Integrated network pharmacology and in vivo validation reveal the action of Scutellaria baicalensis extract against oviductal inflammation in laying hens

Abstract

Oviductal inflammation in laying hens presents a significant challenge to the laying hen industry, leading to a significant decline in production performance and eggshell quality. The supplementation of traditional Chinese herbs or their extracts has been proven to be beneficial for improving the growth performance and health status of animals. This study aimed to evaluate the effects of Scutellaria baicalensis extract (SBE) on laying performance and oviductal inflammation by integrating network pharmacology, molecular docking, and animal experiments. A total of 288 healthy 55-week-old Hy-Line Brown hens were randomly allocated to 3 treatments (8 replicates of 12 birds each), and all laying hens except those in the control received injections of 15% phenol mucilage (PM; 1 mL/bird once daily for 5 consecutive days). The findings revealed that compared with the PM group, the SBE group had better egg production, egg mass, and feed conversion ratio at weeks 1-8 (P < 0.05). Moreover, compared with the PM group, SBE supplementation reduced the levels of TNF-α, LPS, and β-gal in the magnum and increased the contents of lysozyme and ovotransferrin in albumen (P < 0.05). Meanwhile, the upregulation of PI3K, AKT1, and BCL2 and the downregulation of BAX and TNF-α were observed in the SBE group compared with the PM group (P < 0.05). Additionally, the significantly lower abundances of Rikenellaceae_RC9_gut_group, Bacteroides, and Ruminococcus_torques_group were observed in the PM group compared with the control and SBE groups (P < 0.05), and SBE supplementation effectively counteracted these adverse effects. Taken together, our findings demonstrate that SBE supplementation could mitigate oviductal inflammation in laying hens, potentially by regulating the PI3K-AKT1 signaling pathway, and provide novel insights for developing plant extracts to improve reproductive health and egg quality in laying hens.

Introduction

The oviductal inflammation is accompanied by a rapid decline in the egg production rate and a decreased egg quality during the late production phase (Li et al., 2025). This decline in productivity restricts overall production efficiency and leads to the premature culling of hens, resulting in economic losses, animal welfare, and environmental concerns (Fan and Wu, 2022). The continuous production of high-quality eggs to extend the production cycle of laying hens is an important issue faced by the poultry industry. In addition, declining immune function is a common characteristic of aged animals, and it is widely considered that the decline in production efficiency is closely related to the aging of reproductive organs (Saleh et al., 2019). In particular, the inflammatory responses and diminished immune function in the oviduct of aged laying hens are significant factors leading to the deterioration of egg quality (Feng et al., 2020; Liu et al., 2022). Therefore, alleviating inflammatory responses and restoring tissue homeostasis of the oviduct in laying hens represents a crucial strategy for extending the laying cycle.

The addition of antibiotics to animal feed has been banned in China since 2020, and therapeutic chemical drugs cannot be widely and extensively used in the current process of antibiotic-free poultry farming. In this context, Chinese herbal medicines, which are widely available, inexpensive, and pose a low risk of drug resistance and residue, are increasingly valued in veterinary medicine and have become a focus in the poultry industry (Peng et al., 2022). Dietary supplementation with daidzein (a Chinese herb extract) or Chinese herbal medicines, individually or in combination, could improve the laying performance and egg quality of aged laying hens, as shown in a previous study (Zhang et al., 2021). Furthermore, Scutellaria baicalensis Georgi (Lamiaceae; commonly known as Baikal skullcap or Chinese skullcap) has been used as a medicinal plant in China for thousands of years, which exhibits a broad spectrum of pharmacological properties, including anticancer, antibacterial, antiviral, and antioxidant activities (Guo et al., 2007; Kumagai et al., 2007; Schinella et al., 2002; Shan et al., 2007). Furthermore, previous studies have shown that the extract of Scutellaria baicalensis can inhibit the generation of pro-inflammatory factors caused by deoxynivalenol-induced enteritis in piglets (Liao et al., 2020) and ovalbumin-induced allergic airway inflammation in mice (Bui et al., 2017), thereby treating inflammatory diseases. However, the role and mechanism of Scutellaria baicalensis extract (SBE) in alleviating oviductal inflammation in laying hens have not been elucidated and require further investigation.

Network pharmacology is a relatively new discipline that has emerged gradually in recent years, based on the theories of systems biology, analysis of biological system networks, and the selection of specific signaling nodes in the design of multi-target drugs (Hopkins, 2007; Zhao et al., 2023). Currently, network pharmacology has been widely applied in the study of the therapeutic mechanisms of traditional Chinese medicine (TCM) for various diseases, such as colorectal cancer and myocardial injury of heat-stressed chicks (Shang et al., 2023; Sun et al., 2025). In this study, the inflammatory model of the oviduct in laying hens was established via phenol mucilage induction. By integrating network pharmacology, molecular docking, and in vivo experiments, this work aimed to elucidate the potential targets and underlying molecular mechanisms of SBE in mitigating oviductal inflammation.

Materials and methods

Ethic statement

The methodologies complied with the applicable guidelines and regulations, and the Animal Care and Use Committee of the Institute of Feed Research of the Chinese Academy of Agricultural Sciences approved the experimental protocol (approval No. AEC—CAAS-20230502).

Prediction of potential drug active component targets, inflammatory targets, and drug action inflammatory targets

The active components of Scutellaria baicalensis were obtained using the Traditional Chinese Medicine System Pharmacological Database and Analysis Platform (TCMSP, http://lsp.nwu.edu.cn/tcmsp.php) according to oral bioavailability (OB) ≥ 30% and drug-likeness (DL) ≥ 0.18, a thorough resource that covers details on drug targets, disease-related pathways, and active components of TCM. SMILES representations of the obtained compounds were retrieved from the PubChem database (https://pubchem.ncbi.nlm.nih.gov) and subsequently entered into SwissTargetPrediction (http://www.swisstargetprediction.ch) to predict potential targets for the main active components.

The keyword ‘inflammation’ was used to search the DisGeNET database (https://www.disgenet.org/), Therapeutic Target Database (TTD, http://db.idrblab.net/ttd/), and Online Mendelian Inheritance in Man database (OMIM, https://omim.org/) for disease-related targets (Liu et al., 2021). The resulting target data underwent normalization and standardization, after which duplicates were eliminated to obtain the definitive list of disease targets. In addition, the Venn diagram drawn using the bioinformatics mapping website (http://www.bioinformatics.com.cn/) was used to show the intersection targets of drug active components and inflammatory diseases, which serve as predictive targets for drug effects on diseases.

PPI network construction of intersection targets of inflammation and scutellaria baicalensis

Protein-protein interaction (PPI) data may be found using the interactive gene database search engine STRING (https://string-db.org/). The minimum required interaction score was set to 0.97 once the interaction targets were loaded into STRING (Shang et al., 2023). Cytoscape 3.7.2 was used to generate the common targets PPI network diagram, and the top five key target genes were identified and selected based on their degree values. In the diagram, node size and color were adjusted according to the degree.

Screening of Key Components of Scutellaria Baicalensis

The information on TCM, compounds, and predictive targets was imported into Cytoscape 3.7.2 to draw TCM-compounds-targets network diagrams. Subsequently, the compounds were ranked based on their degree value, which served as the criterion for identifying key components of Scutellaria baicalensis.

Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis

DAVID Bioinformatics Resources 6.8 (https://david.ncifcrf.gov/home.jsp) was used to perform the KEGG pathway enrichment analysis. In addition, the bubble graph was created by importing the top 20 KEGG pathways with the lowest p-value into the bioinformatics mapping website (http://www.bioinformatics.com.cn/).

Molecular docking analysis

The three-dimensional (3D) structures of these active components were determined using the PubChem database platform, and the 3D structures were downloaded from the RCSB PDB database (http://www.rcsb.org/). The pretreatment stage must be finished to perform the molecular docking procedure, including the removal of hydrogen atoms. Afterward, the AutoDock Vina program (http://vina.scripps.edu/) was used to finish the ligand and protein formation. The capacity of the ligand to bind to the receptor is expressed as affinity, which could be reflected by absolute binding energy (kcal/mol). The higher the absolute binding energy value, the stronger the binding capacity. The top 4 compounds with the highest binding affinity, which are formed by each pathway-related protein and the top 3 components of the Scutellaria baicalensis (identified by the TCM-compounds-targets network, namely wogonin, baicalein, or baicalin, with their respective MOL IDs: MOL000173, MOL002714, and MOL002935), were imported into PyMOL and Discovery Studio 2020 Client software for further visualization, respectively.

Birds and experimental design

A total of 288 healthy 55-week-old Hy-Line Brown hens were randomly assigned to 3 treatments, each with 8 replicates (12 birds per replicate). In the modeling phase before the formal experimental phase, all laying hens, except for the control, received injections of 15% phenol mucilage (PM; 1 mL/bird, once daily for 5 days in a row). The method for establishing the model was detailed in Supplementary Material S1, and the successful induction of inflammation was confirmed by measuring inflammatory factor levels in blood collected from the wing vein. The initial body weight and laying rate of the experimental hens were similar for each replication group. During the whole trial, all hens were fed with the basal diet. After modeling, the control group remained untreated, while the phenolic mucilage-challenged groups either received no supplementation (termed the PM group) or were supplemented with SBE via drinking water (termed the SBE group). The concentration of SBE added was 0.8 mL/L (Baiyu Biotechnology Co., Ltd., Guangzhou, China). This concentration was determined based on previously published feed-based doses (Zhang et al., 2025a) and converted according to the average feed intake and water consumption of laying hens. Ultra performance liquid chromatography (UPLC) analysis revealed the chemical profile of SBE (Fig. 1G), with baicalin, wogonoside, and wogonin identified as the primary constituents at concentrations of 511.07, 120.17, and 3.57 µg/mL, respectively. The Chinese Feeding Standard of Chicken (NY/T, 33-2004) and the NRC (1994) were followed in the preparation of the experimental diets. The basic diet composition and nutrient level were displayed in Table 1 during the 8-week experiment.

Fig. 1.

Screening and identification of key therapeutic targets. (A) Venn diagram of intersecting active compounds and inflammatory disease targets. (B) PPI network of common targets. (C) Degree distribution of top 5 key targets. (D) TCM-compounds-targets diagram. (E) Degree distribution of top 5 key components. (F) KEGG pathway enrichment analysis. (G) Ultra performance liquid chromatography chromatogram of Scutellaria baicalensis extract. TCM, traditional Chinese medicine.

Table 1.

Basic diet formula and nutrient level of layer chicks (air-dried basis).

Items	Contents (%)
Ingredient
Corn	65.20
Soybean meal	23.80
Limestone	8.60
Salt	0.30
DL-methionine	0.10
Calcium hydrogen phosphate	1.78
Choline chloride	0.10
Premix1	0.12
Nutrient level2
AME (MJ/kg)	11.20
Crude protein	16.50 (16.77)
Calcium	3.39 (3.45)
Total phosphorus	0.45 (0.43)
Available phosphorus	0.39
Lysine	0.78
Methionine	0.35
Methionine + cystine	0.60

¹The following premix is provided per kg of diet: vitamin A, 12,500 IU; vitamin D₃, 4,125 IU; vitamin E, 15 IU; vitamin K₃, 2 mg; thiamine, 1 mg; riboflavin, 8.5 mg; calcium pantothenate, 11 mg; niacin, 32.5 mg; pyridoxine, 8 mg; biotin, 0.5 mg; folic acid, 1.25 mg; vitamin B₁₂, 0.02 mg; Mn, 65 mg; I, 1 mg; Fe, 60 mg; Cu, 8 mg; Zn, 66 mg; choline, 1,000 mg; phytase, 300 mg.

²The other nutrient levels are calculated values, while the levels in parentheses are analyzed values.

The feeding space and apparatus were meticulously cleaned and disinfected before the experiment, and the procedure was properly followed in compliance with the recommended protocols. To keep the chicken house clean, the ventilation system was routinely maintained, and trash was removed as soon as possible. Water and feed were accessible at all times during the experiment. Laying hens were allocated to 3-tier battery cages (three hens per cage; cage size: 40 cm × 40 cm × 35 cm) and exposed to a daily light cycle of 16 h of light and 8 h of dark.

Sample collection

Eight birds (one bird randomly selected per replicate) from each of the control, PM, and SBE/PM treatments were slaughtered and dissected for sample collection at the end of the experiment. Two segments (approximately 2 cm each) were obtained from the middle portion of the magnum region of the oviduct. One section was preserved in 4% paraformaldehyde for subsequent histomorphological analysis. The other section, mucosal samples (collected by longitudinally cutting the remaining magnum tissue) and the content of the cecum, were immediately submerged in liquid nitrogen and kept at −80°C until further analysis. Eight eggs were chosen at the end of the trial from each treatment (one egg per replicate at the average egg weight). The albumen was subsequently collected and transferred to sterile containers for the assessment of protein secretion function in the magnum.

Laying performance and egg quality

Daily egg production (number and weight) and weekly feed intake were recorded per replicate throughout the trial period. The following parameters were computed: egg production, egg mass, average egg weight, average daily feed intake (ADFI), and feed conversion ratio (FCR). Additionally, eight eggs from each replicate (at average egg weight) were chosen to evaluate egg quality. The Eggshell Thickness Gauge and Egg Force Reader (ORKA Technology Ltd., Ramat HaSharon, Israel) were used to evaluate the thickness (equator and both poles) and strength of the eggshell, respectively. Moreover, for measuring albumen height, Haugh unit, and yolk color, the Egg Analyzer™ (ORKA Food Technology Ltd., Ramat HaSharon, Israel) was employed.

Histomorphology of the magnum

Following the described method (Liu et al., 2022), samples from the magnum were embedded, stained, and viewed using an Eclipse microscope (Nikon Corporation Co., Ltd., Tokyo, Japan). From the magnum’s sections, five microscopic fields were chosen at random to observe its pathological state. In addition, the sections were stained with periodic acid-Schiff (PAS), and fields were randomly selected for observation (Chawla et al., 2017). Image-Pro Plus software was used to quantify the PAS-positive area percentage (total PAS-positive pixels/total tissue area pixels) in pixels.

ELISA kits analysis for magnum mucosal

As instructed by the manufacturer, ELISA kits for chickens (Shanghai Jichun Industrial Co., Ltd., Shanghai, China, and Wuhan Saipei Biotechnology Co., Ltd., Wuhan, China) were used to measure the contents of serum samples, including interleukin (IL)-1β, lipopolysaccharide (LPS), tumor necrosis factor-α (TNF-α), and β-galactosidase (β-gal), as well as the levels of total protein, TNF-α, IL-1β, IL-10, LPS, and β-gal in magnum mucosal samples.

Protein content of albumen

The ovalbumin, ovotransferrin, and lysozyme contents of albumen samples were determined using ELISA kits (Beijing Jinzhiyan Biotechnology Co., Ltd., Beijing, China) following the manufacturer’s instructions.

Quantification of mRNA with real-time PCR

As directed by the manufacturer, all of the RNA from the magnum mucosa samples was extracted using the FreeZol Reagent (Nanjing Vazyme Bio-Technology Co., Ltd., Nanjing, China). An Epoch Microplate Spectrophotometer (BioTek Instruments, Inc., VT, USA) was used to measure the purity and concentration of RNA and kept at −80°C until synthesis for cDNA. Following the instructions of the manufacturer, a PrimeScript® RT kit (Shanghai Guyan Industrial Co., Ltd., Shanghai, China) was used to convert the total RNA to cDNA. The Applied Biosystems 7500 real-time PCR system (Thermo Fisher Scientific Ltd., Portland, OR, USA) was used to perform real-time fluorescence quantitative PCR utilizing a SYBR® Premix Ex Taq^TM kit (Shanghai Guyan Industrial Co., Ltd., Shanghai, China). The process included a preliminary denaturation stage that lasted 5 min at 95°C. Table 2 lists the primer sequences for the genes under investigation, which Shanghai Shenggong Bioengineering Co., Ltd. created. With β-actin serving as the internal reference gene, the mRNA relative expression levels were analyzed and compared using the 2^−∆∆CT method (Livak and Schmittgen, 2001).

Table 2.

Primers of intended and reference genes for layer chicks.

Gene1	Primer sequence (5′−3′)2	GenBank number
AKT1	F: AGGAGGAAGAGATGATGGAT	NM_001396388.1
	R: GAATGGATGCCGTGAGTT
PI3K	F: GTCCTTGAGCCACTGATG	XM_046923915.1
	R: TGTTGCCTTACGGTTGTT
FOXO3	F: CAGCAATGTCAAGGAGAGCA	XM_001234495.7
	R: TGAAGAGGTTGTCCGAGTCC
BCL2	F: ATCGTCGCCTTCTTCGAGTT	XM_040676897.2
	R: TACCCATCCTCCGTTGTCCT
BAX	F: TATGGGACACCAGGAGGGTA	XM_015290060.4
	R: CGTAGACCTTGCGGATAAAGC
TNF-α	F: AGTTCAGATGAGTTGCCCTTCCTG	XM_015294124
	R: TTCAGAGCATCAACGCAAAAGGGA
β-actin	F: TGTTACCAACACCCACACCC	NM_205518.2
	R: TCCTGAGTCAAGCGCCAAAA

¹AKT1 = serine/threonine kinase 1; PI3K = phosphatidylinositol 3-kinase; FOXO3 = forkhead box O3; BCL2 = B-cell lymphoma 2; BAX = BCL-2-associated X protein; TNF-α = tumor necrosis factor-α.

²F: forward primer; R: reverse primer.

Microbiota analysis

Using the E.Z.N.A. Soil DNA Kit (Omega Bio-Tek, Norcross, GA, USA), the total bacterial DNA was extracted from the samples of the cecum. DNA sample quality was evaluated using gel electrophoresis. The bacterial 16S rRNA gene’s V3-V4 sections were amplified using primers 338F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). The PCR amplification and purification of the amplicon were based on published research (Dai et al., 2022). Furthermore, on the Illumina MiSeq PE300 platform (Illumina, San Diego, USA), purified amplicons were qualified and paired-end sequenced following the standard protocols by Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China).

Statistical analysis

Unless otherwise noted, the one-way ANOVA procedure and Tukey’s Multiple Comparison Test were used by SAS 9.2 (SAS Institute Inc., Cary, NC, USA) for statistical analysis. The Wilcoxon rank-sum test was used to assess the statistical significance between the two groups for microbial statistics. Furthermore, the Kruskal–Wallis test was used to assess the differences between the three groups. The data were shown as mean and pooled SEM, and statistical significance for differences was determined at P < 0.05.

Microbial data, including beta diversity and linear discriminant analysis (LDA) combined effect size measurements (LEfSe), were analyzed using the Majorbio Cloud Platform (www.majorbio.com), a free online platform owned by Shanghai Majorbio Bio-pharm Technology Co., Ltd. Beta diversity was assessed through principal coordinate analysis (PCoA) accompanied by analysis of similarity (ANOSIM). LDA was employed to evaluate the effect size of differentially abundant features, with a threshold LDA score (log₁₀LDA) set at 3.0. Additionally, the Wilcoxon rank-sum test was applied to examine overall differences between treatment groups.

Results

Prediction of scutellaria baicalensis in regulating inflammation via network pharmacology

In the TCMSP database, a total of 29 active compounds derived from Scutellaria baicalensis were identified through screening. The canonical SMILES representations of the compounds were obtained from the PubChem database and imported into SwissTargetPrediction, which predicted 120 targets (after removing targets with a reliability score of 0 and eliminating duplicates). Furthermore, 495 disease targets related to inflammatory diseases were collected from the DisGeNET, TTD, and OMIM databases after removing duplicates. The intersection between the active compounds and the inflammatory disease targets was visualized using a Venn diagram (Fig. 1A), which revealed 34 common targets. Additionally, the 34 intersection targets were imported into the STRING database with the minimum required interaction score set to 0.97. A PPI network between Scutellaria baicalensis and inflammation was subsequently constructed using Cytoscape 3.7.2 (Fig. 1B). Based on degree values, the top five key targets (including IL6, AKT1, TP53, TGFB1, and FN1) were identified and selected (Fig. 1C). Then, the network of TCM-compounds-targets was constructed (Fig. 1D). Subsequently, the compounds were ranked by their degree values, leading to the selection of wogonin, baicalein, and baicalin as the key components of Scutellaria baicalensis (Fig. 1E). In this study, the components of Scutellaria baicalensis extract were identified via UPLC, and their contents in the extract were characterized (Fig. 1G). KEGG enrichment analysis indicated that the PI3K-Akt pathway might be the molecular pathway through which Scutellaria baicalensis regulates oviductal inflammation (Fig. 1F). These results suggest that Scutellaria baicalensis demonstrates potential in modulating oviductal inflammation in layer hens.

Laying performance and egg quality

Further, we validated the function of Scutellaria baicalensis in regulating oviductal inflammation in laying hens through animal experiments. Compared with the control group, the significantly increased inflammatory factor levels of TNF-α, IL-1β, LPS, and β-gal in the serum were observed in the model group (P < 0.05), confirming the successful establishment of the inflammation model (Fig. S1). The results of laying performance and egg quality are presented in Table 3, Table 4. The significantly lower values of egg production and egg mass were observed in the PM and SBE groups compared with the control group at weeks 1-8 (P < 0.05). Meanwhile, the PM and SBE groups showed worse FCR compared with the control group (P < 0.05). However, egg production and egg mass were significantly higher in the SBE group than in the PM group, while the SBE group exhibited more favorable FCR than the PM group at weeks 1-8 (P < 0.05). Additionally, the significantly lower values of eggshell breaking strength and albumen height were observed in the PM group compared with the control group at the end of the trial (P < 0.05), whereas no significant difference was observed between the control and SBE groups. These results suggest that the SBE alleviated oviduct inflammation in laying hens and mitigated the associated declines in egg production rate and egg mass.

Table 3.

Effects of SBE on the laying performance of laying hens (weeks 55 to 64 of age)¹.

Items2	Control		PM	SBE	SEM	P-value
Egg production (%)
Week 0	87.51a	65.91b		65.35b	2.351	< 0.001
Weeks 1-4	80.63a	65.63b		69.38b	1.496	< 0.001
Weeks 5-8	79.38a	59.13b		63.38b	1.947	< 0.001
Weeks 1-8	80.00a	62.38c		66.38b	1.659	< 0.001
Egg mass (g/hen/d)
Week 0	53.16a	40.91b		40.17b	1.418	< 0.001
Weeks 1-4	49.40a	39.86b		42.88b	1.029	< 0.001
Weeks 5-8	48.61a	36.39b		38.88b	1.214	< 0.001
Weeks 1-8	49.00a	38.13c		40.88b	1.052	< 0.001
Average egg weight (AEW) (g)
Week 0	60.74	62.06		61.43	0.463	0.528
Weeks 1-4	61.26	60.69		61.81	0.581	0.753
Weeks 5-8	61.19	61.56		61.40	0.384	0.931
Weeks 1-8	61.22	61.12		61.60	0.390	0.880
ADFI (g)
Week 0	118.68	122.13		120.22	0.977	0.368
Weeks 1-4	110.39	104.03		102.77	1.567	0.100
Weeks 5-8	104.57	106.38		109.33	1.747	0.127
Weeks 1-8	107.48	107.21		107.91	1.235	0.975
FCR (g/g)
Week 0	1.99b	2.27ab		2.49a	0.063	0.002
Weeks 1-4	1.94c	2.56a		2.29b	0.064	< 0.001
Weeks 5-8	1.90b	2.46a		2.37a	0.064	< 0.001
Weeks 1-8	1.92c	2.50a		2.30b	0.059	< 0.001

¹The data are the means of 8 replicates per treatment, each including 12 birds.

²Control no change; PM and SBE groups were treated with phenolic mucilage for 5 consecutive days, which supplemented nothing and SBE (0.8 mL/L) in their basal drinking water, respectively. PM, phenolic mucilage; SBE, Scutellaria baicalensis extract.

^a-cSignificant differences exist between means within a row without a common superscript (P < 0.05).

Table 4.

Effects of SBE on the egg quality of laying hens (weeks 55 to 64 of age)¹.

Items2	Control		PM	SBE	SEM	P-value
Egg shape index
Week 0	1.35	1.35		1.35	0.003	0.840
Week 4	1.35	1.36		1.35	0.004	0.264
Week 8	1.35	1.37		1.37	0.004	0.163
Eggshell thickness (× 10-2 mm)
Week 0	44.82	44.30		43.89	0.349	0.574
Week 4	44.82	45.71		45.09	0.304	0.491
Week 8	43.26	43.54		43.28	0.305	0.924
Eggshell weight (g)
Week 0	6.12	5.99		5.92	0.045	0.180
Week 4	5.97	6.04		5.77	0.049	0.052
Week 8	6.28	6.08		6.22	0.050	0.232
Eggshell breaking strength (N)
Week 0	36.59	35.47		35.10	0.390	0.276
Week 4	32.91	33.33		34.47	0.744	0.693
Week 8	35.95a	32.42b		35.36ab	0.646	0.050
Albumen height (mm)
Week 0	6.44	6.25		6.31	0.080	0.629
Week 4	6.83	6.77		6.83	0.113	0.974
Week 8	7.62a	7.04b		7.69a	0.109	0.019
Yolk color
Week 0	6.29	6.12		6.20	0.095	0.779
Week 4	6.03	5.96		6.13	0.107	0.814
Week 8	7.69	7.65		7.47	0.091	0.598
Haugh unit
Week 0	77.61	76.00		76.88	0.604	0.573
Week 4	79.84	79.60		80.73	0.964	0.890
Week 8	84.90	82.29		84.97	0.761	0.273

¹The data are the means of 8 replicates per treatment, each including 8 eggs.

²Control no change; PM and SBE groups were treated with phenolic mucilage for 5 consecutive days, which supplemented nothing and SBE (0.8 mL/L) in their basal drinking water, respectively. PM, phenolic mucilage; SBE, Scutellaria baicalensis extract.

^a-bSignificant differences exist between means within a row without a common superscript (P < 0.05).

Tissue homeostasis and protein secretion in the oviduct

The morphological structure of the magnum is shown in Fig. 2A. Compared with the control group, the PM group exhibited impaired epithelial integrity in the magnum, along with occasional reduction and atrophy of glandular tissue, a reduced size of tubular glands, connective tissue hyperplasia in the submucosa, and focal lymphocyte infiltration. In contrast, the SBE group showed only mild mucosal epithelial exfoliation, slight connective tissue proliferation, and occasional focal lymphocyte infiltration. Notably, abundant and orderly arranged tubular glands were observed, and those within the lamina propria remained clearly visible. Additionally, as shown in Fig. 2B and C, the PAS-positive cell area in the PM group significantly increased compared with the control group, and the SBE group showed a lower PAS-positive cell area than the PM group (P < 0.05).

Fig. 2.

Effect of SBE on magnum morphology in laying hens. (A) Representative images of magnum morphology (Scale bar, 500 and 50 μm). (B) PAS staining of magnum tissue (Scale bar, 50 and 25 μm). (C) Quantification of PAS-positive area in the magnum. PAS, periodic acid-Schiff; PM, phenolic mucilage; SBE, Scutellaria baicalensis extract. Data are presented as mean ± SD (n = 8). Differences are shown as ***(P < 0.001), **(P < 0.01).

The levels of TNF-α, LPS, and β-gal in the PM group showed a significant increase compared with the control group, and significantly lower values were observed in the SBE group than those in the PM group (Fig. 3C-E, P < 0.05). Furthermore, compared with the SBE group, the IL-10 level significantly decreased in the PM group, and the control group exhibited a significantly lower level of β-gal (Fig. 3A and E, P < 0.05). As shown in Fig. 3G, no significant difference was observed in the ovalbumin of albumen among all groups. However, compared with the PM group, significantly higher values of lysozyme and ovotransferrin concentration were observed in the control and SBE groups (Fig. 3F and H, P < 0.05). These results demonstrate that SBE contributes to mitigating oviductal inflammation, restoring oviductal homeostasis, and protein secretory function in laying hens.

Fig. 3.

Effects of SBE on inflammatory factors in the magnum and core protein in albumen. (A-E) Levels of inflammatory factors in the magnum mucosa. (F-H) Levels of core protein in albumen. PM, phenolic mucilage; SBE, Scutellaria baicalensis extract. Data are presented as mean ± SD (n = 8). Differences are shown as ***(P < 0.001), **(P < 0.01), *(P < 0.05).

Microbial diversity in the intestine

PCoA plots revealed significant shifts in the cecal microbial communities among the three groups (P = 0.001, ANOSIM) (Fig. 4A). The dominant phyla in the cecum of the laying hen were Firmicutes and Bacteroidota, contributing > 85% to the entire community among all groups (Fig. 4B). The PM group exhibited enriched abundances of phylum Firmicutes (class Bacilli, order Lactobacillales, Lactobacillaceae, and Lactobacillus). Meanwhile, the relative abundances of phylum Bacteroidota (class Bacteroidia, order Bacteroidales, Rikenellaceae, Bacteroidaceae, Rikenellaceae_RC9_gut_group, and Bacteroides), Ruminococcus_torques_group, and Fournierella increased in the SBE group (Fig. 4C). Additionally, the differences between each of the two groups were evaluated using the Wilcoxon rank sum test and are presented in Fig. 4D. The higher abundances of Rikenellaceae_RC9_gut_group, Bacteroides, Ruminococcus_torques_group, etc. were also observed in the control group compared with the PM group, as well as the higher abundances of Ruminococcus, norank_f__norank_o__RF39, norank_f__F082, etc. in the SBE group. Notably, the control group also exhibited increased abundances of Enterorhabdus and Solobacterium compared with the SBE group, but lower abundances of Ruminococcus and Clostridium_sensu_stricto_1. These results demonstrated that Scutellaria baicalensis can regulate the disruption of the intestinal microbiota in laying hens induced by oviductal inflammation.

Fig. 4.

Effects of SBE on cecal microbiota in laying hens. (A) Principal coordinate analysis (PCoA) of cecal microbiota based on Bray-Curtis. (B) Microbial composition at the phylum and genus levels. (C) Linear discriminant effect size of cecal microbiota. (D) Differences in the relative abundance of cecal microbiota at the genus level across groups of laying hens. LDA, Linear discriminant analysis; PM, phenolic mucilage; SBE, Scutellaria baicalensis extract.

Mechanism of scutellaria baicalensis in improving inflammation revealed through molecular docking and gene expression

First, molecular docking confirmed the regulatory effects of wogonin, baicalein, and baicalin on four key genes in the PI3K-Akt signaling pathway. the structures of the 4 compounds (namely Baicalin-AKT1, Baicalin-FOXO3, Baicalein-PI3K, and Baicalein-BLC2) formed by molecular docking are shown in Fig. 5A-D. Presented in Table 5 are the affinity values between the constituents and protein targets, which were evaluated by calculating binding energy. Each binding energy in Table 5 with less than −5.0 kcal/mol reflects a good binding capability, which could indicate the positive effects of SBE on improving inflammation in laying hens from the molecular docking level.

Fig. 5.

The molecular docking models and gene expression related to the PI3K-AKT1 signaling pathway. (A) The binding pattern of Baicalin with AKT1. (B) The binding pattern of Baicalin with FOXO3. (C) The binding pattern of Baicalein with PI3K. (D) The binding pattern of Baicalein with BLC2. (E) The mRNA relative expression of PI3K-AKT1 pathway-related genes. PM, phenolic mucilage; SBE, Scutellaria baicalensis extract. Data are presented as mean ± SD (n = 8). Differences are shown as ***(P < 0.001), **(P < 0.01), *(P < 0.05).

Table 5.

Binding energy of the key components of Scutellaria baicalensis with protein (kcal/mol).

Protein/Ligand	AKT1	PI3K	FOXO3	BLC2
Wogonin	−7.3	−8.2	−6.6	−6.8
Baicalein	−9.2	−8.3	−6.6	−7.2
Baicalin	−9.2	−8.1	−6.7	−7.0

In addition, the expression levels of genes associated with the PI3K-AKT1 pathway are presented in Fig. 5E. There were no significant differences in the relative mRNA expression of FOXO3 across all treatment groups. Compared with the control and SBE groups, the PM group exhibited significantly higher mRNA relative expression levels of BAX and TNF-α in the magnum but significantly lower expression of BCL2 (P < 0.05). Furthermore, the mRNA relative expression levels of PI3K and AKT1 significantly increased in the SBE group compared with the control and PM groups (P < 0.05). Concurrently, the significantly higher expression of TNF-α was also observed in the SBE group compared with the control group (P < 0.05).

Disscussion

The deterioration of productive performance and egg quality during the late laying phase poses significant economic challenges to the poultry industry, serving as a critical constraint that impedes the realization of the “500 eggs in 700 days” extended production strategy. According to previous research, inflammatory damage in the oviducts of laying hens is an important cause of a drop in egg quality or abnormalities during the late laying stage (Feng et al., 2020; Nii et al., 2025; Qiang et al., 2025). Approximately 2 billion of the 5 billion laying hens globally that are eliminated annually are in China (Fan and Wu, 2022). Sustaining egg quality and laying consistency to extend the production life of hens presents a significant opportunity to foster a more sustainable and economically viable egg industry. However, in the context of antibiotic-free poultry farming and growing drug resistance, TCM has gradually become a research hotspot in the poultry industry due to its wide availability, natural origin, and absence of drug residues (Peng et al., 2022). In this work, the integrated approach of network pharmacology, molecular docking, and in vivo experiments was employed to deeply investigate the efficacy and mechanism of SBE in mitigating oviduct inflammation in laying hens.

Network pharmacology is an emerging interdisciplinary field that has gained more attention in recent years, aiming to elucidate the intricate interactions between drugs and diseases through multi-target therapy (Wu et al., 2024). In this study, network pharmacology was employed to predict the potential targets, underlying mechanisms, and key active compounds of SBE against inflammatory diseases. As the key active ingredients, wogonin, baicalein, and baicalin have demonstrated anti-inflammatory efficacy as the primary active components of Scutellaria baicalensis (Liao et al., 2021). KEGG enrichment analysis conducted in this study further revealed that the PI3K-Akt pathway may be the key molecular pathway through which these compounds regulate oviductal inflammation. This pathway is crucial for cell survival and apoptosis, and FOXO3 and BLC2 are significant transcription factors and effector proteins that function downstream of this pathway (Guo et al., 2015; He et al., 2018; John et al., 2008).

To validate the network pharmacology findings through in vivo experiments, an oviductal inflammatory model was first established in the magnum of laying hens using PM, and the therapeutic effect of SBE against this condition and its underlying mechanism were investigated. Compared with the control, significantly reduced values of laying performance were observed in both the PM and SBE groups. Nevertheless, SBE supplementation effectively improved the laying performance of laying hens suffering from inflammatory magnum compared with the PM group. This result is consistent with previous findings that dietary supplementation with TCM extracts can improve the laying performance of laying hens (Zhang et al., 2021). Laying performance is intrinsically linked to oviductal health and structural integrity (Nii, 2022). The successful establishment of the inflammatory model was confirmed by further histological evaluation of the oviductal magnum, which showed that PM treatment caused considerable tissue damage marked by elevated levels of inflammatory factors. However, SBE supplementation improved tissue health and mitigated inflammation in the magnum of laying hens, as evidenced by lower levels of inflammatory factors than in the PM group. This result is similar to the previous study, which found that dietary supplementation with Lonicera flos and Cnicus japonicus extracts could reduce the inflammation-related factors in the oviduct of laying hens (Liu et al., 2023). These results indicated that SBE may improve oviduct health and enhance laying hen production performance by down-regulating the expression of inflammatory factors.

According to the results of molecular docking, wogonin, baicalein, and baicalin all have binding energies below −5.0 kcal/mol with target proteins in the PI3K-AKT1 pathway. Generally, binding energies below −4.25, −5.0, and −7.0 kcal/mol are indicative of certain, good, and robust binding affinities, respectively (Liu et al., 2021). These findings provide a structural foundation for the beneficial effects of SBE from the perspective of molecular docking, indicating that the binding of these compounds to target proteins may mediate the improvement of inflammation in the magnum of laying hens. Additionally, previous studies have shown that activation of the PI3K-AKT1 pathway can inhibit apoptosis (Yu et al., 2015) and relieve inflammation (Zhang et al., 2025b). Thus, the mRNA relative expression of PI3K-AKT1 pathway-related genes in the magnum was further measured. Laying hens in the PM group exhibited upregulation of the pro-apoptotic gene BAX and the pro-inflammatory factor gene TNF-α, alongside downregulation of the anti-apoptotic gene BCL2 in the magnum. The mRNA relative expression of these genes was partially reversed by SBE supplementation, which may be attributed to the up-regulated expression of PI3K and AKT1 genes. This finding is consistent with previous research results indicating that the addition of Chinese herbal medicine extracts can inhibit cell apoptosis and mitigate inflammatory conditions (Hu et al., 2024; Zhang et al., 2025b). In general, these results suggested that SBE supplementation may inhibit apoptosis and alleviate the oviduct inflammation by activating the PI3K-AKT1 pathway.

The ratio of Firmicutes to Bacteroidetes (F/B ratio) exerts a significant impact on maintaining normal intestinal homeostasis, and either an increase or decrease in the F/B ratio is regarded as dysbiosis (Stojanov et al., 2020). Our results showed that PM treatment altered the F/B ratio, whereas supplementation with SBE counteracted its effect on the F/B ratio and preserved normal intestinal homeostasis. Previous studies have found that supplementation with Scutellaria baicalensis or its extracts can modulate the composition of the microbial community, inhibit the proliferation of harmful bacteria, and increase the abundance of beneficial bacteria (Ma et al., 2026; Zhang et al., 2025c). Bacterial genera, including Rikenellaceae_RC9_gut_group, Bacteroides, Ruminococcus_torques_group, and Ruminococcus, are core members of the intestinal microbiota. Reduced abundances of these genera may not only decrease the production of key short-chain fatty acids such as butyrate, thereby impairing intestinal mucosal repair and immune development, but also diminish gut microbial diversity and compromise the stability and stress resistance of the intestinal microbes (Christopherson et al., 2014; Liu et al., 2024; Luo et al., 2025; Zafar and Saier, 2021). However, in this study, the significantly lower abundances of these bacterial genera were observed in the PM group compared with the control and SBE groups. This indicated that PM treatment may reduce the abundances of these genera, thereby impairing intestinal absorption and host immune function, whereas SBE supplementation could partially reverse the adverse effects of PM treatment on microbial homeostasis and host health of laying hens. Additionally, previous studies have shown that the intestinal microbes of poultry can reach the oviduct through the cloaca (the end of the reproductive and digestive tract), thereby influencing the entire microbial community of the oviduct (Dai et al., 2023; Shterzer et al., 2020). Overall, these results indicated that supplementing SBE may improve the oviduct homeostasis and production performance of laying hens by regulating the composition of the intestinal microbiota.

Conclusion

In summary, this study provides an integrated network pharmacology and in vivo validation of the therapeutic efficacy of SBE against oviductal inflammation in laying hens. Mechanistically, three key components (the wogonin, baicalein, and baicalin) of SBE can alleviate oviductal inflammation by regulating the PI3K-AKT1 pathway and restoring intestinal microbial balance (Fig. 6). This study offers novel insights for the development of plant-derived feed additives to improve reproductive health and extend the laying cycle in poultry.

Fig. 6.

Scutellaria baicalensis extract alleviate oviductal inflammation in laying hens via PI3K-AKT1 pathway modulation and intestinal microbiota restoration.

Data availability statement

The datasets of this study are available from the corresponding author on reasonable request.

Ethics statement

The methodologies complied with the applicable guidelines and regulations, and the Animal Care and Use Committee of the Institute of Feed Research of the Chinese Academy of Agricultural Sciences approved the experimental protocol (approval No. AEC—CAAS-20230502).

CRediT authorship contribution statement

Peiyu Huang: Writing – original draft, Formal analysis, Conceptualization. Pengzu Wang: Investigation. Haijun Zhang: Methodology. Guanghai Qi: Supervision. Dong Dai: Writing – review & editing, Supervision, Methodology, Funding acquisition. Jing Wang: Writing – review & editing, Supervision, Funding acquisition, Conceptualization.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.