Skip to main content
Journal of Orthopaedic Surgery and Research logoLink to Journal of Orthopaedic Surgery and Research
. 2026 Feb 17;21:214. doi: 10.1186/s13018-026-06715-5

FENDRR-mediated regulation of osteoclast differentiation through the miRNA-129-5p/P2X7R axis

Jia Chen 1,3, Huaxing Zhang 2, Yujie Jin 3, Fei Wang 1,✉
PMCID: PMC13014784  PMID: 41703627

Abstract

Objective

Osteoclast differentiation is a pivotal driver in the pathogenesis of bone-related disorders. This study aimed to elucidate the functional role of long non-coding RNA FENDRR.

Methodology

Functional validation was performed through both overexpression and knockdown of FENDRR. Osteoclast development and functionality were assessed using TRAP staining, ALP activity assays, and quantification of intracellular calcium levels. Inflammatory responses were evaluated by measuring cytokine production and examining key inflammasome components. Molecular interactions were further investigated via dual-luciferase reporter assays.

Results

Overexpression of FENDRR promoted osteoclast development and activation, enhanced inflammatory cytokine release, and activated the NF-κB signaling pathway along with the NLRP3 inflammasome. Conversely, FENDRR knockdown attenuated these effects. Mechanistically, miRNA-129-5p was identified as a downstream target of FENDRR, and its overexpression counteracted the pro-osteoclastogenic and pro-inflammatory effects of FENDRR. Furthermore, P2X7R, regulated by miRNA-129-5p, was demonstrated to be critically involved in mediating inflammatory responses in osteoclasts.

Conclusion

These findings suggest that FENDRR plays a significant role in the pathophysiology of osteoarthritis by promoting osteoclast development and activation, thereby exacerbating inflammatory cascades.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13018-026-06715-5.

Keywords: Osteoarthritis, Long non-coding RNA FENDRR, Osteoclast differentiation, Inflammatory response, miRNA-129-5p, P2X7 receptor

Introduction

Osteoarthritis (OA), a prevalent musculoskeletal disorder affecting predominantly the aging population, is characterized by progressive degradation of articular cartilage, osteophyte formation, subchondral bone damage, and synovial membrane inflammation. Its pathogenesis is multifactorial, encompassing elements such as chronic inflammation, oxidative stress, cellular senescence, obesity, sex-related factors, and genetic predisposition. For patients with advanced disease, total joint replacement remains the definitive therapeutic intervention, effectively alleviating pain and restoring functional mobility in affected joints[1]. Notably, knee osteoarthritis alone accounts for approximately 80% of the global OA burden [2]. Despite extensive investigation, the precise molecular mechanisms driving OA progression-particularly the contribution of inflammatory pathways-remain incompletely elucidated. Recent advances in high-throughput sequencing and related methodologies have significantly enriched our understanding of intracellular molecular changes across diverse cell types during OA development [3].

Pathologically, OA progression involves a dysregulation of physiological bone remodeling within the joint microenvironment. Heightened osteoclast activity leads to excessive bone resorption, thereby initiating or exacerbating abnormal remodeling processes-evident in the formation of osteophytes [4]. This excessive resorptive activity contributes to subchondral bone sclerosis, which in turn compromises joint stability and mobility. Osteoclasts secrete a range of cytokines and chemokines, including RANKL and TNF-α, which further amplify osteoclast recruitment and activation, creating a deleterious cycle that accelerates bone loss and joint deterioration [5]. In the context of joint implants, wear particle-induced osteolysis-driven largely by osteoclast activity-represents a major cause of prosthetic failure, underscoring the therapeutic potential of inhibiting osteoclast differentiation [6].

Emerging evidence highlights the critical regulatory roles of non-coding RNAs, including microRNAs, long non-coding RNAs, and circular RNAs in musculoskeletal disorders [7–11]. miRNAs, which function as post-transcriptional regulators of gene expression, have attracted attention due to their dysregulated expression in OA cartilage and detectability in biofluids, marking them as promising diagnostic or therapeutic targets [12, 13]. While miRNAs have been explored in other orthopedic contexts such as tendon repair, their diagnostic utility in OA awaits systematic validation through standardized approaches [13]. LncRNAs, defined as transcripts exceeding 200 nucleotides with little or no protein-coding capacity, are increasingly recognized as key modulators of gene expression in OA pathogenesis. One important mechanism involves their function as competitive endogenous RNAs, whereby lncRNAs act as molecular sponges that sequester miRNAs, thereby preventing miRNA-mediated repression of target mRNAs and leading to enhanced expression of those genes [14]. However, the specific interplay between lncRNAs and osteoclast biology in OA remains underexplored. For instance, lncRNA MALAT1 has been implicated in osteoporosis and bone metastasis [15], lncRNA DANCER modulates NFATC1 transcription in osteoclasts [16], and lncRNA H19 promotes osteoclast differentiation and bone regeneration [17].

Given that osteoclast differentiation is strictly controlled by the inflammatory microenvironment, we hypothesized that lncRNAs driving inflammation in other contexts might also regulate osteoclasts in OA. Through bioinformatic mining of the GSE213070 dataset and review of existing literature, we identified the lncRNA FENDRR as a novel candidate implicated in inflammatory aggravation. Prior studies indicate that FENDRR modulates ATG7-mediated autophagy during acute pancreatitis by interacting with the Polycomb Repressive Complex 2 [18], a condition linked to elevated sepsis risk [19]. Additionally, FENDRR protects NLRC4 from degradation by counteracting the E3 ubiquitin ligase HERC2, thereby accelerating microglial pyroptosis and intensifying neuroinflammation following cerebral ischemia [20].

To elucidate the downstream molecular mechanism, we utilized predictive tools (LncRNA SNP2 and AnnoLnc2) to analyze miRNA–mRNA interactions. We identified miRNA-129-5p as a direct target of FENDRR. Furthermore, among the downstream targets of miRNA-129-5p, we prioritized P2X7 receptor (P2X7R) for further validation. P2X7R was selected not only due to its high prediction scores but also because of its well-established role in driving NLRP3 inflammasome activation—a critical pathway in OA progression. Consequently, we hypothesized that FENDRR regulates osteoclast development and function via a novel FENDRR/miR-129-5p/P2X7R axis.

Experimental methods

Cell culture

RAW264.7 cell line was acquired from Wuhan Puhua Life Science Co., Ltd. Genetic constructs, including Vector, OE-FENDRR, si-NC, si-FENDRR, NC mimic, and micRNA-129-5p mimic plasmids were obtained from Suzhou Jima Biotechnology Co., Ltd. The A438079 compound was purchased from MCE, and M-CSF and RANKL reagents were procured from BiYunTian Biotechnology.

RNA extraction and real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR)

Total RNA was isolated from cellular samples using TRIzol reagent (R1100, Solarbio), followed by RNA quantification using a N50 Touch Spectrophotometer (Biospectrometer Basic, Eppendorf). cDNA synthesis for miRNA was carried out employing miRNA 1st Strand cDNA Synthesis Kit (KR211, TIANGEN), while mRNA and lncRNA underwent reverse transcription using PrimeScript™ RT Reagent Kit (with gDNA Eraser) (KR118, TIANGEN). Quantitative PCR analysis for miRNA was performed using the miRNA Universal SYBR® qPCR Master Mix (FP205, TIANGEN) with Sno202 as endogenous control. Parallel detection of lncRNA and mRNA employed TB Green™ Premix Ex Taq™ (FP205, TIANGEN), using GAPDH for normalization. The specific primer sequences are listed in Table 1, and the gene expression levels were quantified using the 2−ΔΔCt analytical approach.

Table 1.

The primer sequence for genes

Forward primer Reverse primer
FENDRR AAACGACAAGGCAGACCAAC AGCACCATTCCCACAATGTC
miR-129-5P CTTTTTGCGGTCTGGGCTTGC GTGCAGGGTCCGAGGT
P2X7R ATGTGGAAAAGCGGACGTTG TTTCCTCCAGTGCCGAAAAC

Enzyme-linked immunosorbent assay (ELISA)

50 μl of the diluted standard solution was added to the standard wells. For the sample wells, 40 μl of sample diluent was injected, followed by 10 μl of the sample to be tested. The mixture was gently mixed and incubated at 37 °C for 30 min. The liquid in the wells was discarded and the wells were dried with absorbent paper. The 30-fold diluted washing buffer was used to fully soak each well, shaken for 30 s, and pat dried again. This washing procedure was repeated five times to ensure thorough cleaning. Except for the blank well, 50 μl of the enzyme-labeled working solution was added to each well, mixed well, and incubated at 37 °C for 30 min. The washing and patting dry steps were repeated five times, and 50 μl of substrate A and 50 μl of substrate B were added to each well and incubated, at 37 °C in the dark for 10 min. Finally, 50 μl of stop solution was added to each well to terminate the reaction. An enzyme-linked immunosorbent assay reader was used to measure the absorbance of each well at 450 nm (zero with the blank well). Assays were conducted within 15 min after introducing the stop solution. Standard curves were established by plotting the TNF-α, IL-6, and IL-1β reference concentrations against their respective optical density measurements to derive the linear regression equation. Subsequently, the analyte levels in the experimental samples were quantified by applying the derived equation to their measured OD readings.

Alkaline phosphatase (ALP) content detection

A 100 μl of a 1 mM 4-MU standard solution was prepared by mixing 2 μl of 50 mM 4-MU with 98 μl of ALP Assay Buffer. Next, 0, 0.2, 0.5, 1, 2, 5, 10, and 20 μl of the 1 mM 4-MU standard solution were added to the standard wells of a 96-well plate, and filled to 20 μl with ALP Assay Buffer, resulting in 4-MU concentrations and amounts of 0, 10, 25, 50, 100, 250, 500, and 1000 μM or 0, 0.2, 0.5, 1, 2, 5, 10, 20 nmol, respectively. The Dilute Positive Control (100X) was 100-fold with ALP Assay Buffer, and 20 μl to a t96-well plate as a positive sample. For instance, 1 μl of Positive Control (100X) was diluted with 99 μl of ALP Assay Buffer, mixed, and 20 μl was added to the 96-well plate as a positive sample. Add 1–20 μl of the diluted samples were added to the sample wells of the 96-well plate; and filled to 20 μl with ALP Assay Buffer. The wells containing only ALP Assay Buffer were used as blank controls. Next, 80 μl of MUP Substrate working solution was added to all wells except the 4-MU standard curve wells, which received 80 μl of ALP Assay Buffer. The mixture was mixed well, and fluorescence detection was immediately performed using an appropriate microplate reader; with an excitation wavelength of 360 nm and an emission wavelength of 450 nm.

CCK8 assay

RAW264.7 cells were plated at a density of 2,000 cells per well in 96-well plates. After 0, 24, 48, and 72 h of culture, 10 μl CCK-8 solution (CA1210, Solarbio) was introduced into each well followed by 2-h incubation at 37 °C. The absorbance values were quantified at 450 nm using Varioskan LUX microplate reader (Thermo Fisher Scientific).

Tartrate-resistant acid phosphatase (TRAP) staining

Begin by removing the existing culture medium was removed from the 6-well plates, and each well was washed with 1 ml of PBS. The cells were fixed by adding 1 ml of pre-warmed 4% paraformaldehyde solution (maintained at ~ 37 °C) to each well, followed by a 25-min incubation at 37 °C. Three PBS washes were performed to remove the residual fixative. The staining mixture was prepared by combining 0.5 ml fast garnet GBC base solution with 0.5 ml sodium nitrite solution in a 1.5 ml microcentrifuge tube through gentle vortexing for 30 s, allowing 2 min for complete reaction at ambient temperature. The mixture was transferred to a light-protected 25 cm2 culture flask containing sequentially added 0.5 ml Naphthol AS-BI phosphate solution, 2 ml acetate buffer, and 1 ml tartrate solution, followed by thorough mixing and 5-min temperature equilibration at 37 °C. Next, 2 ml of this prepared solution was added to each well and incubated in the dark at 37 °C for 60 min. The process was concluded with triple ultrapure water rinses and complete air drying prior to microscopic analysis.

Transwell assay

Cellular migratory behavior was evaluated using Transwell chamber systems. RAW264.7 macrophages suspended in serum-free medium (200 μl) were seeded in the upper compartment, and chemoattractant medium containing fetal bovine serum was added to the lower chamber. Following 24-h culture conditions, membrane-traversing cells underwent sequential processing: PBS rinsing, 10-min fixation with 4% paraformaldehyde, and 5-min nuclear staining using 0.1% crystal violet. Quantitative analysis of cellular migration was conducted through microscopic enumeration using a Leica DM3000 LED inverted imaging system.

Actin ring detection

Vector, OE-FENDRR, NC mimic, and micRNA-129-5p mimic plasmids were introduced into RAW 264.7 cells, which were then plate at 103 cells/well in 96-well plates. Combined stimulation was administered using 100 ng/ml M-CSF and 100 ng/ml RANKL for 96 h. Following treatment, the cells were immersed in 10% formaldehyde fixative for 10 min, rinsed twice with PBS, and incubated with 50 µg/ml FITC-phalloidin under light-protected conditions for 1 h. After additional PBS washes, the nuclei were counterstained with DAPI for 5 min at ambient temperature. Fluorescence imaging was conducted using a Nikon inverted microscope system, specifically evaluating cellular specimens demonstrating fully formed ACTIN ring structures for quantitative analysis.

Intracellular calcium ion detection

Transfer the calibration references and experimental specimens into the designated microplate wells, ensuring that each well has a total volume of 50 µL. Subsequently, 90 µL of color development solution was added to each well, followed by 60 µL of calcium assay buffer. The mixture was gently agitated to ensure homogeneity before conducting a light-protected incubation at ambient temperature (20–25 °C) for 5–10 min. Optical density measurements were performed using a microplate spectrophotometer, specifically targeting a wavelength of 575 nm. Critical implementation note: Complete all measurements within a 30-min timeframe to ensure data accuracy.

Western blot

Cellular proteins were isolated using RIPA lysis buffer (P0013B, Beyotime), followed by protein quantification using a BCA assay kit (23,227, Thermo Fisher). Samples containing 20 μg of protein were electrophoresed on SDS-PAGE gels and subsequently transferred to PVDF membranes (IPVH00010, Millipore). Membranes underwent blocking before overnight incubation at 4 °C with primary antibodies targeting the following proteins: NLRP3 (ab263899, Abcam), ITGB3 (ab182773, Abcam), CTSK (ab300569, Abcam), TRAP (ab52750, Abcam), NFATC1 (ab2796, Abcam), P2X7R (ab307718, Abcam), phosphorylated NF-κB (ab76302, Abcam), total NF-κB (ab32536, Abcam), IL-1β (ab283818, Abcam), Caspase1 (ab207802, Abcam), Caspase11 (ab246496, Abcam), and GAPDH (ab181602, Abcam) as loading control. After washing, the membranes were exposed to secondary antibodies for 90 min at ambient temperature. Signal detection was performed using enhanced chemiluminescence reagents (MA0186, Meilunbio).

Statistical analysis

All experimental results are presented as mean ± standard deviation (SD). A minimum of three independent experimental replicates were performed for each condition. Statistical evaluations were performed using GraphPad Prism version 8.0. For multi-group comparisons, one-way ANOVA with Tukey’s post-hoc analysis was applied, whereas pairwise comparisons utilized Student’s t-test. Statistical significance was defined as a probability value below 0.05 (p < 0.05).

Results

LncRNA FENDRR enhances osteoclast differentiation and the development of actin rings in Raw264.7 cells, while having a minimal effect on cell proliferation

An interrogation of GEO database, specifically utilizing the dataset GSE213070, revealed a marked upregulation in the expression of the long non-coding RNA FENDRR in osteoarthritic tissues (Fig. 1A).

Fig. 1.

Fig. 1

LncRNA FENDRR fosters osteoclast differentiation and the genesis of the ACTIN RING within RAW264.7 cells in the context of osteoarthritis, yet it exerts minimal impact on cellular proliferation. A Analysis from GEO database (GSE213070) reveals a significant upregulation of FENDRR expression in OA group, with a marked difference compared to control group. B RT-PCR confirms the expression of OE-FENDRR and si-FENDRR in RAW264.7 cells. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. C CCK8 assay shows the proliferation capability of RAW264.7 cells between OE-FENDRR group and Vector group, as well as between si-FENDRR group and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. D TRAP staining indicates osteoclast differentiation in Vector group, OE-FENDRR group, si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. E FITC staining illustrates actin ring formation in the Vector group, OE-FENDRR group, si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3

To model osteoclastogenesis in vitro, RAW264.7 cells were cultured in the presence of 100 ng/mL M-CSF and 100 ng/mL RANKL, which reliably induced osteoclast formation by day 4. To delineate the functional role of FENDRR in osteoclast differentiation, both overexpression and knockdown constructs targeting FENDRR were transfected into RAW264.7 cells. Subsequent quantitative reverse transcription polymerase chain reaction analysis confirmed robust overexpression, with OE-FENDRR group demonstrating a greater than 23-fold elevation in FENDRR expression relative to the Vector control group. Conversely, si-FENDRR group exhibited a pronounced reduction, with expression diminished to approximately 0.4-fold compared to si-NC group (Fig. 1B).

CCK8 assays were conducted to assess the influence of FENDRR on the proliferation of RAW264.7 cells 24, 48, and 72 h post-transfection. The OD values at 450 nm did not differ significantly between OE-FENDRR and Vector or between si-FENDRR and si-NC. This indicates FENDRR does not significantly affect the growth capacity of RAW264.7 (Fig. 1C).

Further characterization employing TRAP staining revealed a significant increase in both the number and the total area of TRAP-positive multinucleated cells in the OE-FENDRR group relative to Vector group. Conversely, a marked reduction in these parameters was evident in si-FENDRR group when compared with si-NC group. Collectively, these findings substantiate that FENDRR significantly enhances osteoclast differentiation in RAW264.7 cells (Fig. 1D).

To assess the influence of FENDRR on cytoskeletal reorganization, a hallmark of mature osteoclast function, FITC-phalloidin staining was employed to visualize actin ring formation. Immunofluorescence analysis demonstrated a significantly elevated relative fluorescence intensity of actin rings in OE-FENDRR group compared to Vector group, whereas si-FENDRR group displayed diminished intensity relative to si-NC group. These observations suggest that FENDRR may facilitate osteoclast differentiation, at least in part, by promoting the assembly of functional actin rings (Fig. 1E).

By allowing calcium ions to flow into RAW264.7 cells and increasing the concentration of ALP inside the cells, FENDRR can increase the levels of osteoblast markers in these cells

To assess the extent of cellular damage associated with osteoarthritis, intracellular ALP activity and calcium levels were measured. OE-FENDRR group demonstrated a significant upregulation of ALP expression compared with Vector group. Conversely, ALP levels in si-FENDRR group were markedly reduced relative to si-NC group. These findings suggest that FENDRR may potentiate inflammatory responses mediated by osteoclasts (Fig. 2A). OE-FENDRR group had more calcium in their cells than Vector group, and si-FENDRR group had less calcium than si-NC group (Fig. 2B).

Fig. 2.

Fig. 2

FENDRR promotes osteoclast differentiation and function. A ALP expression and intracellular calcium levels in Vector group, OE-FENDRR group, si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. B Intracellular calcium levels in Vector group, OE-FENDRR group, si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. C Transwell assay demonstrates the migration capability of RAW264.7 cells in Vector group, OE-FENDRR group, si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. D Western blot analysis shows the protein expression levels of osteoclast markers (NFATC1, TRAP, ITGB3, CTSK) in RAW264.7 cells across Vector group, OE-FENDRR group, si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3

Transwell assays evaluated the impact of FENDRR on the migratory capacity of RAW264.7 cells, revealing a significant increase in crystal violet-positive cells in OE-FENDRR group compared to Vector group, and a decrease in si-FENDRR group relative to si-NC group. This indicates that FENDRR significantly enhanced the migratory ability of RAW264.7 cells (Fig. 2C).

To further examine the influence of FENDRR on osteoclastogenesis, both overexpression and knockdown plasmids of FENDRR were introduced into RAW 264.7 cells. Western blot analysis showed that the levels of NFATC1, TRAP, ITGB3, and CTSK proteins were much higher in OE-FENDRR group than in Vector group. In contrast, the levels of these proteins were much lower in si-FENDRR group than in si-NC group (Fig. 2D).

FENDRR can bind to miRNA-129-5p

In order to systematically identify downstream microRNAs regulated by FENDRR, we leveraged two established bioinformatics resources: lncRNA SNP2 database and the AnnoLnc2 platform. Through a comparative analysis across these datasets, we performed intersection-based validation to pinpoint potential FENDRR-associated microRNAs. Through an integrative bioinformatic and experimental strategy, miR-129-5p emerged as a prominent downstream target consistently identified by both computational prediction frameworks.

To investigate its regulatory interplay with FENDRR, RAW264.7 cells were transfected with Vector, OE-FENDRR, si-NC, or si-FENDRR constructs and subsequently stimulated with 100 ng/mL M-CSF and 100 ng/mL RANKL to induce osteoclast differentiation. RT-PCR analysis revealed a significant downregulation of miR-129-5p expression in OE-FENDRR group relative to Vector group (Fig. 3A & B). si-FENDRR group exhibited significantly higher miRNA-129-5p expression than si-NC group.

Fig. 3.

Fig. 3

FENDRR Regulates Osteoclast Activation Through Interaction with miRNA-129-5p. A miRNA-129-5p expression levels in RAW264.7 cells across Vector group, OE-FENDRR group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. B miRNA-129-5p expression levels in RAW264.7 cells across si-FENDRR group, and si-NC group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. C Dual-luciferase reporter assay confirms the binding between FENDRR and miRNA-129-5p. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3

To further validate the direct interaction between FENDRR and miR-129-5p, WT and MUT FENDRR reporter plasmids were constructed for dual-luciferase assays. The results demonstrated a specific association of FENDRR with miR-129-5p, evidenced by a significant reduction in luciferase activity in WT reporter group, thereby confirming a direct regulatory binding relationship (Fig. 3C).

Functional analysis of the FENDRR-miRNA-129-5p in osteoclast differentiation, calcium mobilization, and migration

To investigate the functional consequences of FENDRR/miR-129-5p axis, we constructed plasmids overexpressing miR-129-5p and co-transfected them into RAW264.7 cells. Four experimental groups were established: Vector, OE-FENDRR, OE-FENDRR + NC mimic, and OE-FENDRR + miR-129-5p mimic. CCK-8 assays indicated no statistically significant alterations in RAW264.7 cell viability across the groups, with no notable differences between the OE-FENDRR and Vector group, or between the OE-FENDRR + miR-129-5p mimic and OE-FENDRR + NC mimic group. These data suggest that FENDRR/miR-129-5p regulatory axis does not exert a substantial effect on RAW264.7 cell proliferation (Fig. 4A).

Fig. 4.

Fig. 4

FENDRR Modulates Osteoclast Function via miRNA-129-5p. A CCK8 assay reveals changes in cell viability in RAW264.7 cells among Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. B TRAP staining shows osteoclast differentiation levels in Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. C Colorimetric assay indicates ALP activity in Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. D Calcium ion detection assay reveals intracellular calcium ion concentrations in osteoclasts across Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. E Transwell assay displays osteoclast migration status among Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. F Western blot analysis shows the regulation of osteoclast markers (NFATC1, TRAP, ITGB3, CTSK) protein expression levels across the Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3

To determine whether FENDRR modulates osteoclast differentiation through miR‑129‑5p, TRAP staining was performed. The results revealed a significant increase in the number of TRAP‑positive multinucleated cells in OE‑FENDRR group compared to Vector. In contrast, OE‑FENDRR + miR‑129‑5p mimic group exhibited a pronounced reduction in TRAP‑positive cells relative to OE‑FENDRR + NC mimic group. This demonstrates that FENDRR promotes osteoclast differentiation in a miR‑129‑5p‑dependent manner (Fig. 4B).

Furthermore, to assess the influence of FENDRR on ALP activity via miR-129-5p, colorimetric analysis was conducted. ALP levels were markedly elevated in OE-FENDRR group compared to Vector group, whereas a significant decrease was observed in OE-FENDRR + miR-129-5p mimic group relative to OE-FENDRR + NC mimic group. These findings indicate that FENDRR enhances ALP activity during osteoclast differentiation through miR-129-5p (Fig. 4C).

Calcium ion detection assays further demonstrated a substantial rise in intracellular calcium concentration in OE‑FENDRR group versus Vector group. This effect was notably attenuated in OE‑FENDRR + miR‑129‑5p mimic group compared to NC mimic group, confirming that FENDRR regulates calcium homeostasis in osteoclasts via miR‑129‑5p (Fig. 4D).

Cell migration capacity was evaluated using Transwell assays. OE-FENDRR group displayed significantly enhanced migratory activity compared to Vector group. Conversely, OE-FENDRR + miR-129-5p mimic group showed a marked reduction in the number of migrated cells relative to OE-FENDRR + NC mimic group, supporting the role of FENDRR in promoting osteoclast migration through miR-129-5p (Fig. 4E).

Finally, Western blot analysis was performed to examine key osteoclast‑related proteins. Protein expression levels of NFATC1, TRAP, ITGB3, and CTSK were significantly upregulated in OE‑FENDRR group compared to Vector group. In contrast, these levels were substantially downregulated in OE‑FENDRR + miR‑129‑5p mimic group relative to the OE‑FENDRR + NC mimic group. These results collectively indicate that FENDRR orchestrates osteoclast activation and function via regulation of miR‑129‑5p (Fig. 4F).

miRNA-129-5p modulates calcium ion-mediated inflammasome formation and the inflammatory response elicited by osteoclasts through P2X7R

To elucidate the regulatory influence of FENDRR and miRNA-129-5p on P2X7R expression in osteoclasts, RT-PCR was performed. The results demonstrated a significant upregulation of P2X7R mRNA expression in OE-FENDRR group relative to Vector group, whereas a pronounced downregulation was observed in OE-FENDRR + miRNA-129-5p mimic group compared to OE-FENDRR + NC mimic group. These data indicate that FENDRR governs P2X7R transcript levels through miRNA-129-5p-mediated regulation (Fig. 5A).

Fig. 5.

Fig. 5

miRNA-129-5p Modulates Inflammatory Response in Osteoclasts Through P2X7R. A RT-PCR results indicate P2X7R mRNA expression levels across Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, and OE-FENDRR + miRNA-129-5p mimic group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. B & C Dual-luciferase reporter assay confirms the binding between P2X7R and miRNA-129-5p. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. D Western blot analysis explores the impact on osteoclast markers (NFATC1, TRAP, ITGB3, CTSK) protein expression levels across Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, OE-FENDRR + miRNA-129-5p mimic group, OE-FENDRR + NC mimic + oxATP group, and OE-FENDRR + miRNA-129-5p mimic + oxATP group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3. E ELISA assesses the inflammatory markers TNFα, IL-6, and IL-1β induced by osteoclasts across Vector group, OE-FENDRR group, OE-FENDRR + NC mimic group, OE-FENDRR + miRNA-129-5p mimic group, OE-FENDRR + NC mimic + oxATP group, and OE-FENDRR + miRNA-129-5p mimic + oxATP group. Statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001. n = 3

To examine the direct interaction between miRNA‑129‑5p and P2X7R, dual‑luciferase reporter assays were conducted using WT and MUT P2X7R. The assays confirmed a specific molecular association between miRNA‑129‑5p and P2X7R, evidenced by a significant reduction in luciferase activity upon miRNA‑129‑5p binding (Fig. 5B & C).

To further delineate the role of FENDRR/miRNA-129-5p/P2X7R axis in inflammatory signaling under osteoclast-enhanced conditions, key proteins of classical inflammatory pathways were assessed. Western blot analysis revealed a marked elevation in the expression of phosphorylated NF-κB, NLRP3, IL-1β, Caspase-1, and Caspase-11 in OE-P2X7R group compared to Vector group. Conversely, these protein levels were significantly attenuated in the OE-FENDRR + miRNA-129-5p mimic group relative to the OE-FENDRR + NC mimic group. Subsequent administration of P2X7R inhibitor oxATP to both OE-FENDRR + NC mimic and OE-FENDRR + miRNA-129-5p mimic groups led to a further decrease in the expression of these inflammatory mediators in the OE-FENDRR + miRNA-129-5p mimic group; however, the observed reduction did not reach statistical significance (Fig. 5D).

Additionally, the secretion levels of pro‑inflammatory cytokines, including TNF‑α, IL‑6, and IL‑1β, were substantially increased in OE‑FENDRR group compared to the Vector group, and were significantly suppressed in the OE‑FENDRR + miRNA‑129‑5p mimic group relative to the OE‑FENDRR + NC mimic group. Treatment with the P2X7R inhibitor oxATP further diminished cytokine release in OE‑FENDRR + miRNA‑129‑5p mimic group, although this incremental decrease was not statistically significant (Fig. 5E).

Discussion

Osteoarthritis (OA) represents the most common form of joint disease, affecting nearly all articular structures, with a predominant impact on the hands, knees, hips, and feet. The pathogenesis involves pathological alterations across multiple joint tissues, including cartilage, bone, synovium, ligaments, muscles, and adjacent adipose tissue. These changes collectively contribute to joint dysfunction, manifesting as chronic pain, stiffness, restricted mobility, and diminished capacity for daily activities [21]. While knee arthroplasty remains a cornerstone surgical intervention for end-stage OA [22], identifying early molecular drivers of disease progression is critical for developing non-surgical therapies.

Osteoclasts are essential for bone resorption, a process intricately regulated by non-coding RNAs (ncRNAs) [23–26]. Dysregulated osteoclast activity disrupts subchondral bone remodeling, a key driver of osteoarthritis (OA) pathogenesis [27]. Furthermore, osteoclast-derived exosomes and microenvironmental factors contribute to disease advancement by impairing matrix integrity [28]. Crucially, the NF-κB pathway and NLRP3-mediated pyroptosis are central to OA progression. For instance, miR-204-5p protects against degeneration via the SSRP1/NF-κB axis [29], while excessive pyroptosis creates a deleterious feedback loop exacerbating inflammation [30]. Building on these mechanisms, our study reveals that FENDRR directly enhances osteoclast pyroptosis and activation. By upregulating P2X7R, FENDRR elevates intracellular calcium levels and drives pro-inflammatory cytokine secretion. This FENDRR-mediated disruption of osteoclast homeostasis likely accelerates pathological bone remodeling in OA.

Our findings align with FENDRR’s diverse regulatory roles in other pathologies. FENDRR facilitates VEGFA-related apoptosis in hypertension [31]; in OA, the FENDRR-induced inflammatory milieu likely upregulates VEGFA, promoting pathological angiogenesis and bone resorption. FENDRR also downregulates p53 [32] and β-catenin [33] in other cell types. In the bone microenvironment, p53 suppression may remove the brake on NLRP3 inflammasome activation, while β-catenin downregulation could indirectly enhance osteoclastogenesis by elevating the RANKL/OPG ratio. Distinct from the m6A-mediated pyroptosis observed in pulmonary endothelial cells [34], our study indicates FENDRR drives osteoclast pyroptosis primarily through inflammatory and ionic dysregulation. Furthermore, FENDRR regulates endothelial dysfunction via the miR-423-5p/Nox4 axis [35] and promotes Nrf2 degradation [36], suggesting it exacerbates oxidative stress in osteoclasts through calcium-ROS feedback loops and antioxidant inhibition. Finally, FENDRR modulates mitochondrial metabolism [37] and regulates macrophage M1 polarization [38]. Our data implies a reciprocal mechanism where FENDRR reinforces the pro-inflammatory M1 phenotype, creating a vicious cycle that sustains osteoclast differentiation and inflammation.

miR-129-5p serves as a critical negative regulator of inflammation and pathology in various contexts. It modulates endothelial injury via the FGF2 axis [39], potentially influencing OA-related angiogenesis. Furthermore, miR-129-5p mitigates spinal cord injury by inhibiting inflammatory signaling [40] and prevents renal tubular apoptosis by counteracting Neat1 [41]. Notably, while it promotes osteogenesis via the PKA/β-catenin pathway [42], our study reveals its distinct role in suppressing osteoclastogenesis. We demonstrate that FENDRR sponges miR-129-5p, thereby relieving the repression of its downstream target, P2X7R.

P2X7R is a key driver of calcium-mediated inflammation. Its activation is implicated in Th17/NLRP3-mediated arthritis [43] and neuroinflammation [44]. Crucially, P2X7R drives cartilage degradation and pyroptosis in OA via NF-κB/NLRP3 crosstalk [45], providing a strong rationale for investigating this target. In our study, FENDRR-mediated upregulation of P2X7R triggered massive calcium influx, activating the NF-κB and NLRP3 pathways. This axis exacerbates OA pathology by promoting osteoclast maturation, migration, and the secretion of pro-inflammatory cytokines (TNF-α, IL-6, IL-1β).

However, this study has limitations. First, the specific contributions of other FENDRR-regulated pathways warrant further investigation. Second, while P2X7R inhibition showed promise in vitro, its efficacy in preventing bone destruction requires rigorous in vivo verification. Crucially, our experiments relied on the murine RAW264.7 cell line. Although widely used, this immortalized line cannot fully replicate the species-specific characteristics, phenotypic heterogeneity, or complex multicellular crosstalk (involving chondrocytes and synovial cells) found in primary human osteoclasts and the OA joint microenvironment. Future studies utilizing primary bone marrow-derived macrophages (BMMs) and in vivo OA models are essential to validate these findings.

In summary, FENDRR exacerbates OA pathology by driving osteoclast differentiation and pyroptotic inflammation via the miRNA-129-5p/P2X7R axis. These findings highlight the therapeutic potential of targeting this non-coding RNA network to mitigate subchondral bone destruction in osteoarthritis.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (40.5MB, zip)

Acknowledgements

Not Applicable.

Author contributions

CJ and FW designed the research study. CJ and HXZ performed the research. CJ, HXZ and YJJ analyzed the data. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.

Funding

None.

Data availability

The data used to support the findings of this study are available from the corresponding author upon request.

Declarations

Ethics approval and consent to participate

The study followed the principles outlined in the Declaration of Helsinki. Ethical approval was not required for the study involving humans in accordance with the local legislation requirements (“Ethical Review Measures for Human Life Sciences and Medical Research” (2023)). Written informed consent to participate in this study was not required from the participants or the participants’ legal guardians/next of kin in accordance with the national legislation requirements (“Ethical Review Measures for Human Life Sciences and Medical Research”(2023)).

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Wilczyński M, Bieniek MA-O, Krakowski PA-O, Karpiński RA-O. Cemented vs. cementless fixation in primary knee replacement: a narrative review. Materials. 2024;17(5):1136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gupta N, Arora A, Kanwar N, Khatri K, Kanwal A. Serum Sirt6 as a potential biomarker for osteoarthritis and its correlation with IL-6 alterations. Indian J Orthop. 2024;58(9):1254–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Qiao L, Gu J, Ni Y, et al. RNA-Seq reveals the mRNAs, miRNAs, and lncRNAs expression profile of knee joint synovial tissue in osteoarthritis patients. J Clin Med. 2023;12(4):1449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sagar DR, Ashraf S, Xu L, et al. Osteoprotegerin reduces the development of pain behaviour and joint pathology in a model of osteoarthritis. Ann Rheum Dis. 2014;73(8):1558–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Doi K, Murata KA-O, Ito S, et al. Role of lysine-specific demethylase 1 in metabolically integrating osteoclast differentiation and inflammatory bone resorption through hypoxia-inducible factor 1α and E2F1. Arthritis Rheumatol. 2022;74(6):948–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gao X, Ge J, Zhou W, Xu L, Geng D. IL-10 inhibits osteoclast differentiation and osteolysis through MEG3/IRF8 pathway. Cell Signal. 2022;95:110353. 10.1016/j.cellsig.2022.110353. [DOI] [PubMed] [Google Scholar]
  • 7.Gargano G, Oliviero A, Oliva F, Maffulli N. Small interfering RNAs in tendon homeostasis. Br Med Bull. 2021;138(1):58–67. [DOI] [PubMed] [Google Scholar]
  • 8.Gargano G, Asparago G, Spiezia F, Oliva F, Maffulli N. Small interfering RNAs in the management of human osteoporosis. Br Med Bull. 2023;148(1):58–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gargano G, Oliva F, Oliviero A, Maffulli N. Small interfering RNAs in the management of human rheumatoid arthritis. Br Med Bull. 2022;142(1):34–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gargano G, Pagano SM, Maffulli N. Circular RNAs in the management of human osteoporosis. Br Med Bull. 2025;153(1):ldae024. 10.1093/bmb/ldae024. [DOI] [PubMed] [Google Scholar]
  • 11.Yang X, Yin P, Yao X, Zhang J. Micrornas in the diagnosis of osteoarthritis: a systematic review and meta-analysis of observational studies. J Orthop Surg Res. 2025;20(1):654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Oliviero A, Della Porta G, Peretti GM, Maffulli N. Microrna in osteoarthritis: physiopathology, diagnosis and therapeutic challenge. Br Med Bull. 2019;130(1):137–47. [DOI] [PubMed] [Google Scholar]
  • 13.Giordano L, Porta GD, Peretti GM, Maffulli N. Therapeutic potential of microrna in tendon injuries. Br Med Bull. 2020;133(1):79–94. [DOI] [PubMed] [Google Scholar]
  • 14.Wang R, Shiu HT, Lee WYW. Emerging role of lncRNAs in osteoarthritis: an updated review. Front Immunol. 2022;13:982773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhao YA-O, Ning J, Teng H, et al. Long noncoding RNA Malat1 protects against osteoporosis and bone metastasis. Nat Commun. 2024;15(1):2384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhang Z, Meng Y, Lin T, Zhang Z, Tao Z, Yin H, et al. Dancr-BRG1 regulates Nfatc1 transcription and Pgc1β-dependent metabolic shifts in osteoclastogenesis. Proc Nat Acad Sci. 2024;121(5):e23136c56121. 10.1073/pnas.2313656121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhou Z, Hossain MS, Liu DA-O. Involvement of the long noncoding RNA H19 in osteogenic differentiation and bone regeneration. Stem Cell Res Ther. 2021;12(1):74. 10.1186/s13287-13021-02149-13284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhao SP, Yu C, Yang MS, et al. Long non-coding RNA FENDRR modulates autophagy through epigenetic suppression of ATG7 via binding PRC2 in acute pancreatitis. Inflammation. 2021;44(3):999–1013. [DOI] [PubMed] [Google Scholar]
  • 19.Cheng L, Nan C, Kang L, Zhang N, Liu S, Chen H, et al. Whole blood transcriptomic investigation identifies long non-coding RNAs as regulators in sepsis. J Transl Med. 2020;18(1):217. 10.1186/s12967-12020-02372-12962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang LQ, Zheng YY, Zhou HJ, et al. LncRNA-Fendrr protects against the ubiquitination and degradation of NLRC4 protein through HERC2 to regulate the pyroptosis of microglia. Mol Med. 2021;27(1):39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Walton TJ, Chatterton ALD, Goodwin VA. Hip and knee replacement in lower limb amputees: a scoping review. BMC Musculoskelet Disord. 2024;25(1):239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Evans JT, Walker RW, Evans JP, et al. How long does a knee replacement last? A systematic review and meta-analysis of case series and national registry reports with more than 15 years of follow-up. Lancet. 2019;393(10172):655–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li Y, Ye S, Han Z, Wei C, Huang Y. LncRNA CRNDE ameliorates bone fracture by regulating cell viability and apoptosis of osteoblasts. J Orthop Surg Res. 2025;20(1):521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li F, Tan H, Zhang X, et al. LncRNA HCG18 regulates the progression of spinal tuberculosis by modulating the hsa-miR-146a-5p/TGF-β1/SMADs pathway. J Orthop Surg Res. 2025;20(1):484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liu X, Zhang X, Cen M. Dysregulation of miR-106a-5p/PTEN axis associated with progression and diagnostic of postmenopausal osteoporosis. J Orthop Surg Res. 2025;20(1):456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yang X, Jin Q, Guo L. Mir-217 participates in the progression of postmenopausal osteoporosis by regulating the OPG/RANKL/RANK pathway. J Orthop Surg Res. 2025;20(1):600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Duan LA-O, Liang Y, Xu X, et al. Noncoding RNAs in subchondral bone osteoclast function and their therapeutic potential for osteoarthritis. Arthritis Res Ther. 2020;22(1):279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Liu JA-O, Wu X, Lu JA-O, et al. Exosomal transfer of osteoclast-derived miRNAs to chondrocytes contributes to osteoarthritis progression. Nat Aging. 2021;1(4):368–84. [DOI] [PubMed] [Google Scholar]
  • 29.Zhao C, Li Q, Shen C. Therapeutic potential of miR-204-5p in intervertebral disc degeneration: targeting the SSRP1/NF-κB pathway to inhibit apoptosis. J Orthop Surg Res. 2025;20(1):586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zheng X, Qiu J, Gao N, et al. Paroxetine Attenuates Chondrocyte Pyroptosis and Inhibits Osteoclast Formation by Inhibiting NF-κB Pathway Activation to Delay Osteoarthritis Progression. Drug Des Devel Ther. 2023;17:2383–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Dong B, Zhou B, Sun Z, Huang S, Han L, Nie H, et al. Lnc RNA-FENDRR mediates VEGFA to promote the apoptosis of brain microvascular endothelial cells via regulating miR-126 in mice with hypertensive intracerebral hemorrhage. Microcirculation. 2018;25(8):e12499. 10.11111/micc.12499. [DOI] [PubMed] [Google Scholar]
  • 32.Li X, Ni L, Wang W, Zong L, Yao BA-O. LncRNA Fendrr inhibits hypoxia/reoxygenation-induced cardiomyocyte apoptosis by downregulating p53 expression. J Pharm Pharmacol. 2020;72(9):1211–20. [DOI] [PubMed] [Google Scholar]
  • 33.Senavirathna LK, Liang Y, Huang C, et al. Long noncoding RNA FENDRR inhibits lung fibroblast proliferation via a reduction of β-catenin. Int J Mol Sci. 2021;22(16):8536. 10.3390/ijms22168536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang X, Li Q, He S, et al. LncRNA FENDRR with m6A RNA methylation regulates hypoxia-induced pulmonary artery endothelial cell pyroptosis by mediating DRP1 DNA methylation. Mol Med. 2022;28(1):126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhao X, Wang C, Liu M, Meng F, Liu K. LncRNA FENDRR servers as a possible marker of essential hypertension and regulates human umbilical vein endothelial cells dysfunction via miR-423-5p/Nox4 axis. Int J Gen Med. 2022;15:2529–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liu Y, Liu Y, Wang J, et al. LncRNA FENDRR promotes apoptosis of Leydig cells in late-onset hypogonadism by facilitating the degradation of Nrf2. Cell Tissue Res. 2021;386(2):379–89. [DOI] [PubMed] [Google Scholar]
  • 37.Wang G, Yang Y, Ma H, et al. LncRNA FENDRR inhibits ox-LDL induced mitochondrial energy metabolism disorder in aortic endothelial cells via miR-18a-5p/PGC-1α signaling pathway. Front Endocrinol (Lausanne). 2021;12:622665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Munteanu MC, Huang C, Liang Y, et al. Long non-coding RNA FENDRR regulates IFNγ-induced M1 phenotype in macrophages. Sci Rep. 2020;10(1):13672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Li J, Wang M, Wu X, et al. miR-129-5p/FGF2 axis is associated with homocysteine-induced human umbilical vein endothelial cell injury. Comb Chem High Throughput Screen. 2024;27(4):641–8. [DOI] [PubMed] [Google Scholar]
  • 40.Huang X, Hou X, Chuan L, et al. miR-129-5p alleviates LPS-induced acute kidney injury via targeting HMGB1/TLRs/NF-kappaB pathway. Int Immunopharmacol. 2020;89(Pt A):107016. [DOI] [PubMed] [Google Scholar]
  • 41.Ma T, Li H, Liu H, et al. Neat1 promotes acute kidney injury to chronic kidney disease by facilitating tubular epithelial cells apoptosis via sequestering miR-129-5p. Mol Ther. 2022;30(10):3313–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Deng LA-O, Li X, Ren X, et al. A grooved porous hydroxyapatite scaffold induces osteogenic differentiation via regulation of PKA activity by upregulating miR-129-5p expression. J Periodontal Res. 2022;57(6):1238–55. [DOI] [PubMed] [Google Scholar]
  • 43.Pan Y, Wu Y, Liu Y, et al. Long non-coding RNA ENSMUST00000197208 promotes a shift in the Th17/Treg ratio via the P2X7R-NLRP3 inflammasome axis in collagen-induced arthritis. Immunol Res. 2024;72(2):347–60. [DOI] [PubMed] [Google Scholar]
  • 44.Li T, Li Y, Chen J, et al. Hyperibone J exerts antidepressant effects by targeting ADK to inhibit microglial P2X7R/TLR4-mediated neuroinflammation. J Adv Res. 2025;72:571–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Li ZA-O, Huang Z, Zhang H, et al. P2X7 receptor induces pyroptotic inflammation and cartilage degradation in osteoarthritis via NF-κB/NLRP3 crosstalk. Oxid Med Cell Longev. 2021;2021:8868361. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (40.5MB, zip)

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.


Articles from Journal of Orthopaedic Surgery and Research are provided here courtesy of BMC

RESOURCES