Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2022 Jan 12;163(3):bqab269. doi: 10.1210/endocr/bqab269

Human INHBB Gene Variant (c.1079T>C:p.Met360Thr) Alters Testis Germ Cell Content, but Does Not Impact Fertility in Mice

Brendan J Houston 1,2, Anne E O’Connor 3,4, Degang Wang 5,6, Georgia Goodchild 7, D Jo Merriner 8, Haitong Luan 9, Don F Conrad 10,11, Liina Nagirnaja 12,13, Kenneth I Aston 14,15, Sabine Kliesch 16, Margot J Wyrwoll 17, Corinna Friedrich 18, Frank Tüttelmann 19, Craig Harrison 20, Moira K O’Bryan 21,22,✉, Kelly Walton 23,✉
PMCID: PMC13016639  PMID: 35022746

Abstract

Testicular-derived inhibin B (α/β B dimers) acts in an endocrine manner to suppress pituitary production of follicle-stimulating hormone (FSH), by blocking the actions of activins (β A/B/β A/B dimers). Previously, we identified a homozygous genetic variant (c.1079T>C:p.Met360Thr) arising from uniparental disomy of chromosome 2 in the INHBB gene (β B-subunit of inhibin B and activin B) in a man suffering from infertility (azoospermia). In this study, we aimed to test the causality of the p.Met360Thr variant in INHBB and testis function. Here, we used CRISPR/Cas9 technology to generate InhbbM364T/M364T mice, where mouse INHBB p.Met364 corresponds with human p.Met360. Surprisingly, we found that the testes of male InhbbM364T/M364T mutant mice were significantly larger compared with those of aged-matched wildtype littermates at 12 and 24 weeks of age. This was attributed to a significant increase in Sertoli cell and round spermatid number and, consequently, seminiferous tubule area in InhbbM364T/M364T males compared to wildtype males. Despite this testis phenotype, male InhbbM364T/M364T mutant mice retained normal fertility. Serum hormone analyses, however, indicated that the InhbbM364T variant resulted in reduced circulating levels of activin B but did not affect FSH production. We also examined the effect of this p.Met360Thr and an additional INHBB variant (c.314C>T: p.Thr105Met) found in another infertile man on inhibin B and activin B in vitro biosynthesis. We found that both INHBB variants resulted in a significant disruption to activin B in vitro biosynthesis. Together, this analysis supports that INHBB variants that limit activin B production have consequences for testis composition in males.

Keywords: inhibin, activin, follicle stimulating hormone, spermatogenesis, testis, male fertility

As much as 90% of testis volume in adult males is contributed by the seminiferous tubules. Within the tubules, immature germ cells, spermatogonia, are found along the basement membrane where they proceed through mitosis to form spermatocytes, which undergo meiosis. Haploid germ cells (spermatids) produced from this process then undergo a dramatic morphological transformation in a series of processes collectively known as spermiogenesis, before being released as sperm into the excurrent ductal system. Germ cell development is supported by Sertoli cells, which envelop germ cells and facilitate differentiation and migration toward the lumen. Data suggest that Sertoli cells support a finite number of germs cells through spermatogenesis. As such, Sertoli cell numbers ultimately influence sperm output by the testes (1). Progression of immature spermatogonia through the various phases of spermatogenesis is coordinated by both locally derived testicular hormones and growth factors (eg, androgens, inhibin B, activin A, activin B) and pituitary hormones [eg, luteinizing hormone and follicle stimulating hormone (FSH)]. Consequently, hormonal imbalances, or changes to cellular responsiveness in either the pituitary or the testes can cause disruptions to sperm production or function, and male fertility.

One of the major hormonal circuits that coordinates spermatogenesis is the hypothalamic-pituitary-gonadal (HPG) axis. Within the pituitary, activin A/B (β A/B/β A/B dimers) bind to type I (ALK4) and type II (ActRIIA/IIB) receptors on the surface of gonadotrope cells, which leads to phosphorylation of SMAD2/3 proteins and transcriptional activation of the FSHβ subunit gene (FSHB) (2). In response to FSH, the gonads produce inhibin A and inhibin B (α/β A/B-heterodimers), which, in the presence of coreceptors betaglycan (3) or TGFβ receptor type III-like (4), respectively, form an inert receptor complex with ActRIIA/B (5,6). This effectively blunts activin A/B-mediated receptor binding and activation of FSHB synthesis.

FSH binds to target receptors on Sertoli cells to stimulate germ cell development and acts indirectly to increase androgen production by Leydig cells within the intertubular space (7). Although FSH is not absolutely essential for male fertility in the mouse (8), it is important for quantitatively normal spermatogenesis, and loss of FSH activity is associated with reduced testis weights, reduced Sertoli cell numbers, and altered ratios of developing germ cells (8-11). Independent of FSH, activin A/B promote Sertoli cell proliferation during the perinatal (adolescent) period (12), and unrestrained activin A/B activity triggers Sertoli cell tumors in the mouse (13). Conversely, loss of activin A/B-responsiveness in the mouse results in reduced testis weights, potential loss of Sertoli cells, and delayed puberty onset (14). While inhibin B and activin B are not critical for male fertility in the mouse (15), like FSH they are important for normal testis function. Indeed, evidence supports that elevated levels of inhibin B negatively impact testis size and sperm production in mice (16-18).

Several human studies have identified associations between perturbations to the HPG axis and disrupted male fertility. Point variants within the FSH β-subunit or FSH receptor have been linked to delayed puberty onset, hypogonadism, and defective spermatogenesis (19-22). Although definitive evidence linking genetic aberrations in the INHBB and INHA genes and male in/subfertility is lacking, 1 study identified an association between variants within the INHA promoter region in male infertility patients (23). Clinically, low inhibin/activin B serum concentrations are reliable indicators of diminished testis function in humans. In sub/infertile men, serum activin B (24) and inhibin B (25) levels are significantly reduced, and FSH is elevated [(25; also reviewed in (26)]. Thus, circulating concentrations of inhibin/activin B are important biomarkers of Sertoli cell competence and spermatogenesis in men.

In a recent study, we identified a homozygous variant (c.1079T>C:p.Met360Thr) within a region of uniparental disomy of chromosome 2, in the INHBB gene (which encodes the β B-subunit of inhibin B and activin B proteins) in a male patient suffering from infertility characterized by nonobstructive azoospermia (27). The patient presented with elevated levels of FSH (19.1 IU/L, reference 1.4-14.5 IU/L), and testosterone at the lower limit of the normal range (48.5 pg/mL; lab reference range: 47-244 pg/mL). To test if the p.Met360Thr variant in the INHBB gene contributed to the male infertility in this patient, we generated genetically modified InhbbM364T/M364T mice and examined the testis phenotype. While as predicted, the equivalent Inhbb p.Met364Thr variant did not cause male infertility in the mouse, it did alter serum levels of activin B and germ cell content within the testis. Partway through this study, we identified a second infertile azoospermic man with a homozygous variant in the INHBB gene (c.314C>T:p.Thr105Met). Mechanistic analysis of this INHBB p.Thr105Met and the p.Met360Thr variant revealed that both variants limit the in vitro biosynthesis of activin B, without compromising inhibin B production. This study supports a link between genetic aberrations in the INHBB gene that limit activin B supply and disrupted testicular function.

Methods

Human Ethics and Genetic Variant Discovery

The detection of the first INHBB genetic variation (c.1079T>C:p.Met360Thr) in the male patient and relevant ethical approvals have been previously described (27). The second INHBB genetic variation (c.314C>T:p.Thr105Met) was identified in individual M1880, who is part of the Male Reproductive Genomics (MERGE) study and gave written consent compliant with local requirements. The MERGE study protocol was approved by the Münster Ethics Committees/Institutional Review Boards (Ref no. Münster: 2010-578-f-S) in accordance with the Helsinki Declaration of 1975.

Variant Analysis of the German Patient

Exome sequencing of infertile men within the MERGE study was conducted as described previously (28,29). In brief, genomic DNA was extracted from peripheral blood leukocytes, sample preparation and enrichment were carried out in accordance with the protocols of either Agilent’s SureSelectQXT Target Enrichment kit or Twist Bioscience’s Twist Human Core Exome kit, and libraries were analyzed on Illumina sequencers. The exome data were screened focusing on rare, biallelic variants in INHBB (minor allele frequency < 1% in the gnomAD database, version v2.1.1) (28), which might affect protein function (stop-gain, frameshift, and splice site variants as well as missense variants). In total, exome data from 1305 men with varying infertility phenotypes were screened for variants in the INHBB gene. The majority of these men (n = 1056) presented with azoospermia or cryptozoospermia. Most of them had previously attended the Centre of Reproductive Medicine and Andrology, Münster, because of infertility. Men with well-established causes for infertility, including chromosomal aberrations and Y-chromosomal microdeletions in the AZF region, were excluded from the study.

After identification of subject M1880 who carried a rare missense variant in INHBB gene (NM_002193.4, c.314C>T;p.Thr105Met), the exome sequencing data of this man was screened for other rare (minor allele frequency in gnomAD < 0.01), likely pathogenic variants (stop-, frameshift-, splice site-, and missense variants with a CADD score > 25) in 230 genes that were classified with at least a limited level of evidence for being associated with male infertility according to our recent systematic review (30). Additionally, we screened for likely pathogenic variants in the recently published potential male infertility genes ADAD2, GCNA, MAJIN, MSH4, RAD21L1, RNF212, SHOC1, STAG3, SYCP2, TERB1, TERB2, and TRIM71, which have been associated with non-obstructive azoospermia (31-34).

Pathogenicity Assessment of the Genetic Variant

The effect of variants on protein function was assessed using 3 pathogenicity prediction software programs: Polyphen-2 (http://genetics.bwh.harvard.edu/pph2/), SIFT (https://sift.bii.a-star.edu.sg/), and MetaDome (https://stuart.radboudumc.nl/metadome/). These each provided an assessment of whether the variant was pathogenic or if the affected amino acid was tolerant to change. Amino acid conservation of the p.Met360 residue was assessed using a multiple alignment BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) of the INHBB protein sequences collected from UniProt. These included Homo sapiens (man, P09529), Pan troglodytes (chimpanzee, A0A2I3TNV9), Macaca mulatta (Rhesus macaque, A0A5F8ALK5), Mus musculus (mouse, Q04999), and Danio rerio (zebrafish, B0S7E0).

Histological evaluation of testis biopsies

Testis biopsies from patient M1880 were collected for testicular sperm extraction and research use. Biopsies were fixed in Bouin’s solution overnight at 4°C, washed with 70% ethanol, and embedded in paraffin using an automatic ethanol and paraffin row (Bavimed Laborgeräte GmbH, Birkenau, Germany). Subsequently, 5-µm sections were stained with periodic acid-Schiff’s reagents (PAS) according to standard procedures.

Animal studies/breeding experiments

All animal breeding and experimental protocols were approved by Monash University Animal Ethics Committee (project ID MARP3/14624) and conducted in accordance with the relevant code of practice for the care and use of animals for scientific purposes (National Health and Medical Council of Australia).

Generation of InhbbM364T/M364T mutant mice

Based on protein sequence comparisons, human p.Met360 amino acid corresponds to p.Met364 in the mouse. As such, we modified the mouse genome to generate InhbbM364T/M364T mutant mice. Founders were generated by the Australian Phenomics Network node at Monash University using CRISPR/Cas9-technology on a C57BL/6J background. The single-guide RNA “GGCGTACGCACCGGACTTGGGAC” was designed to target exon 2 (ENSMUSE00000424701) of murine transcript ENSMUSE00000424701 and was coinjected with the repair template (tggccggggtccctggctcagcttcctccttccacacagccgtggtgaaccagtaTcgcaCgcgtggcctgaaccct gggcccgtgaactcttgctgcatccctaccaagctgagctccat) into mouse zygotes. Following homology directed repair with the injected template, a c.1091T>C variant encoding for p.M364T was introduced into the genome, as well as a silent c.1086C>T variant to prevent cutting of the oligonucleotide during genome repair. Sanger sequencing of polymerase chain reaction products (752 bp) amplified from tail clip DNA, using forward (5’-GTAGCGGCTGGCATACCTT-3’) and reverse (5’-TGCAGTTAGGAGTCTCTCGTG-3’) primers identified mutant founders to establish the colony. Mice were breed with wildtype animals to dilute any off-target CRISPR/Cas9-induced variants. Routine genotyping using tail clip DNA was performed by Transnetyx via real-time polymerase chain reaction. For analysis, mutant mice were bred to homozygosity and compared with age-matched wildtype littermates.

Histological analyses of mouse tissues

For histological evaluation, testes were dissected, pierced with a fine needle and immediately transferred into Bouin’s fixative (Sigma-Aldrich) for 5 hours at room temperature. Testes were then processed, cut in half, and embedded into paraffin blocks using standard methods. After embedding, testes were cut at 5-µm sections, dewaxed and stained using PAS reagents and hematoxylin using standard methods.

Tissue sections were imaged with an Olympus BX53 microscope (Olympus America, PA, USA) equipped with an Olympus DP80 camera mounted with a 40×/0.95 UPlanSApo Olympus objective. For a stage-specific analysis of germ cell content and tubule area size, circular stage VIII seminiferous tubules were identified and imaged. To count spermatogonia, stage V tubules were used as spermatogonia are not present at stage VIII. To identify committed spermatogonia, testis sections were stained with 1 µg/mL goat cKIT antibody (R&D Systems, Cat# AF1356, RRID:AB_354750; https://antibodyregistry.org/search.php?q=AB_354750) and rabbit anti-goat horseradish peroxidase secondary in Dako antibody diluent (Agilent, Cat# P0449, RRID:AB_2617143; https://antibodyregistry.org/search?q=AB_2617143) as described previously (35). Staining was developed with 3,3'-diaminobenzidine liquid chromogen (Agilent), and all sections were counterstained with PAS reagents. Measurements were done by researchers blinded to genotype. The number of spermatocytes, round spermatids, and Sertoli cells per stage VIII tubule was counted (n = 10 tubules per animal, n = 6 males/genotype). Images were also loaded into ImageJ to trace the diameter of each tubule for a calculation of tubule area.

Fertility analyses

Male reproductive capacity was assessed using previously described methods (36). Three- and 6-month old InhbbM364T/M364T males were mated with young females (2-4 months old), and the litter size was recorded. Daily sperm production and epididymal sperm counts were measured as described previously (37). To assess sperm function, sperm were collected from the cauda epididymides and vas deferens at 10 to 12 weeks of age and 22 to 24 weeks of age as described previously using the back-flushing method (38). Sperm motility was assessed using a Hamilton-Thorne computer-aided semen analysis machine (MouseTraxx, USA) as described in Gibbs et al (38). Motility parameters, including total sperm motility and progressive motility, were measured. At least 1000 sperm were measured per mouse, and analyses were recorded on a minimum of 5 mice per genotype.

Serum hormone assays

Serum levels of activin B were measured using Ansh Lab’s enzyme-linked immunosorbent assay (ELISA) kits (Ansh Laboratories Biotechnology), and inhibin B using previously established in-house assays (39). Activin A assays were conducted using in-house ELISAs with reagents described in (40) but were only found to be within the limits of detection at 12 weeks of age. FSH levels were measured by an immunofluorometric assay using methods and reagents described in van Casteren et al (41).

Generation of activin B and inhibin B proteins

To explore the effects of INHBB variants on activin and inhibin biosynthesis and activity wildtype, Met360Thr and Thr105Met mutant inhibin B and activin B proteins were generated using methods previously described (42,43). Expression vectors (pcDNA3.1 backbone) encoding the complimentary DNA for the human α- (ref sequence NM_002191.4) and β B-subunit (ref sequence NM_002193.4), which had been engineered to favor the production of mature inhibin/activin B proteins served as starting templates (43). The c.1079T>C:p.Met360Thr point variant was introduced into the β B-subunit complimentary DNA sequence using the QuikChange Lightning Mutagenesis Kit (Agilent Technologies) using primers (sense 5-GAACCAGTACCGCACGCGGGGTCTGAACC-3’, and antisense 5’-GGTTCAGACCCCGCGTGCGGTACTGGTTC-3’, mutated nucleotides underlined). The INHBB c.314C>T:p.Thr105Met variant was generated using the same approach with mutagenic primers (sense 5’-GCCGCCATGGTCATGGCCCTGCGCAAG-3’, and antisense 5’- CTTGCGCAGGGCCATGACCATGGCGGC-3’, mutated nucleotides underlined). Resulting β B-subunit mutant constructs were verified by DNA sequencing using Monash University’s Micromon Genomics facility. To generate inhibin B protein variants, wildtype α-subunit DNA constructs were combined with wildtype or mutant β B-subunit DNA constructs in cotransfections with Lipofectamine 2000 (Life Technologies) in HEK293 cells as previously described (43). Inhibin B protein variants were isolated from conditioned media using cobalt-immunoaffinity procedures as described in Goney et al (42), and recoveries were verified using inhibin B ELISAs (as outlined in the previous discussion). Activin B protein variants were also generated by transfecting the wildtype or mutant β B-subunits into HEK293 cells with Lipofectamine 2000. The resulting activin B protein was purified from the conditioned media using FLAG-immunoaffinity as previously outlined (42). Activin B recoveries were estimated by ELISA.

Western bot analysis of inhibin B and activin B biosynthesis

Western blot analysis was used to assess the biosynthesis of inhibin B and activin B, following cotransfection of the inhibin α- and β B-subunit DNA constructs in HEK293 cells, as previously described (42). Protein concentrations were determined in conditioned media and cell lysate samples using a bicinchoninic acid assay (Thermo Fisher) and equivalent amounts of protein (1 µg) loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels. Western blots were probed with antibodies specific to the inhibin α-subunit (R1; Oxford Bio-innovation, UK (44), RRID:AB_2857371; https://antibodyregistry.org/search?q=AB_2857371), which binds residues 233 to 264, or to the β B-subunit (C5; Oxford Bio-innovation (45), RRID:AB_2857372; https://antibodyregistry.org/search?q=AB_2857372), which binds residues 373 to 405. Bound primary antibodies were captured using an antimouse secondary antibody conjugated with horseradish peroxidase (Merck, NJ, diluted 1:10 000, RRID:AB_2892102; https://antibodyregistry.org/search?q=AB_2892102). Chemiluminescent membranes were developed using a Lumi-Light Western blotting substrate (Roche Diagnostics, Switzerland) and detected using the Bio-Rad ChemiDoc detection system (Bio-Rad Laboratories), and band densitometry was performed using ImageLab software (Bio-Rad Laboratories).

In Vitro Activin/Inhibin B Bioassays

Activin B in vitro bioactivity was determined using a SMAD2/3-responsive luciferase reporter assay in HEK293 cells. First, HE293 cells were seeded onto 48-well plates at a density of 8 × 105 cells per well in Dulbecco’s Modified Eagle Medium containing 10% fetal calf serum. At 24 hours postplating, cells were transfected with a SMAD 2/3-responsive A3-luciferase reporter construct and FAST2 transcription factor using Lipofectamine 2000 (Thermo Fisher Scientific), as previously described (42,46). At 24 hours after transfection, cells were treated with increasing amounts of either wildtype or mutant activin B preparations (0-5 nM). The following day, cells were harvested in solubilization buffer (1% Triton X-100, 25 mM glycylglycine, pH 7.8, 15 mM MgSO4, 4 mM ethyleneglycol-bis-(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid, and 1 mM dithiothreitol). The lysates were transferred to a 96-well plate and combined with an equal amount of D-luciferin (Thermo Fisher Scientific) to measure luciferase activity. Luminescence was quantified using a CLARIOstar microplate reader (BMG Labtech, Germany).

Follistatin in vitro bioassays

To assess the ability of follistatin to inhibit activin B-mediated SMAD2/3-lucifierase bioactivity, we incorporated follistatin treatments into HEK293 luciferase assay as previously described. In this assay, cells were treated with increasing doses of follistatin (R&D Systems, MN, USA, 0-500 nM) in the presence of 200 pM of wildtype or Met360Thr mutant activin B.

Inhibin B in vitro bioactivity was determined using an activin B-responsive luciferase reporter assay in COV434 granulosa cells (42). Following plating, COV434 cells were transfected with an A3-luciferase reporter construct, the transcription factor FAST2 and betaglycan, using Lipofectamine 3000 (Thermo Fisher Scientific). At 24 hours posttransfection, cells were treated in triplicate with 200 pM activin B (R&D Systems) and increasing doses of purified inhibins (0-10 nM). The following day, cells were lysed and luciferase activity determined as previously described.

ALK7 mediated in vitro activin B bioactivity was assessed in R1B-L17 mink lung epithelial cells, which are devoid of the activin type 1 receptors, thus allowing a clean assessment of activin B-mediated signalling via ALK7. On the first day, R1B-L17 cells were plated at 6 × 105 cells/well on 48-well plates in Dulbecco’s Modified Eagle Medium media containing 10% fetal calf serum. The following day, cells were transfected with Lipofectamine 3000 with 10 ng/well ALK7 receptor, 50 ng/well of A3-luciferase reporter, and 100 ng/well FAST2 transcription factor according to manufacturer’s specifications. The following day, cells were treated with increasing amounts of wildtype or mutant activin B preparations (0-5 nM). Activin B-induced luciferase assay was determined as described above.

Statistical analyses

Data were analyzed using unpaired t-tests or 2-way analyses of variance with Sidak’s post hoc tests using GraphPad Prism v.9 (GraphPad), with the exception of germ cell content counts. Significance was denoted when α (P-value) was less than 0.05. Numerical data are presented as individual values as well as the mean ± SD.

Statistical analysis of germ cell content was conducted in R version 3.5.1. A mixed model regression was used to analyze significance of germ cell content data. The following interaction was used: pachytene spermatocytes ~ gt + animal, rounds spermatids ~ gt + animal, Sertoli ~ gt + animal, and log10_tubule area ~ gt + animal, where gt = genotype and animal = animal ID.

Results

Detection of a Rare Genetic Variant in INHBB in an Infertile Man Presenting With Azoospermia

Previously, a homozygous INHBB c.1079T>C genetic variant was identified in an azoospermic man using whole exome sequencing (Fig. 1A) (27). The predictive pathogenicity of this INHBB variant was assessed using leading assessment software Polyphen-2, SIFT and MetaDome (47,48). The INHBB c.1079T>C variant results in a methionine to threonine protein change (p.Met360Thr), in an amino acid that is highly conserved across species (Fig. 1B). Pathogenicity prediction software (Fig. 1C and 1E) classified this variant as possibly damaging and deleterious, and the amino acid as slightly intolerant to change. The affected amino acid sits within the second exon of INHBB (Fig. 1D), specifically within the bioactive or mature domain of the inhibin βB-subunit (Fig. 1E).

Figure 1.

Figure 1.

Open in a new tab

INHBB variant found in infertile male patient via whole exome sequencing. (A) INHBB variant information and allele frequency as shown in gnomAD. (B) The affected amino acid (p.Met360) is conserved across mammals and in zebrafish. Identity refers to whole protein similarity compared to human INHBB. (C) Pathogenicity assessment of the INHBB variant predicts that it is possibly damaging/deleterious to protein function. (D) The INHBB protein is encoded across 2 exons, with the variant identified in exon 2. (E) Tolerance landscape of the INHBB protein as sourced from MetaDome. The affected p.Met360 residue is predicted to be slightly intolerant to modification and sits within the bioactive mature domain of INHBB, downstream of a propeptide domain.

Male InhbbM364T/M364T Mice are Fertile but Have Altered Testis Cell Composition

To test whether the identified genetic variant in the human INHBB gene (c.1079T>C:p.Met360Thr) affected male fertility in the mouse, we generated the corresponding InhbbM364T/M364T mutant mice. Mutant males were examined at 12 and 24 weeks of age for a range of fertility parameters to assess for effects of age. We identified that body weight was comparable between genotypes (Fig. 2A). Testis weight was, however, significantly elevated in InhbbM364T/M364T males at both 12 weeks (19% increase) and 24 weeks (10% increase) of age (Fig. 2B). Pups per litter was comparable between groups at both ages, as revealed by breeding experiments with wildtype females (Fig. 2C). Similarly, daily sperm production was comparable between genotypes and ages (Fig 2D). Objective computer-aided sperm motility analysis indicated that there was no impact of the point variant on sperm functional parameters including total motility or progressive motility at 12 weeks of age (Fig. 2E). These data are indicative of an altered cell composition between genotypes that is normalized prior to the elongated spermatid phase of development.

Figure 2.

Figure 2.

Open in a new tab

Fertility data for wildtype and InhbbM364T/M364T male mice at 12 and 24 weeks of age. (A) Body weights, (B) testis weights, (C) litter sizes, (D) daily sperm production, and (E) sperm total and progressive motility (at 12 weeks of age) as measured using computer-aided semen analysis. Grey bars and black points are wildtype data, and white bars and clear points are mutant (p.Met364Thr), mean ± SD.

A closer examination of the testis histology of 12 week old InhbbM364T/M364T males revealed that all germ cell subtypes were present and normal stages of spermatogenesis were identified (Fig. 3B). Tubule size was, however, visibly larger in mutants than in age-matched wildtype males (Fig. 3A), and the ratio of individual germ cell types appeared to be perturbed. To assess this objectively, spermatogonia numbers (cKIT+, spermatogonia committed to spermatogenesis) in stage V tubules, as well as spermatocyte, round spermatid, and Sertoli cell numbers and tubule area in stage VIII tubules were measured. While there was no difference in the mean number of spermatogonia between genotypes (Fig. 3C), we identified a significant increase in the spermatocyte (Fig. 3D) and round spermatid numbers (Fig. 3E) per tubule in InhbbM364T/M364T males at 12 weeks of age compared to wildtype littermates. We also identified a significant increase in Sertoli cell numbers (Fig. 3F) and tubule area per stage VIII tubules (Fig. 3G) in mutant testes. Collectively, these data indicate that the InhbbM364T/M364T variant results in increased numbers of Sertoli cells carrying a collectively larger number of spermatocytes and round spermatids and leads to a larger tubule size. The “excess” spermatids were, however, removed prior to beginning elongated spermatids, as indicated by a normal daily sperm output (Fig. 2D) and epididymal sperm count (49).

Figure 3.

Figure 3.

Open in a new tab

Testis histology and germ cell content of InhbbM364T/M364T mice. (A) Wildtype and (B) InhbbM364T mutant testis histology (stage V or VIII tubules). Scale bar = 50 μm. (C) Spermatogonia counts (cKIT + cells) in stage V seminiferous tubules; (D) Pachytene spermatocyte counts, (E) round spermatid counts, (F) Sertoli cell counts and (G) tubule size of stage VIII seminiferous tubules. P-values for wildtype vs mutant are shown at the top right of each graph; mean ± SD.

Male InhbbM364T/M364T Mice Have Reduced Circulating Levels of Activin B

To test if the Inhbb variant altered the ability of activin and/or inhibin forms to regulate the HPG axis, we examined the circulating levels of activin A and B, FSH, and inhibin B. We found that serum activin B levels (Fig. 4B) were significantly reduced (by 33%) in male mutant InhbbM364T/M364T mice relative to wildtype littermates at 12 weeks of age. However, serum levels of FSH (Fig. 4A), inhibin B (Fig. 4C), and activin A (Fig. 4D) were unchanged in mutants.

Figure 4.

Figure 4.

Open in a new tab

Serum hormone screens for wildtype and mutant InhbbM364T/M364T male mice at 12 and 24 weeks. (A) Follicle-stimulating hormone levels were assessed by immunofluorometric assay. Serum (B) activin B, (C) inhibin B, and (D) activin A levels (12 weeks only) were measured by enzyme-linked immunosorbent assay. Wildtype responses are shown in shaded boxes; mutant responses are in clear boxes. Statistical significance determined using 2-way analysis of variance, **P < 0.01; n = 6-12 samples per genotype. Grey bars and black points are wildtype data, and white bars and clear points are mutant (p.M364T), mean ± SD.

The INHBB p.Met360Thr Impairs Activin B In Vitro Biosynthesis, but Does Not Disrupt Activin B or Inhibin B In Vitro Bioactivity

To understand the mechanism by which the (human) INHBB p.Met360Thr variant may alter activin B biosynthesis and/or bioactivity, we undertook in vitro analyses. In vitro expression analyses on the conditioned media from HEK293 cells cotransfected with the inhibin α-subunit and either the wildtype or p.Met360Thr mutant β B-subunits, revealed that the Met360Thr variant disrupted activin B biosynthesis but had no effect on inhibin B production (Fig. 5A-5F). Indeed, activin B in vitro production was reduced by 56% in cells cotransfected with the p.Met360Thr mutant β B-subunit. This was not attributed to differences in β B-subunit expression, as intracellular levels of the β B-subunits were comparable (Fig. 5C and 5F).

Figure 5.

Figure 5.

Open in a new tab

Analysis of the effect of the human INHBB p.Met360Thr variant on in vitro activin B and inhibin B bioactivity and production. In vitro production of inhibin B (A) and activin B (B), and intracellular βB-subunit levels (C), from HEK293 cells transfected with wildtype or p.M306T INHBB constructs was assessed by Western blot with densitometric analysis (D-F). (G) The ability of wildtype and mutant activin B to activate a SMAD 2/3-responsive luciferase reporter was investigated in HEK293 cells. (H) The ability of wildtype or mutant inhibin B to suppress an activin B-induced SMAD 2/3-luciferase activity was measured in COV434 cells expressing betaglycan. (I) The ability of follistatin to block wildtype and mutant activin B-induced SMAD 2/3-luciferase activity was determined in HEK293 cells. (J) R1B/L17 cells expressing the type I receptor ALK7 were assessed for activin B-induced luciferase responsiveness. Wildtype responses are shown in filled squares; mutant responses, in clear squares. Statistical significance determined using unpaired t tests, **P < 0.01 and ***P < 0.001; n = 3 samples per variant.

We next examined the ability of purified wildtype and mutant Met360Thr inhibin B and activin B forms to act through their canonical signalling pathways. It was found that the Met360Thr genetic variant did not impair the ability of activin B to activate a SMAD 2/3 luciferase reporter in HEK293 cells (Fig. 5G) or the ability of inhibin B to suppress activin B-induced SMAD 2/3 signaling in a COV434 granulosa cells primed with betaglycan (Fig. 5H). Additionally, the extracellular antagonist follistatin blocked both wildtype and mutant activin B activity in HEK293 cells with equal potency, supporting that the Met360Thr variant does not alter interactions with follistatin (Fig. 5I). Finally, because activin B has been reported to also act through the type I receptor ALK7, we compared the ability of activin B variants to induce a SMAD 2/3 response in R1B-L17 cells, which lack the activin type I receptors (Fig. 5J). Expression of ALK7 in R1B-L17 cells resulted in indistinguishable activation of SMAD 2/3 signalling by both wildtype and mutant Met360Thr activin B forms, supporting that the Met360Thr variant does impair activin B signaling through ALK7. Together, these mechanistic analyses support that while the INHBB p.Met360Thr variant does not alter the bioactivities of activin B or inhibin B, it does interfere with the activin B biosynthesis.

A Second INHBB Variant, p.Thr105Met, Is Associated With Male Infertility and Also Impairs Activin B Biosynthesis In Vitro

During the course of this study, a second azoospermic male (M1880) carrying a homozygous INHBB missense variant, c.314T>C:p.Thr105Met, was discovered (Fig. 6A). No alternative causes for infertility were identified in this subject. Histological analyses of testes biopsies show a heterogeneous phenotype (Fig. 6B and 6C). On the left side, most tubules showed Sertoli cell only or tubular shadows, and only 1 tubule showed meiotic arrest at the spermatocyte phase. In contrast, on the right side more tubules exhibited meiotic arrest and a few putative round spermatids as the most mature germ cell type. Both testes were, however, negative for 3′,5′-cyclic adenosine 5′-monoiphosphate responsive element modulator staining indicating that if round spermatids were indeed present, they were abnormal (Fig. 6D). Positive staining 3′,5′-cyclic adenosine 5′-monoiphosphate responsive element modulator staining is shown in a biopsy section from a man with normal spermatogenesis (Fig. 6E and 6F), with a negative immunoglobulin G control also shown (Fig. 6G). Testicular sperm extraction as a means to achieve pregnancy was not successful for patient M1880 as no elongating spermatids were recovered. Hormone analyses revealed that, like the INHBB p.Met360Thr case study, the man carrying the INHBB p.Thr105Met variant had elevated levels of FSH (26.5 IU/L, reference 1-7 IU/L), low total testosterone (7.4 nmol/L, lab reference range: >12 nmol/L), and inhibin B levels that were below the limit of assay detection in 2 separate samples. The p.Thr105Met mutation site in the INHBB gene lies within the prodomain of the inhibin β B-subunit, which is highly conserved across species (Fig. 6H). Analysis of the predictive pathogenicity of this INHBB c.314T>C:p.Thr105Met variant classified it as probably damaging (Polyphen-2) and deleterious (SIFT) to protein function (Fig. 6I), and the amino acid was classified as highly intolerant to change (MetaDome) (Fig. 6J). An examination of the effect of the p.Thr105Met variant on inhibin B and activin B in vitro biosynthesis revealed that, like the INHBB p.Met360Thr variant, this variant abrogated the production of activin B from HEK293 transfected cells (Fig 7A-7F).

Figure 6.

Figure 6.

Open in a new tab

Identification of a second INHBB variant in an azoospermic man (M1880). (A) Variant information and allele frequency as shown in gnomAD. (B and C) Left and right testis histology (periodic acid-Schiff staining) of biopsy from human male patient with the INHBB p.Thr105Met variant. (D) Testis 3′,5′-cyclic adenosine 5′-monophosphate responsive element modulator (CREM) staining to detect round spermatids. (E) Testis section from a male with normal spermatogenesis stained for CREM, identifying staining in round spermatids; magnified in (F) and negative immunoglobulin G staining control in (G). (H) Scale bar = 50 μm for all images. The affected amino acid (p.Thr105) is conserved across mammals and in zebrafish. Identity refers to whole protein similarity compared to human INHBB. (I) Pathogenicity assessment of the INHBB variant by the in silico algorithms Polyphen-2 and SIFT predicts that it is possibly damaging/deleterious to protein function. (J) Tolerance landscape of the INHBB protein and position of p.Thr105 as sourced from MetaDome. The p.105 residue is predicted to be highly intolerant to change and sits within the transforming growth factor β propeptide domain.

Figure 7.

Figure 7.

Open in a new tab

Analysis of the human INHBB p.Thr105Met variant. In vitro production of (A) inhibin B and (B) activin B and (C) intracellular levels of βB-subunit from HEK293 cells transfected with wildtype or p.Thr105Met INHBB constructs was assessed by Western blot with densitometric analysis (D-F). Wildtype responses are shown in filled circles; mutant responses, in clear circles. Statistical significance determined using unpaired t tests, **P < 0.01 and ***P < 0.001.

Discussion

In this study, we examined the functional consequence of a human variant in the INHBB gene (c.1079T>C:p.Met360Thr), which codes subunits of the inhibin B and activin B proteins, on spermatogenesis and fertility in male mice. While the identified man, who was homozygous for this INHBB variant, was infertile, we found that the corresponding p.Met364Thr variant in the mouse Inhbb gene did not disrupt fertility. Rather, the Inhbb p.Met364Thr variant in the mouse led to a significant increase in the number of Sertoli cells and round spermatids and, consequently, a significant increase in seminiferous tubule area and testis weight. The quantitative shift in germ cell numbers was associated with a significant reduction in circulating levels of activin B, but no significant shift in circulating levels of FSH. Interestingly, despite notable increases in haploid germ cell numbers, this did not translate to detectable changes in the production of the daily sperm production or epididymal sperm content in InhbbM364T/M364T mice. These data indicate that germ cells were lost during the elongating phase of spermatogenesis (50).

Mechanistic analyses revealed that the INHBB p.Met360Thr variant, and a second human variant p.Thr105Met, disrupted activin B in vitro biosynthesis, without compromising inhibin B production. Homology modelling using the pro-activin A structure (51) predicts that the p.Met360Thr variant lies within the helical wrist region of the mature activin B dimer. Therefore, we suspect that the p.Met360Thr change may disorder this helix and, in doing so, perturbs β B-subunit folding and dimerization. In contrast, the p.Thr105Met variant is located within the prodomains of the β B-subunit, in a region thought to contact the mature domains during ligand assembly (51-53). As such, we anticipate that the p.Thr105Met variant is interfering with prodomain-mediated β B-subunit folding, leading to reduced formation of activin B dimers. Interestingly, inhibin B in vitro biosynthesis appears largely unaffected by these point variants, suggesting that p.Met360Thr and p.Thr105Met β B-subunit assembly is rescued in the presence of the α-subunit. In support, serum inhibin B levels were found to be unaltered in InhbbM364T/M364T mice.

Because the p.Met360Thr variant also lies within the predicted inhibin Bβ-subunit type I receptor binding site (54), we wondered whether this variant may influence activin B-mediated bioactivity through ALK4 or ALK7. However, the corresponding mutant p.Met360Thr activin B protein had comparable bioactivity in vitro to the native human activin B protein through both these type I receptors. Additionally, we found that the p.Met360Thr variant did not compromise the ability of the activin-binding protein follistatin to block activin B in vitro bioactivity, nor did it disrupt inhibin B activity through the coreceptor betaglycan. However, it is possible that the p.Met360Thr variant could compromise the bioactivity of the resulting inhibin B or activin B forms through unidentified receptors and/or binding proteins or the newly discovered inhibin B-specific coreceptor TGFβ receptor type III-like (4).

The in vitro analyses support that INHBB variants that disrupt activin B biosynthesis have consequences for testis composition in males. As activins are thought to be major drivers of pituitary FSH production, it was suspected that this phenotype might be owing to a FSH deficit. However, despite a reduction in circulating activin B in InhbbM364T/M364T male mice, FSH levels were actually unchanged. Rather, the increased Sertoli cell numbers and testis masses in InhbbM364T/M364T male mice are similar to mice exposed to elevated FSH during the postnatal period (55,56). Further, the 2 male patients examined were found to have elevated levels of circulating FSH. In support, Inhbb knockout male mice also display elevated levels of circulating FSH (15). Together these analyses suggest that activin B may not actually stimulate FSH production in males but rather function to constrain FSH production via a yet to be discovered mechanism. Although unexplored, we hypothesize that the elevation in Sertoli cell number is due to increased proliferation during the prepubertal phase (57).

The testis phenotype in InhbbM364T/M364T male mice may also be due to the direct effects of reduced intratesticular activin B. While is there is no overt male fertility phenotype in Inhbb knockout male mice (15), there is evidence to support that restrained activin activity is important for normal spermatogenesis in the mouse (13,58). Indeed, it has been shown that elevated levels of activin A/B in Inha haploinsufficient mice are associated with age-related changes in sperm production and Sertoli cell differentiation (58). Our study provides the first detailed insights into how modest disruptions to activin B supply can have marked effects on Sertoli cell germ cell carrying capacity in the mouse.

The reasons for the differing consequences of the INHBB variant c.1079T>C:p.Met360Thr on male fertility in the mouse and the man are unknown but are likely multifactorial. Unlike inbred monogenic mouse models, many human disorders result from a combination of alleles (59). As such, it is possible that additional confounding genetic variations may contribute to the infertility in the man. A stringent analysis of all protein-coding variants, however, failed to identity any other strong candidates in both patients. We accept, however, that there are likely many as yet undiscovered genes that impact the hormonal regulation of male fertility. Similarly environmental factors such as diet, exercise, infections, stress, and pollutants are also likely to contribute to the more severe testis phenotype in the man, relative to the laboratory mice, which are housed under controlled conditions (59). The high degrees of gene/protein conservations (99%) between human and mouse, however, argues against species differences in the inhibin βB-subunit function being the primary difference.

In conclusion, we showed that the human INHBB variant c.1079T>C:p.Met360Thr identified in an infertile man does not result in infertility in mice but does alter testicular Sertoli and germ cell content and circulating levels of activin B. We also identified a second INHBB variant, c.314C>T:p.Thr105Met in an azoospermic man and demonstrated that this variant similarly limits activin B biosynthesis. This study supports a common link between genetic aberrations in the INHBB gene, which limit activin B supply, and disrupted spermatogenesis. Additionally, these data have uncovered a role for activin B in defining optimal Sertoli cell:germ cell numbers in the testis.

Acknowledgments

The authors acknowledge Dr Hong-Jian Zhu at the University of Melbourne for provision of the mink lung epithelial R1B-L17 cells, as well as Nadja Rotte and Jutta Salzig from the University of Münster for providing testicular histology of patient M1880.

Contributor Information

Brendan J Houston, School of Biological Sciences, Faculty of Science, Monash University, Clayton, Australia; School of BioSciences and Bio21 Institute, Faculty of Science, University of Melbourne, Parkville, Australia.

Anne E O’Connor, School of Biological Sciences, Faculty of Science, Monash University, Clayton, Australia; School of BioSciences and Bio21 Institute, Faculty of Science, University of Melbourne, Parkville, Australia.

Degang Wang, Department of Physiology, Monash Biomedicine Discovery Institute, Monash University, Clayton, Australia; The Affiliated Zhongshan Boai Hospital of Southern Medical University, Guangdong, China.

Georgia Goodchild, Department of Physiology, Monash Biomedicine Discovery Institute, Monash University, Clayton, Australia.

D Jo Merriner, School of Biological Sciences, Faculty of Science, Monash University, Clayton, Australia.

Haitong Luan, Department of Physiology, Monash Biomedicine Discovery Institute, Monash University, Clayton, Australia.

Don F Conrad, Oregon National Primate Research Center, Oregon Health and Science University, Beaverton, OR, USA; Genetics of Male Infertility Initiative, GEMINI, Portland, OR, USA.

Liina Nagirnaja, Oregon National Primate Research Center, Oregon Health and Science University, Beaverton, OR, USA; Genetics of Male Infertility Initiative, GEMINI, Portland, OR, USA.

Kenneth I Aston, Genetics of Male Infertility Initiative, GEMINI, Portland, OR, USA; Department of Surgery (Urology Division) University of Utah School of Medicine, Salt Lake City, UT, USA.

Sabine Kliesch, Department of Clinical and Surgical Andrology, Centre of Reproductive Medicine and Andrology, University Hospital  Münster, Münster, Germany.

Margot J Wyrwoll, Institute of Reproductive Genetics, University of Münster, Münster, Germany.

Corinna Friedrich, Institute of Reproductive Genetics, University of Münster, Münster, Germany.

Frank Tüttelmann, Institute of Reproductive Genetics, University of Münster, Münster, Germany.

Craig Harrison, Department of Physiology, Monash Biomedicine Discovery Institute, Monash University, Clayton, Australia.

Moira K O’Bryan, School of Biological Sciences, Faculty of Science, Monash University, Clayton, Australia; School of BioSciences and Bio21 Institute, Faculty of Science, University of Melbourne, Parkville, Australia.

Kelly Walton, Department of Physiology, Monash Biomedicine Discovery Institute, Monash University, Clayton, Australia.

Funding

This research was supported in part by funding from the National Health and Medical Research Council to M.K.O.B., D.C., and K.I.A. (APP1120356), and K.L.W. (APP1157680), by a Monash University (Medicine-Science Interdisciplinary Seed Grant), as well as by funding from the German Research Foundation sponsored Clinical Research Unit “Male Germ Cells” (DFG, CRU326) to C.F. and F.T.

Disclosures

The authors have nothing to disclose.

Data Availability

All data generated or analyzed during this study are included in this published article or in the Figshare data repository listed in the references (https://doi.org/10.6084/m9.figshare.17306138).

References

  • 1. Kluin  PM, Kramer  MF, de Rooij  DG. Proliferation of spermatogonia and Sertoli cells in maturing mice. Anat Embryol (Berl).  1984;169(1):73-78. [DOI] [PubMed] [Google Scholar]
  • 2. Vale  W, Rivier  J, Vaughan  J, et al.  Purification and characterization of an FSH releasing protein from porcine ovarian follicular fluid. Nature.  1986;321(6072):776-779. [DOI] [PubMed] [Google Scholar]
  • 3. Lewis  KA, Gray  PC, Blount  AL, et al.  Betaglycan binds inhibin and can mediate functional antagonism of activin signalling. Nature.  2000;404(6776):411-414. [DOI] [PubMed] [Google Scholar]
  • 4. Brule  E, Wang  Y, Li  Y, et al.  TGFBR3L is an inhibin B co-receptor that regulates female fertility. Sci Adv.  2021;7(51):eabl4391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Mathews  LS, Vale  WW. Expression cloning of an activin receptor, a predicted transmembrane serine kinase. Cell.  1991;65(6):973-982. [DOI] [PubMed] [Google Scholar]
  • 6. Mathews  LS, Vale  WW, Kintner  CR. Cloning of a second type of activin receptor and functional characterization in Xenopus embryos. Science.  1992;255(5052):1702-1705. [DOI] [PubMed] [Google Scholar]
  • 7. O’Shaughnessy  PJ, Monteiro  A, Verhoeven  G, De Gendt  K, Abel  MH. Effect of FSH on testicular morphology and spermatogenesis in gonadotrophin-deficient hypogonadal mice lacking androgen receptors. Reproduction.  2010;139(1):177-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Kumar  TR, Wang  Y, Lu  N, Matzuk  MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet.  1997;15(2):201-204. [DOI] [PubMed] [Google Scholar]
  • 9. Abel  MH, Wootton  AN, Wilkins  V, Huhtaniemi  I, Knight  PG, Charlton  HM. The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinology.  2000;141(5):1795-1803. [DOI] [PubMed] [Google Scholar]
  • 10. Krishnamurthy  H, Danilovich  N, Morales  CR, Sairam  MR. Qualitative and quantitative decline in spermatogenesis of the follicle-stimulating hormone receptor knockout (FORKO) mouse. Biol Reprod.  2000;62(5):1146-1159. [DOI] [PubMed] [Google Scholar]
  • 11. Singh  J, ’Neill O C, Handelsman  DJ. Induction of spermatogenesis by androgens in gonadotropin-deficient (hpg) mice. Endocrinology. 1995;136(12):5311-5321. [DOI] [PubMed] [Google Scholar]
  • 12. Archambeault  DR, Yao  HH. Activin A, a product of fetal Leydig cells, is a unique paracrine regulator of Sertoli cell proliferation and fetal testis cord expansion. Proc Natl Acad Sci USA.  2010;107(23):10526-10531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Matzuk  MM, Finegold  MJ, Su  JG, Hsueh  AJ, Bradley  A. Alpha-inhibin is a tumour-suppressor gene with gonadal specificity in mice. Nature.  1992;360(6402):313-319. [DOI] [PubMed] [Google Scholar]
  • 14. Matzuk  MM, Kumar  TR, Bradley  A. Different phenotypes for mice deficient in either activins or activin receptor type II. Nature.  1995;374(6520):356-360. [DOI] [PubMed] [Google Scholar]
  • 15. Vassalli  A, Matzuk  MM, Gardner  HA, Lee  KF, Jaenisch  R. Activin/inhibin beta B subunit gene disruption leads to defects in eyelid development and female reproduction. Genes Dev.  1994;8(4):414-427. [DOI] [PubMed] [Google Scholar]
  • 16. Adeeko  AO, Dunne  E, Mather  J, Moore  A, Morris  ID. Testicular germ cell populations in the adult rat after continuous in-vivo testicular infusion of inhibin-A and activin-A. Int J Androl.  1996;19(2):69-76. [DOI] [PubMed] [Google Scholar]
  • 17. Cho  BN, McMullen  ML, Pei  L, Yates  CJ, Mayo  KE. Reproductive deficiencies in transgenic mice expressing the rat inhibin alpha-subunit gene. Endocrinology.  2001;142(11):4994-5004. [DOI] [PubMed] [Google Scholar]
  • 18. McMullen  ML, Cho  BN, Yates  CJ, Mayo  KE. Gonadal pathologies in transgenic mice expressing the rat inhibin alpha-subunit. Endocrinology.  2001;142(11):5005-5014. [DOI] [PubMed] [Google Scholar]
  • 19. Lindstedt  G, Nystrom  E, Matthews  C, Ernest  I, Janson  PO, Chatterjee  K. Follitropin (FSH) deficiency in an infertile male due to FSHbeta gene mutation: a syndrome of normal puberty and virilization but underdeveloped testicles with azoospermia, low FSH but high lutropin and normal serum testosterone concentrations. Clin Chem Lab Med.  1998;36(8):663-665. [DOI] [PubMed] [Google Scholar]
  • 20. Simoni  M, Gromoll  J, Hoppner  W, et al.  Mutational analysis of the follicle-stimulating hormone (FSH) receptor in normal and infertile men: identification and characterization of two discrete FSH receptor isoforms. J Clin Endocrinol Metab.  1999;84(2):751-755. [DOI] [PubMed] [Google Scholar]
  • 21. Tapanainen  JS, Aittomaki  K, Min  J, Vaskivuo  T, Huhtaniemi  IT. Men homozygous for an inactivating mutation of the follicle-stimulating hormone (FSH) receptor gene present variable suppression of spermatogenesis and fertility. Nat Genet.  1997;15(2):205-206. [DOI] [PubMed] [Google Scholar]
  • 22. Achermann  JC, Jameson  JL. Fertility and infertility: genetic contributions from the hypothalamic-pituitary-gonadal axis. Mol Endocrinol.  1999;13(6):812-818. [DOI] [PubMed] [Google Scholar]
  • 23. Li  WH, Chen  L, Chen  SX, et al.  Polymorphisms in inhibin alpha gene promoter associated with male infertility. Gene.  2015;559(2):172-176. [DOI] [PubMed] [Google Scholar]
  • 24. Ludlow  H, Phillips  DJ, Myers  M, et al.  A new “total” activin B enzyme-linked immunosorbent assay (ELISA): development and validation for human samples. Clin Endocrinol (Oxf).  2009;71(6):867-873. [DOI] [PubMed] [Google Scholar]
  • 25. Pierik  FH, Vreeburg  JT, Stijnen  T, De Jong  FH, Weber  RF. Serum inhibin B as a marker of spermatogenesis. J Clin Endocrinol Metab.  1998;83(9):3110-3114. [DOI] [PubMed] [Google Scholar]
  • 26. Meachem  SJ, Nieschlag  E, Simoni  M. Inhibin B in male reproduction: pathophysiology and clinical relevance. Eur J Endocrinol.  2001;145(5):561-571. [DOI] [PubMed] [Google Scholar]
  • 27. Lopes  AM, Aston  KI, Thompson  E, et al.  Human spermatogenic failure purges deleterious mutation load from the autosomes and both sex chromosomes, including the gene DMRT1. PLoS Genet.  2013;9(3):e1003349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Karczewski  KJ, Francioli  LC, Tiao  G, et al.  The mutational constraint spectrum quantified from variation in 141,456 humans. Nature.  2020;581(7809):434-443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Wyrwoll  MJ, Temel  SG, Nagirnaja  L, et al.  Bi-allelic mutations in M1AP are a frequent cause of meiotic arrest and severely impaired spermatogenesis leading to male infertility. Am J Hum Genet.  2020;107(2):342-351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Houston  BJ, Riera-Escamilla  A, Wyrwoll  MJ, et al.  A systematic review of the validated monogenic causes of human male infertility: 2020 update and a discussion of emerging gene-disease relationships. Hum Reprod Update.  2021;28(1):15-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Hardy  JJ, Wyrwoll  MJ, McFadden  W, et al.  Variants in GCNA, X-linked germ-cell genome integrity gene, identified in men with primary spermatogenic failure. Hum Genet.  2021;140(8):1169-1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Krausz  C, Riera-Escamilla  A, Moreno-Mendoza  D, et al.  Genetic dissection of spermatogenic arrest through exome analysis: clinical implications for the management of azoospermic men. Genet Med.  2020;22(12):1956-1966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Salas-Huetos  A, Tuttelmann  F, Wyrwoll  MJ, et al.  Disruption of human meiotic telomere complex genes TERB1, TERB2 and MAJIN in men with non-obstructive azoospermia. Hum Genet.  2021;140(1):217-227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Torres-Fernandez  LA, Emich  J, Port  Y, et al.  TRIM71 deficiency causes germ cell loss during mouse embryogenesis and is associated with human male infertility. Front Cell Dev Biol.  2021;9:658966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Houston  BJ, Nagirnaja  L, Merriner  DJ, et al.  The Sertoli cell expressed gene secernin-1 (Scrn1) is dispensable for male fertility in the mouse. Dev Dyn.  2021;250(7):922-931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Borg  CL, Wolski  KM, Gibbs  GM, O’Bryan  MK. Phenotyping male infertility in the mouse: how to get the most out of a “non-performer.”  Hum Reprod Update.  2010;16(2):205-224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Cotton  L, Gibbs  GM, Sanchez-Partida  LG, Morrison  JR, de Kretser  DM, O’Bryan  MK. FGFR-1 [corrected] signaling is involved in spermiogenesis and sperm capacitation. J Cell Sci.  2006;119(Pt 1):75-84. [DOI] [PubMed] [Google Scholar]
  • 38. Gibbs  GM, Orta  G, Reddy  T, et al.  Cysteine-rich secretory protein 4 is an inhibitor of transient receptor potential M8 with a role in establishing sperm function. Proc Natl Acad Sci USA.  2011;108(17):7034-7039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Walton  KL, Chan  KL, Pruysers  E, et al.  Use of detergent-based buffers allows detection of precursor inhibin forms in an immunoassay format. Mol Cell Endocrinol.  2013;381(1-2):106-114. [DOI] [PubMed] [Google Scholar]
  • 40. Groome  N. Ultrasensitive two-site assays for inhibin-A and activin-A using monoclonal antibodies raised to synthetic peptides. J Immunol Methods.  1991;145(1-2):65-69. [DOI] [PubMed] [Google Scholar]
  • 41. van Casteren  JI, Schoonen  WG, Kloosterboer  HJ. Development of time-resolved immunofluorometric assays for rat follicle-stimulating hormone and luteinizing hormone and application on sera of cycling rats. Biol Reprod.  2000;62(4):886-894. [DOI] [PubMed] [Google Scholar]
  • 42. Goney  MP, Wilce  MCJ, Wilce  JA, et al.  Engineering the ovarian hormones inhibin A and inhibin B to enhance synthesis and activity. Endocrinology.  2020;161(8):bqaa099. [DOI] [PubMed] [Google Scholar]
  • 43. Walton  KL, Kelly  EK, Johnson  KE, Robertson  DM, Stanton  PG, Harrison  CA. A novel, more efficient approach to generate bioactive inhibins. Endocrinology.  2016;157(7):2799-2809. [DOI] [PubMed] [Google Scholar]
  • 44. Groome  NP, Illingworth  PJ, O’Brien  M, et al.  Detection of dimeric inhibin throughout the human menstrual cycle by two-site enzyme immunoassay. Clin Endocrinol (Oxf).  1994;40(6):717-723. [DOI] [PubMed] [Google Scholar]
  • 45. Groome  NP, Illingworth  PJ, O’Brien  M, et al.  Measurement of dimeric inhibin B throughout the human menstrual cycle. J Clin Endocrinol Metab.  1996;81(4):1401-1405. [DOI] [PubMed] [Google Scholar]
  • 46. Liu  B, Dou  CL, Prabhu  L, Lai  E. FAST-2 is a mammalian winged-helix protein which mediates transforming growth factor beta signals. Mol Cell Biol.  1999;19(1):424-430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Adzhubei  IA, Schmidt  S, Peshkin  L, et al.  A method and server for predicting damaging missense mutations. Nat Methods.  2010;7(4):248-249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Ng  PC, Henikoff  S. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res.  2003;31(13):3812-3814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Walton  K, O’Bryan  M, Houston  B. Supplemental data for: Epididymal sperm counts of wild type and InhbbM364T/M364T male mice at 12 weeks of age. Figshare. Uploaded December 20, 2021. 10.6084/m9.figshare.17306138 [DOI] [Google Scholar]
  • 50. O’Donnell  L, Nicholls  PK, O’Bryan  MK, McLachlan  RI, Stanton  PG. Spermiation: the process of sperm release. Spermatogenesis.  2011;1(1):14-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Wang  X, Fischer  G, Hyvonen  M. Structure and activation of pro-activin A. Nat Commun.  2016;7:12052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Shi  M, Zhu  J, Wang  R, et al.  Latent TGF-beta structure and activation. Nature.  2011;474(7351):343-349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Walton  KL, Makanji  Y, Wilce  MC, Chan  KL, Robertson  DM, Harrison  CA. A common biosynthetic pathway governs the dimerization and secretion of inhibin and related transforming growth factor beta (TGFbeta) ligands. J Biol Chem.  2009;284(14):9311-9320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Harrison  CA, Gray  PC, Fischer  WH, Donaldson  C, Choe  S, Vale  W. An activin mutant with disrupted ALK4 binding blocks signaling via type II receptors. J Biol Chem.  2004;279(27):28036-28044. [DOI] [PubMed] [Google Scholar]
  • 55. Allan  CM, Haywood  M, Swaraj  S, et al.  A novel transgenic model to characterize the specific effects of follicle-stimulating hormone on gonadal physiology in the absence of luteinizing hormone actions. Endocrinology.  2001;142(6):2213-2220. [DOI] [PubMed] [Google Scholar]
  • 56. Haywood  M, Spaliviero  J, Jimemez  M, King  NJ, Handelsman  DJ, Allan  CM. Sertoli and germ cell development in hypogonadal (hpg) mice expressing transgenic follicle-stimulating hormone alone or in combination with testosterone. Endocrinology.  2003;144(2):509-517. [DOI] [PubMed] [Google Scholar]
  • 57. Figueiredo  AFA, Wnuk  NT, Tavares  AO, et al.  Prepubertal PTU treatment in rat increases Sertoli cell number and sperm production. Reproduction.  2019;158(2):199-209. [DOI] [PubMed] [Google Scholar]
  • 58. Itman  C, Bielanowicz  A, Goh  H, et al.  Murine inhibin alpha-subunit haploinsufficiency causes transient abnormalities in prepubertal testis development followed by adult testicular decline. Endocrinology.  2015;156(6):2254-2268. [DOI] [PubMed] [Google Scholar]
  • 59. Beckers  J, Wurst  W, de Angelis  MH. Towards better mouse models: enhanced genotypes, systemic phenotyping and envirotype modelling. Nat Rev Genet.  2009;10(6):371-380. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article or in the Figshare data repository listed in the references (https://doi.org/10.6084/m9.figshare.17306138).

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES