP group and the 0.625 and 10 mg/mL COS treatment groups. These findings indicate that treatment with COS in the range of 2.5–5 mg/mL may increase the diversity of the intestinal microbiota in SAP rats and influence its composition.

Studies have confirmed that treatment with COS can modulate the composition of the intestinal microbiota by altering the abundances of Firmicutes, Bacteroides, Actinobacteria, and Proteobacteria and reducing the Firmicutes/Bacteroidetes ratio [41]. In the SAP mouse model pretreated with COS, the prophylactic application of COS significantly increased the abundances of norank_f_Muribaculaceae and Akkermansia taxa but caused a substantial decrease in the abundances of Desulfovibrio, Dubosiella, Enterococcus, and Escherichia–Shigella at the genus level [17]. Our study revealed that in the SAP mouse model, COS treatment increased the relative abundances of Alloprevotella, Blautia, Butyricimonas, and Coprococcus_2 but decreased the relative abundances of Enterococcus, Escherichia–Shigella, and Rodentibacter at the genus level. These results further support the experimental evidence for the regulatory effect of COS on the intestinal microbiota at the genus level. Additionally, we observed that the effect on bacteria was more noticeable in the 2.5–5 mg/mL COS treatment groups, suggesting that different concentrations of COS may have opposite effects on the same bacteria. This finding implies that the effects of COS concentrations may vary across different bacteria in the intestinal microbiota, and the 2.5–5 mg/mL range is a potential optimal concentration for clinical application.

In SAP rats, Alloprevotella and Blautia are reportedly suppressed [42–45]. Alloprevotella is a common producer of butyric acid and propionic acid [46]. Blautia can generate acetic acid using carbon dioxide, hydrogen, or formic acid [47]. Currently, there are only limited reports on the related effects of Butyricimonas and Coprococcus_2 in SAP rats. However, our findings indicate that COS treatment increased the relative abundance of these genera. Butyricimonas and Coprococcus_2 are capable of producing butyric acid. Acetic acid, butyric acid, and propionic acid are short-chain fatty acids (SCFAs). Moreover, as a prebiotic, COS promotes the production of abundant SCFAs, including acetate, propionate, and butyrate, through anaerobic fermentation in the intestine [18]. SCFAs serve as the primary energy source for intestinal epithelial cells and can enhance intestinal cross-epithelial cell resistance, thereby reducing intestinal mucosal permeability and reinforcing the function of the intestinal chemical barrier [35, 48]. Therefore, we speculate that oral gavage of 2.5–5 mg/mL COS facilitates the recovery of intestinal barrier injury in SAP rats, potentially due to the increase in SCFA levels. The increase in SCFAs stems not only from the increase in Alloprevotella, Blautia, Butyricimonas, and Coprococcus_2 but also from anaerobic fermentation. It is worth noting that PCoA analysis showed that the microbial community structure of the 10 mg/mL group clustered with the low-dose group (0.625 mg/mL) but separated from the 2.5–5 mg/mL group (Fig. 5b), suggesting that excessive concentrations may disrupt the microbial community balance. The diminished efficacy observed at the highest dose (10 mg/mL, Group A) may be attributable to factors such as altered osmotic load impacting gut function, potential dysbiosis at supraphysiological concentrations, or interference with normal fermentation processes.

Furthermore, our findings indicate that the concentrations of Enterococcus, Escherichia–Shigella, and Rodentibacter were inhibited by COS. The prevalence of Enterococcus and Escherichia–Shigella has been documented in numerous studies on SAP [49, 50]. Additionally, Enterococcus was positively correlated with serum IL-6 and plasma endotoxin [51]. Escherichia–Shigella has been associated with TLR4/MyD88/p38 MAPK and ERS signalling-induced intestinal epithelial injury, exacerbating acute necrotizing pancreatitis in rats [52]. Previously, it was speculated that the presence of Enterococcus and Escherichia–Shigella, which are abnormally increased in SAP, contributes to oxidative stress [17]. However, COS administration has been found to protect the intestinal barrier from oxidative stress by reducing the abundance of these genera. Our research further confirmed the inhibitory effect of intragastrically administered COS on Enterococcus, Escherichia–Shigella, and Rodentibacter. Notably, for the first time, we discovered that 5 mg/mL COS significantly decreased the abundance of Rodentibacter in SAP rats. Studies suggest that R. reuteri exacerbates the inflammatory response of the respiratory system by impacting the immune functions of Th1 and Th2 cells. Consequently, the inhibitory effect of COS on Rodentibacter may present a novel approach for managing SAP complicated by lung injury [53]. Consequently, our results demonstrate that COS effectively controls the deterioration of AP in rats. This effect can be attributed to its ability to inhibit the abundance of Enterococcus, Escherichia–Shigella, and Rodentibacter. This mechanism provides a valuable experimental foundation for the application of COS in the treatment of AP.

Previous studies have shown that COS has an inhibitory effect on the NF-κB pathway and that the development and progression of intestinal inflammation are associated with abnormal expression and activation of the NF-κB pathway [54–56]. Therefore, we speculate that the anti-inflammatory and antioxidant effects produced by COS in intestinal inflammation may be related to the modulation of the NF-κB signalling pathway. Firstly, an in vitro cell model of intestinal inflammation was prepared by incubating NCM460 cells with 200 μg/mL LPS for 48 h to investigate the effects of COS on intestinal inflammation. MTT and FCM showed a significant reduction in LPS-induced NCM460 cell damage in all three concentrations (high, medium and low) of the COS treatment. Furthermore, TNF-α, IL-6, and MDA levels were much lower in the COS-treated group than in the LPS group, and the SOD levels were much higher. The intensity of the effect depended on the concentration of COS. Notably, the differences among the COS high-concentration groups were highly significant. These results imply that COS treatment is effective in alleviating the level of inflammation and oxidative stress in NCM460 cells caused by LPS, which is in line with the results of previous studies [17, 57, 58]. Thus, our findings further confirm the inhibitory effect of COS on inflammation and oxidative stress levels.

The effects of the NF-κB pathway on the inflammation, apoptosis, and oxidative stress of NCM460 cells have been widely studied. For example, the NF-κB signalling pathway plays an important role in regulating the progression of inflammation by regulating the expression of proinflammatory and prosurvival genes to control immune responses and cell survival [59]. The inhibitory effects of COS on the NF-κB signalling pathway’s activity have been revealed using various inflammatory disease models, including animal and cellular models [60–62]. The disproportionate increase in activated p65 and the subsequent transactivation of effector molecules in the NF-κB signalling pathway are integral to the pathogenesis of intestinal inflammation [63]. Thus, we examined the expression of p-P65-P65 in LPS-induced NCM460 cells by Western blot assay after treatment with different COS concentrations. We observed that COS treatment in the high-concentration group significantly decreased the expression of p-P65-P65 in the LPS-treated NCM460 cells. Notably, the expression of p-P65-P65 was reduced in a concentration-dependent manner, implying that increased concentrations of COS within a certain range can enhance the therapeutic effect of COS on intestinal inflammation. On the basis of the aforementioned studies and results, we speculate that COS alleviates LPS-induced inflammatory and oxidative stress in intestinal inflammation by inhibiting the NF-κB signalling pathway.

A limitation of this study is the absence of a healthy, time-matched control group monitored throughout the full 72-h treatment period alongside the SAP groups. While the initial Sham control validated the model at 48 h, data on parameters like baseline intestinal microbiota composition or inflammatory markers over the extended period in healthy rats under identical housing and handling conditions are unavailable. This limits direct comparison of absolute values for some parameters measured at the 72 h endpoint in SAP rats. Future studies should incorporate such a control to provide a more comprehensive baseline. In addition, the sample size per group (n = 8) was based on established practice in comparable rodent SAP intervention studies and our preliminary data. However, a prospective power calculation was not performed, which is a limitation. Future confirmatory studies should utilise power calculations based on the effect sizes observed here.

Conclusion

In conclusion, our study confirmed that oral gavage of COS effectively ameliorates the severity of SAP induced by sodium taurocholate in rats. Based on our research data, we propose that 2.5–5 mg/mL COS has the potential to alleviate pancreatic and intestinal damage, reduce inflammation, and mitigate oxidative damage. Moreover, COS alleviates intestinal inflammation and oxidative stress by inhibiting the NF-κB signalling pathway. These beneficial effects may be attributed to the restoration of intestinal barrier injury and the amelioration of intestinal microbiota imbalance. Notably, these effects were more pronounced at concentrations of 2.5–5 mg/mL than at other concentrations of COS. Consequently, we suggest that COS may be used as a therapeutic drug or prebiotic in the treatment of SAP, particularly at concentrations of 2.5–5 mg/mL. COS ameliorated SAP severity in our rat model by restoring intestinal barrier function and microbiota balance, suggesting potential as a therapeutic agent for SAP, pending further clinical evaluation.

Supplementary Information.

Supplementary Information

Below is the link to the electronic supplementary material.

Author Contribution

Fanjun Meng: Conceptualization, Writing-Original Draft, Visualization, Supervision Guangchen Sun: Formal analysis, Methodology,Writing—Original Draft Yan Zhao: Validation Yayuan Luo: Formal analysis Yanou Bai: Data Curation Weiyan Lyu: Validation Hao Han: Visualization Xu Liu: Conceptualization, Resources, Writing—Original Draft, Writing—Review & Editing, Project administration, Funding acquisition All authors reviewed the manuscript.

Funding

The financial support for this study by the Science Foundation of Liaoning (grant no. 2019-MS-352) and the Science and Technology Foundation of Shenyang (grant no. 19–112-4–046).

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval

The ethics approval and consent to participate in the current study were approved and consented to by the ethics committee of Jiangsu KeyGEN BioTECH Corp., Ltd.

Consent for Publication

Not applicable.

Competing interests

The authors declare no competing interests.