Heterologous expression, immunogenic evaluation, and subunit vaccine potential of the σC protein from the Xinjiang avian reovirus (ARV) strain xj-1.1

Abstract

Avian reovirus (ARV) causes a range of diseases in poultry and results in significant economic losses for the poultry industry. To address the epidemic of ARV infection in yellow-feathered broilers in Xinjiang, this study conducted genetic and evolutionary analyses of a chicken-origin ARV field strain, designated ARV xj-1.1. The σC gene of this strain was expressed in vitro using both Escherichia coli and Pichia pastoris systems to compare expression characteristics and immunogenicity. Phylogenetic analysis revealed that ARV xj-1.1 belongs to genotype IV. The σC gene was successfully cloned and efficiently expressed in both prokaryotic and eukaryotic systems. After purification by nickel affinity chromatography, recombinant proteins pET-σC and GS115/pPIC9K-σC were obtained. Post-translational modification analysis indicated that neither recombinant protein exhibited glycosylation; however, phosphorylation levels differed, with values of 5.9% and 21.7%, respectively. Immunogenicity evaluation showed that both recombinant proteins induced high antibody titers in mice (1:51,200 for pET-σC and 1:102,400 for GS115/pPIC9K-σC). In immunized chicks, antibody levels peaked in the third week post-vaccination, and neutralizing antibody titers were significantly higher than in the control group (P < 0.01). Challenge experiments confirmed that vaccinated chicks exhibited no clinical symptoms or gross lesions, whereas the challenged controls displayed classic signs such as depression, swollen footpads, and visceral hemorrhage. These results demonstrate that the σC protein possesses strong potential as a subunit vaccine antigen. Although the eukaryotically expressed protein exhibited higher phosphorylation, the prokaryotically expressed σC protein induced a stronger neutralizing antibody response. This study provides a theoretical and experimental foundation for the development of regional ARV subunit vaccines and has important implications for controlling ARV infections among poultry in Xinjiang.

Introduction

The yellow-feathered broiler is widely raised and consumed in Xinjiang due to its suitability for preparing local specialty dishes such as Da Pan Ji (Xinjiang Big Plate Chicken) and Spicy Chicken. With the growing demand for broiler meat, cases of avian viral arthritis (AVA) caused by avian reovirus (ARV) infection in yellow-feathered broilers have also increased in the region. This disease has severely affected the development of the poultry industry and caused substantial economic losses. Although several commercial ARV vaccines are currently used in broilers, increasing genetic divergence between vaccine strains and circulating field strains has led to incomplete protection against infection (Mosad et al., 2023). Consequently, the prevalence of ARV has continued to rise in recent years (Kimera et al., 2024). ARV was first described and isolated in 1959 and primarily infects commercial chickens and turkeys (Sellers, 2023). It is the etiological agent responsible for arthritis and tenosynovitis in poultry. ARV is an icosahedral, double-stranded RNA virus with a diameter of approximately 80 nm, belonging to the genus Orthoreovirus within the family Reoviridae (Mase et al., 2021; Nour and Mohanty, 2024). Its genome comprises 10 segments, which are categorized based on electrophoretic mobility into three size classes: large (L1, L2, L3), medium (M1, M2, M3), and small (S1, S2, S3, S4), encoding a total of 12 (Jiang et al., 2023). Among these, the σC protein encoded by the S1 segment is a highly immunogenic structural protein involved in cell attachment. It is a major virulence factor of ARV and contains multiple antigenic epitopes that elicit strong neutralizing antibody responses. Therefore, σC is considered the preferred target protein for developing diagnostic assays and subunit vaccines against avian reovirus.

In this study, the complete genome sequence of the Xinjiang ARV strain xj-1.1 was determined to elucidate its genetic evolution. The σC gene of this epidemic strain was successfully expressed using both prokaryotic and eukaryotic (Pichia pastoris) expression systems. The purified recombinant protein, when emulsified with an adjuvant and administered to chicks, elicited a favorable immune response. These findings provide a foundation for developing diagnostic tools and subunit vaccines against ARV.

Materials and Methods

Strains, Plasmids, and Reagents

The plasmids pET-32a(+) and pPIC9K were preserved in the Preventive Veterinary Medicine Laboratory, College of Animal Science, Shihezi University (Xinjiang, China). Pichia pastoris strain GS115 (Beyotime, D0412, Shanghai, China), Escherichia coli DH5α competent cells (Sangon Biotech, B528413-0100, Shanghai, China), and E. coli BL21(DE3) cells (Sangon Biotech, B528414-0100, Shanghai, China) were used for cloning and expression.

Major reagents included: T4 DNA ligase, restriction enzymes (EcoRI, HindIII, NotI, SalI), and DNA marker (Takara, Dalian, China); Coomassie Brilliant Blue staining solution, BCA protein assay kit, IPTG, ampicillin, G418 sulfate, anti-His monoclonal antibody, HRP-conjugated goat anti-mouse IgG, DAB chromogenic kit, Ni-NTA agarose, and protein marker (Solarbio, Beijing, China); plasmid extraction and DNA gel recovery kits (OMEGA, USA; Vazyme, Nanjing, China); PAGE gel preparation kit (Yamei, Shanghai, China); ELISA reagents including TMB substrate, coating buffer, HRP-labeled rabbit anti-chicken IgG, and 5% skim milk blocking buffer (Solarbio, Beijing, China).

Full-Genome Sequencing of ARV xj-1.1

The F4-generation viral cell culture of ARV xj-1.1 was submitted to Wuhan GeneCreate Biological Engineering Co., Ltd. (Wuhan, China) for full-genome sequencing. The nucleotide sequence of the σC gene was aligned with that of representative ARV strains in GenBank using MEGA 11. A phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replications to determine genetic relationships and mutations.

Amplification of the σC Gene

Based on the full-genome sequencing results, primers were designed using Primer Premier 5.0. For prokaryotic expression, EcoRI and HindIII restriction sites were introduced into the forward and reverse primers, respectively. For eukaryotic expression, the forward primer included an EcoRI site and a 6 × His tag, while the reverse primer contained a NotI site (Table 1). Viral RNA was extracted from the ARV xj-1.1-infected cell supernatant and reverse-transcribed to cDNA. PCR amplification was carried out in a 50 µL reaction containing 25 µL of 2 × Taq PCR SuperMix, 1 µL each of upstream and downstream primers (10 µmol/L), 4 µL of cDNA template, and nuclease-free water. The reaction conditions were as follows: 94°C for 5 min; 34 cycles of 94°C for 10 s, 61°C for 15 s, and 72°C for 1 min; followed by a final extension at 72°C for 10 min. PCR products were visualized by 1% agarose gel electrophoresis, purified, and ligated into the pMD19-T (Simple) vector for sequencing. The recombinant plasmid was designated pMD19T-σC.

Table 1.

Primer Information.

Gene	Primer	sequence (5’-3’)	Length
YH-σC	F1	GGAATTCGTGACTATAAATCCTGGCGATTTG	915bp
	R1	CAAGCTTTTAGGTATCGATGCCCGTACG
ZH-σC	F2	GAATTCGTGCATCATCATCATCATCATACTATAAATCCTGGCGATTTG	915bp
	R2	ATTTGCGGCCGCTTAGGTATCGATGCCCGTACG
AOX1	F3	GACTGGTTCCAATTGACAAGC	2138bp
	R3	GCAAATGGCATTCTGACATCC

Note: Single underlining indicates restriction enzyme recognition sites, and double underlining indicates the histidine (His) tag sequence in the primers.

Construction of the Prokaryotic Expression Vector

The recombinant plasmids pMD19T-σC and pET-32a(+) were double-digested with EcoRI and HindIII, purified, and ligated with T4 DNA ligase at 16°C overnight. The ligation product was transformed into E. coli DH5α competent cells and screened on LB agar plates containing ampicillin (100 µg/mL). Positive clones were verified by colony PCR, double digestion, and sequencing. The confirmed recombinant plasmid was named pET-σC.

Expression and Purification of Recombinant pET-σC Protein

The recombinant plasmid pET-σC was transformed into E. coli BL21(DE3) cells. A positive colony was inoculated into LB medium containing ampicillin and induced with 1 mM IPTG for 8 h at 37°C. Bacterial pellets were collected, resuspended in lysis buffer, subjected to freeze–thaw cycles, and ultrasonicated. The supernatant was analyzed by SDS–PAGE. The recombinant σC protein was purified using Ni-NTA affinity chromatography and concentrated using dialysis against sucrose. Protein purity was evaluated by SDS–PAGE and confirmed by Western blot using anti-His monoclonal antibody (1:2000) and HRP-conjugated secondary antibody (1:5000).

Construction of the Eukaryotic Expression Vector

The σC gene and pPIC9K vector were double-digested with EcoRI and NotI, purified, and ligated using T4 DNA ligase at 16°C overnight. The recombinant plasmid was transformed into E. coli DH5α cells and selected on ampicillin-containing LB plates. Positive clones were confirmed by double digestion and sequencing and designated as pPIC9K-σC.

Transformation and Screening of Recombinant Pichia pastoris

Recombinant pPIC9K-σC plasmid DNA was linearized and transformed into P. pastoris GS115 cells by electroporation. Transformants were screened on YPD agar plates supplemented with varying concentrations of G418 (0.5–3.0 mg/mL) to assess resistance levels. Colonies growing on 3 mg/mL G418 were selected and verified by PCR using ZH-σC and AOX1 primer pairs to confirm the integration of the σC gene into the yeast genome.

Expression and Purification of Recombinant GS115/pPIC9K-σC Protein

Positive GS115/pPIC9K-σC transformants were cultured in YPD medium and induced in BMGY medium with 1% methanol supplementation every 24 h for 96 h. The culture supernatant was collected and precipitated using the TCA–acetone method. The resulting proteins were analyzed by SDS–PAGE and purified by Ni-NTA affinity chromatography. Western blotting was performed using mouse anti-σC polyclonal antibody (1:1000) and HRP-conjugated goat anti-mouse IgG (1:3000).

Protein Quantification and Modification Analysis

Protein concentrations were determined using a BCA protein assay kit at an absorbance wavelength of 562 nm. Post-translational modifications were assessed using a glycoprotein staining kit (periodic acid–Schiff method) and a phosphorylation assay kit.

The periodic acid-Schiff (PAS) method was employed for glycoprotein staining, using the Glycoprotein Stain Kit purchased from Realjimes Biotechnology Co., Ltd. (Beijing, China) (catalog number: RTD6501). The detailed procedures were as follows: (1) Pretreatment: The SDS-PAGE gel was immersed in methanol solution and incubated with gentle shaking on a rocking platform for 30 min. After discarding the methanol, the gel was washed twice with ultrapure water (10 min per wash); (2) Oxidation: 25 mL of oxidation reagent was added to the gel, followed by 15 min of gentle shaking. The reagent was then discarded; (3) Rinsing: The gel was rinsed three times with 50 mL of ultrapure water (5 min per rinse) to completely remove residual oxidation reagent; (4) Reduction: 25 mL of reduction reagent was added, and the gel was incubated with gentle shaking for 15 min. The reagent was discarded (a slight red background of the gel was observed at this stage); (5) Staining: 25 mL of glycoprotein staining reagent was added, and the gel was incubated with gentle shaking in the dark until the bands of the positive control became distinct (60 min); (6) Termination and Storage: The staining reagent was discarded, and the gel was rinsed with ultrapure water. The gel was then soaked in 3% acetic acid solution for storage; glycoproteins were visualized as magenta bands against a pale pink or colorless background.

Phosphorylation level (%) was calculated according to the manufacturer’s protocol.

Phosphorylation levels were quantified using the formula provided by the Phosphorylation Assay Kit (purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number: C500061):

N (Protein phosphorylation level%) = (X × 2.24% × A)/(B × 31)

Where:

• N: Molar percentage of phosphorus per mole of the target phosphorylated protein;

• A: Molecular weight of the target protein (g/mol);

• B: Total protein concentration of the sample (μg/mL);

• X: Phosphorylated protein concentration of the sample (μg/mL);

Note: The phosphorylation level of the phosphorylated standard protein used in this assay was 2.24%.

Immunogenicity Evaluation in Mice

BALB/c mice (6 weeks old) were immunized subcutaneously with 100 µg of purified pET-σC or GS115/pPIC9K-σC protein emulsified with an equal volume of Freund’s complete adjuvant. Booster immunizations were administered on day 14 (with incomplete Freund’s adjuvant) and day 21. Serum samples were collected on day 28, centrifuged, and stored at −80°C. Control sera were obtained from unvaccinated mice. Antibody titers were determined by indirect ELISA (Fig. 1).

Fig. 1.

Immunization Protocol in Mice.

Immunization and Challenge Test in Chickens

Four-week-old specific-pathogen-free (SPF) chickens were randomly divided into four groups (n = 7 per group). Two booster immunizations were administered to the chicks on days 14 and 28 post-primary immunization. A normal control group, a prokaryotic protein immunization group, a eukaryotic protein immunization group, and a challenge control group. Each bird in the immunized groups received an intramuscular injection in the leg containing 80 µg of recombinant σC protein (either pET-σC or GS115/pPIC9K-σC) emulsified 1:1 with Freund’s adjuvant. Fourteen days after vaccination, all groups except the normal control were challenged with the virulent ARV xj-1.1 field strain at a dose of 0.2 mL (10^4.6 TCID₅₀ per 0.1 mL; total dose: 2 × 10⁴.⁶ TCID₅₀). The challenge inoculum was administered into the left footpad, while the right footpad served as a self-control. Birds in the uninfected control group were injected with an equal volume of sterile physiological saline.

Clinical signs, particularly swelling and inflammation of the footpad, were monitored beginning 2 h post-challenge. Grading Criteria for Clinical Symptoms: A 0-3-grade scoring system was adopted for footpad swelling: Grade 0 = no swelling; Grade 1 = mild swelling (increase in thickness ≤ 2 mm compared with the normal state); Grade 2 = moderate swelling (increase in thickness 2-4 mm compared with the normal state); Grade 3 = severe swelling (increase in thickness > 4 mm compared with the normal state or presence of ulceration); Depression was assessed as "present" or "absent" based on the degree of reduced activity and decreased feed intake of the animals.At 3 days post-infection, the chickens were euthanized, and the footpad, thymus, and liver were necropsied to evaluate gross pathological lesions such as redness, hemorrhage, and tissue edema. Grading Criteria for Pathological Lesions: Grade 0 = no obvious lesions; Grade 1 = mild hemorrhage (number of focal hemorrhagic spots ≤ 5); Grade 2 = moderate hemorrhage (number of focal hemorrhagic spots 5-10 or diffuse erythema of the tissue); Grade 3 = severe hemorrhage (diffuse hemorrhagic area covering > 50% of the tissue surface).

Neutralization Test

Serum samples collected at different time points were inactivated at 56°C for 30 min and filtered through 0.22 µm membranes. Serial twofold dilutions of sera were mixed with 200 TCID₅₀ of ARV and incubated at 37°C for 1 h. The virus–serum mixtures were inoculated into LMH cell monolayers in 96-well plates, with four replicates per dilution. After 5 days of incubation, cytopathic effects were recorded, and neutralizing antibody titers were calculated using the Reed–Muench method.

Results

Genome Sequencing and Phylogenetic Analysis of ARV xj-1.1

The complete genome of ARV xj-1.1 was successfully assembled and annotated (Table 2). Sequence analysis revealed that the strain contains 10 double-stranded RNA genome segments encoding 12 viral proteins (Table 3). Phylogenetic comparison of the σC gene with representative sequences available in GenBank indicated that ARV xj-1.1 is most closely related to strains MF183217 (Avian orthoreovirus isolate LY383 segment S1, complete sequence - Nucleotide - NCBI) and MN879710 (Avian orthoreovirus isolate D12 segment S1, complete sequence - Nucleotide - NCBI), belonging to genotype IV. The strain showed clear genetic divergence from the classical vaccine strains S1133, 2408, and 1733, suggesting potential antigenic variation and reduced cross-protection by the vaccine (Fig. 2).

Table 2.

Genome assembly statistics of ARV xj-1.1.

Sample	Total Bases (Mb)	Number of contigs	Maximum Length	Minimum Length	N50	GC (%)	Read Utilization (%)
ARV xj-1.1	2.88	4668	6205	300	607	52.37	96.42

Table 3.

Gene prediction results for ARV xj-1.1.

Sample	Total Sequence Length (KB)	Number of genes	Maximum Length	Minimum Length	Average GC (%)
ARV xj-1.1	22.54	12	3882	291	48.42

Fig. 2.

Phylogenetic tree of the Xinjiang ARV xj-1.1 strain.

Amplification and Cloning of the σC Gene

Total RNA was extracted from ARV xj-1.1-infected cells and reverse-transcribed into cDNA to serve as a template for amplification of the complete σC gene. PCR generated a specific 915-bp fragment, consistent with the expected size of the σC gene, confirming successful amplification (Fig. 3A). The amplified fragment was ligated into the pMD19-T (Simple) cloning vector to generate the recombinant plasmid pMD19T-σC. Double digestion of the plasmid with EcoRI and HindIII produced two fragments—one corresponding to the 2,692 bp vector backbone and the other to the 915 bp insert—verifying that the target gene had been correctly inserted into the pMD19-T vector (Fig. 3B).

Fig. 3.

RT-PCR amplification of the σC gene (A) and double-enzyme digestion identification of the recombinant plasmid pMD19T-σC (B). Note: (A) M1, DNA marker DL2000; Lanes 1–3, σC gene amplification products(915bp); Lane 4, negative control. (B) M2, Trans 8k DNA marker; Lanes 1 and 4, undigested pMD19T-σC plasmid; Lanes 2 and 3, double-digested pMD19T-σC products(vector backbone: 2692 bp; insert: 915 bp).

Prokaryotic Expression and Identification of Recombinant σC Protein

The σC gene was ligated into the pET-32a(+) expression vector, and the recombinant construct was verified by double-enzyme digestion. Electrophoresis revealed two distinct DNA bands—a 5,900 bp fragment corresponding to the pET-32a(+) backbone and a band matching the expected size of the σC insert—confirming that the target gene was successfully integrated into the expression vector (Fig. 4). The ligation product was transformed into E. coli BL21(DE3) competent cells, cultured overnight, and screened by PCR to identify positive pET-σC clones. Recombinant plasmids were further validated by double-digestion and sequencing.

Fig. 4.

Double-enzyme digestion identification of the recombinant plasmid pET-σC. Note: M, DNA marker 8k; Lane 1, double-digested pET-σC product; Lane 2, undigested pET-σC plasmid.

Following IPTG induction, SDS-PAGE analysis revealed a distinct protein band at approximately 49 kDa, consistent with the predicted molecular weight of the recombinant σC protein. This confirmed successful expression of the target protein in E. coli BL21(DE3).

Western blot analysis further demonstrated that the recombinant σC protein was specifically recognized by the anti-His monoclonal antibody, indicating that the expressed protein possessed correct antigenic epitopes and strong immunoreactivity. These results confirm that the σC protein was efficiently expressed and retained its native antigenic properties in the prokaryotic expression system (Fig. 5).

Fig. 5.

SDS-PAGE and Western blot analysis of the recombinant pET-σC protein. Note: (A) M1, protein molecular weight standard (120 kDa); Lane 1, pET-32a(+) empty vector induced for 6 h; Lanes 2–6, recombinant bacteria induced for 2, 4, 6, 8, and 10 h; Lane 7, purified recombinant protein. (B) M2, protein molecular weight standard (100 kDa); Lane 1, purified recombinant pET-σC protein.

Eukaryotic Expression and Verification in Pichia pastoris

The σC gene was ligated into the eukaryotic expression vector pPIC9K, and the recombinant plasmid was verified by double-enzyme digestion. Electrophoresis analysis revealed two bands: a 9,276 bp fragment corresponding to the pPIC9K vector backbone and a band representing the σC gene insert. The fragment sizes were consistent with the expected theoretical values, confirming that the σC gene had been successfully inserted into the pPIC9K vector (Fig. 6).

Fig. 6.

Double-enzyme digestion identification of the recombinant plasmid pPIC9K-σC. Note: M: DNA marker 8k; Lane 1: undigested pPIC9K-σC plasmid; Lane 2: double-digested pPIC9K-σC product.

Single colonies grown on MD plates were transferred to YPD agar plates containing different concentrations of G418 (0.5, 1, 2, and 3 mg/mL) for resistance screening. Colonies grown on YPD plates containing 3 mg/mL G418 were selected for PCR-based identification (Fig. 7).

Fig. 7.

Screening of recombinant Pichia pastoris GS115/pPIC9K-σC1.1 colonies. Note: A: MD plate containing recombinant GS115/pPIC9K-σC colonies; B-E: YPD plates containing 0.5, 1, 2, and 3 mg/mL G418, respectively; F: MD plate of GS115/pPIC9K cells harboring the empty vector.

PCR amplification with ZH-σC primers yielded a specific 915-bp product from the recombinant yeast, confirming the presence of the target gene (Fig. 8A). In the GS115/pPIC9K control strain, two bands were amplified: a 2.2 kb band corresponding to the AOX1 gene and a 492 bp fragment representing the pPIC9K-AOX1 flanking sequence (Fig. 8B). In contrast, the GS115/pPIC9K-σC recombinant strain produced both the 2.2 kb AOX1 band and the σC–AOX1 junction fragment. These results confirmed that the σC gene had been successfully integrated into the P. pastoris genome.

Fig. 8.

PCR identification of recombinant Pichia pastoris GS115/pPIC9K-σC. Note: (A) PCR identification of recombinant yeast transformants; (B) PCR verification of GS115/pPIC9K-σC using AOX1 universal primers. M, DNA marker DL2000; (A) lanes 1–7, PCR results of recombinant transformants; lane 8, negative control; (B) lanes 1–3, methanol-induced Mut⁺-type recombinant GS115/pPIC9K-σC strains; lane 4, GS115/pPIC9K empty-vector control.

SDS-PAGE analysis revealed a distinct protein band at approximately 44 kDa in the culture supernatant of induced Pichia pastoris GS115/pPIC9K-σC, whereas no corresponding band was observed in the culture supernatant of the pPIC9K empty-vector control after 72 h of induction. Western blot analysis confirmed that the recombinant σC protein was specifically recognized by anti-σC antibodies, demonstrating that the expressed protein exhibited strong antigenicity and was successfully expressed in the yeast system (Fig. 9).

Fig. 9.

SDS-PAGE and Western blot analysis of the recombinant σC protein. Note: M, protein molecular weight standard (200 kDa). (A) lane 1, supernatant from pPIC9K empty-vector culture induced for 72 h; lanes 2–5, culture supernatants of recombinant strains induced for 24, 48, 72, and 96 h, respectively; lane 6, purified recombinant protein. (B) lane 1, purified recombinant GS115/pPIC9K-σC protein.

Determination of Protein Concentration

Using the BCA assay (Fig. 10), standard curves were constructed to calculate protein concentration. The purified prokaryotic recombinant σC protein (pET-σC) yielded a concentration of 2.23 mg/mL, while the eukaryotic recombinant protein (pPIC9K-σC) reached 0.48 mg/mL, indicating efficient expression in both systems, with a higher yield from the prokaryotic system.

Fig. 10.

BCA Standard Curve.

Analysis of Post-Translational Modifications of Recombinant σC Proteins

SDS-PAGE analysis combined with glycoprotein staining revealed a distinct glycoprotein band in the positive control (horseradish peroxidase, HRP), whereas no glycoprotein bands were detected in either recombinant pET-σC or pPIC9K-σC proteins (Fig. 11). This result indicates that recombinant σC proteins lacked detectable glycosylation modifications. Phosphorylation analysis showed that the phosphorylation level of the pET-σC protein was 5.9%, while that of the pPIC9K-σC protein reached 21.7%, demonstrating a higher degree of phosphorylation in the eukaryotically expressed protein (Fig. 12).

Fig. 11.

SDS-PAGE identification of glycoprotein modification in recombinant σC proteins. Note: M, protein molecular weight standard (120 kDa); lane 1, pPIC9K-σC protein; lanes 2–3, negative control (soybean trypsin inhibitor, non-glycosylated protein); lane 4, positive control (HRP, 16% glycosylation); lane 5, recombinant pET-σC protein.

Fig. 12.

Standard curve for phosphorylation level determination of recombinant σC proteins.

Immunogenicity Verification of Recombinant σC Proteins

The results showed that all serum samples from the immunized groups were positive, whereas those from the control group were negative. The antibody titers of the anti-pET-σC and anti-GS115/pPIC9K-σC polyclonal sera reached 1:51,200 and 1:102,400, respectively (Fig. 13). These findings indicate that recombinant σC proteins effectively stimulated specific antibody production in mice, demonstrating strong immunogenicity.

Fig. 13.

Analysis of polyclonal antibody titers against (A) pET-σC and (B) GS115/pPIC9K-σC recombinant proteins.

Antibody Response in Chickens after Immunization

Four-week-old chickens were immunized with recombinant σC proteins, and blood samples were collected weekly from the wing vein to separate serum. Antibody levels in serum were measured by indirect ELISA to monitor dynamic changes in the immune response. The results showed that antibody levels in both the pET-σC and GS115/pPIC9K-σC immunization groups increased steadily after vaccination, peaking at the third week. Compared with the control group, the differences were highly significant (p < 0.001). Moreover, the antibody levels in the pET-σC and GS115/pPIC9K-σC groups were significantly different (p < 0.001). No increase in antibody level was observed in the unvaccinated control group, confirming the specificity of the immune response induced by the recombinant σC proteins (Fig. 14).

Fig. 14.

Changes in antibody levels of chickens following immunization with recombinant σC subunit vaccines.

Neutralizing Antibody Titer Analysis

The results showed that both the pET-σC and GS115/pPIC9K-σC immunization groups produced specific neutralizing antibodies, and the antibody titers increased progressively with time after vaccination. The neutralizing antibody titer in the pET-σC-immunized group was significantly higher than that in the GS115/pPIC9K-σC group (p < 0.01), indicating that the prokaryotically expressed σC protein induced a stronger neutralizing immune response in chickens (Fig. 15). Fig. 16, Fig. 17, Fig. 18, Fig. 19

Fig. 15.

Changes in neutralizing antibody titers of chickens following immunization with recombinant σC subunit vaccines.

Fig. 16.

Clinical symptoms in the footpad and tarsal joint of chickens after challenge with the ARV xj-1.1 strain. (A, normal control group; B, prokaryotic protein immunization group; C, eukaryotic protein immunization group; D, challenge control group).

Fig. 17.

Gross pathological changes in the footpad of chickens after challenge with the ARV xj-1.1 strain.

Fig. 18.

Hemorrhagic lesions in the spleen of chickens after challenge with the ARV xj-1.1 strain. (From left to right: A, normal control group; B, prokaryotic protein immunization group; C, eukaryotic protein immunization group; D, challenge control group).

Fig. 19.

Gross pathological changes in the liver of chickens after challenge with the ARV xj-1.1 strain. (From left to right: A, normal control group; B, prokaryotic protein immunization group; C, eukaryotic protein immunization group; D, challenge control group).

Clinical Symptoms and Pathological Changes after Challenge

Four-week-old chickens were immunized with the recombinant σC subunit vaccines and challenged with the virulent ARV xj-1.1 strain 14 days post-immunization. After the challenge, chickens in the control group exhibited typical clinical signs of ARV infection, including depression, footpad swelling, and visible redness on dissection. Necropsy revealed hemorrhagic lesions in the thymus and liver. In contrast, chickens in normal control, pET-σC immunization, and GS115/pPIC9K-σC immunization groups showed no clinical symptoms or pathological changes, indicating that immunization with the recombinant σC proteins conferred effective protection against ARV xj-1.1 infection.

Discussion

ARV possesses a double-layered capsid structure, with the σC protein encoded by the third open reading frame of the S1 genome segment. This protein is assembled on the viral outer surface, directly exposed to the external environment, and plays multiple roles during viral infection and replication. During host cell entry, ARV relies on the σC protein to recognize and bind cell-surface receptors, which then undergo endocytosis, thereby initiating viral replication. As the major determinant of virulence and antigenic variation, σC is critical for strain characterization. It is the most variable protein among ARV components and is regarded as the only surface antigen capable of eliciting strain-specific neutralizing responses (Zheng et al., 2025). Due to its abundance of protective epitopes, σC represents an ideal target for the development of diagnostic reagents and subunit vaccines. In prior reports, the σC protein has been successfully heterologously expressed in various expression systems, including bacterial, baculovirus, yeast, plant, and mammalian cell systems (Grose et al., 2021; Hong et al., 2022; Watts et al., 2021). To date, systematic comparative studies evaluating the immunological potency of σC proteins produced by prokaryotic versus eukaryotic expression systems have not been documented. Notably, previous studies have demonstrated that σC proteins expressed in bacterial systems exhibit strong immunogenicity (Diaz-Dinamarca et al., 2020). Although several commercial ARV vaccines are used in layer and breeder flocks, the emergence of genetically mutated strains with enhanced virulence and altered antigenicity has led to a growing prevalence of ARV infections (Gallardo, 2022). Vaccines based on classical strains such as S1133 have shown markedly reduced or even lost protective efficacy, contributing to widespread outbreaks. Therefore, there is an urgent need to develop new diagnostic tools and vaccines to effectively control ARV infection.

Common heterologous gene expression systems include prokaryotic systems, primarily using bacteria, and eukaryotic systems, commonly using yeast cells (Baghban et al., 2019). The prokaryotic expression system offers several advantages—rapid cell growth, high protein yield, and simple operation—but it also has notable drawbacks. These include misfolding of heterologous proteins, contamination with endotoxins, and the absence of post-translational modification mechanisms (Niazi and Magoola, 2023). As a result, most expressed proteins aggregate into inclusion bodies, necessitating complex refolding procedures to restore their native conformation and biological activity. To overcome these limitations, yeast expression systems were developed in 1979. Yeast cells combine the benefits of prokaryotic expression (ease and efficiency) with the ability to perform correct protein folding and post-translational modifications (Lv and Cai, 2025). In this study, Pichia pastoris was employed as the eukaryotic expression host due to its tightly regulated expression system and strong promoter, which enables efficient transcription and translation of the target gene while minimizing background expression of endogenous proteins. The P. pastoris strain GS115 utilizes two alcohol oxidase genes, AOX1 and AOX2, to metabolize methanol. When methanol is used as the sole carbon source, the AOX1 promoter is strongly induced, whereas the AOX2 promoter is only weakly induced (Wang et al., 2024). Consequently, GS115 is classified as a methanol-slow-utilizing strain (Muts) (Muzaffar et al., 2025). When cultured with glucose or glycerol as the carbon source, Muts and Mut+ strains exhibit similar growth rates; however, with methanol as the carbon source, Mut+ strains grow significantly faster than Muts strains. Additionally, during protein translation, messenger RNA (mRNA) may undergo modifications such as 5′ capping and splicing, which influence both the speed and fidelity of translation.

In the preliminary stage of this study, a chicken-derived avian reovirus (ARV) field strain was successfully isolated and designated ARV xj-1.1(Ma et al., 2025). Phylogenetic analysis revealed that ARV xj-1.1 belongs to genotype IV and is considerably distant from the vaccine reference strains S1133, 2408, and 1733, which are located on different phylogenetic branches. This suggests substantial antigenic differences between the field strain and existing vaccine strains, indicating that current ARV vaccines may no longer provide effective protection in the Xinjiang region and that development of new vaccines is urgently needed. The σC gene of ARV xj-1.1 was expressed using both a prokaryotic (E. coli) and an eukaryotic (Pichia pastoris) expression system. Recombinant proteins pET-σC and GS115/pPIC9K-σC were successfully obtained from both systems. During the screening of recombinant P. pastoris transformants, preliminary selection of Mut⁺ and Mutˢ phenotypes was performed using MD and MM media, followed by identification with universal AOX1 primers according to the yeast expression manual. Colonies showing two bands were confirmed as Mut⁺ strains. SDS-PAGE analysis revealed that the eukaryotically expressed σC protein had a smaller apparent molecular weight than predicted. Previous studies have demonstrated that high phosphorylation levels mediated by eukaryotic expression systems are more conducive to proteins adopting conformations closer to the native state (Seok, 2021). However, for the full-length σC protein, the similarity between its conformation and the native state is not positively correlated with its immunogenicity or ability to induce neutralizing antibodies. A previous study by clearly confirmed that the 122-326 amino acid fragment of the σC protein exhibits significantly higher immunogenicity than the full-length σC protein, and the core mechanism is that the N-terminal 1-121 amino acid sequence of the σC protein contains immunosuppressive elements (De Matos et al., 2024). Therefore, in the present study, the low phosphorylation modification of the prokaryotically expressed σC protein prevents the immunosuppressive element from forming a functional fold, thereby endowing it with superior immunogenicity and neutralizing antibody-inducing capacity compared to the eukaryotically expressed full-length σC protein.

To evaluate immunogenicity, both recombinant proteins were emulsified with adjuvant (1:1, v/v) and administered subcutaneously to mice. Serum antibody titers were determined by indirect ELISA. The results demonstrated strong immune responses: mice immunized with pET-σC produced antibodies with titers up to 1:51,200, whereas those immunized with GS115/pPIC9K-σC achieved titers of up to 1:102,400. These findings indicate that both recombinant proteins are highly immunogenic and capable of eliciting protective immune responses. Overall, successful expression of σC proteins in both prokaryotic and eukaryotic systems provides essential materials for the development of ARV diagnostic reagents and subunit vaccines, and establishes a foundation for further investigation into the functional mechanisms of the ARV σC protein. Four-week-old chicks were immunized by intramuscular injection in the leg with emulsions of ARV xj-1.1 recombinant proteins pET-σC and GS115/pPIC9K-σC mixed 1:1 with Freund’s adjuvant. Blood samples were collected weekly from the wing vein after immunization, and serum was separated to monitor antibody dynamics by indirect ELISA. The results showed that antibody levels in both the pET-σC and GS115/pPIC9K-σC groups peaked at week three, with significantly higher titers than the control group. Moreover, a significant difference was observed between the two immunized groups (P < 0.001). As the immunization period progressed, both groups developed specific neutralizing antibodies, with the pET-σC group exhibiting significantly higher neutralizing titers than the GS115/pPIC9K-σC group (P < 0.01). Fourteen days after the final immunization, chicks were challenged with the ARV xj-1.1 strain. Birds in the challenge control group displayed clinical symptoms such as depression and footpad swelling, with necropsy revealing redness and swelling of the footpad and hemorrhages in the thymus and liver. In contrast, the blank control group and both immunized groups (pET-σC and GS115/pPIC9K-σC) showed no visible clinical signs or gross pathological changes, confirming effective protection conferred by the immunization.

The diagnosis of ARV infection relies on detecting the virus in clinical samples. Various laboratory methods have been developed to detect anti-ARV antibodies, including serum neutralization tests, agar gel diffusion assays, immunoblotting, and immunofluorescence assays. Although these methods are valuable for confirming ARV infection, most are labor-intensive, time-consuming, and not suitable for large-scale screening. In contrast, ELISA offers several advantages, including high sensitivity, high specificity, cost-effectiveness, and suitability for large-scale applications, making it the preferred method for screening large numbers of serum samples. In this study, recombinant ARV xj-1.1 proteins pET-σC and GS115/pPIC9K-σC were evaluated as coating antigens for the development of an indirect ELISA. Following systematic optimization, the pET-σC recombinant protein yielded the most stable and reproducible results. The optimal assay parameters were established as follows: antigen coating dilution, 1:100; serum dilution, 1:1600; coating conditions, incubation at 37°C for 1 h followed by overnight incubation at 4°C; blocking buffer, 5% skim milk; blocking time, 2 h; serum incubation time, 1.5 h; horseradish peroxidase (HRP)–conjugated secondary antibody dilution, 1:1000; secondary antibody incubation time, 2 h; and color development time, 20 min. The positive/negative cutoff value was set at 0.121. This optimized ELISA demonstrated high specificity, sensitivity, and reproducibility, confirming its suitability for detecting antibodies against the ARV xj-1.1 field strain and providing a reliable diagnostic tool for epidemiological surveillance and laboratory confirmation of ARV infection in poultry.

Prevention of ARV infection relies on strict biosecurity measures, including thorough cleaning and disinfection of barns and equipment, as well as effective pest control. In commercial poultry production systems, the all-in/all-out management approach is commonly adopted to prevent the mixing of birds of different ages or species, thereby minimizing viral transmission. Vaccination of breeder flocks serves as an additional control strategy by reducing vertical transmission and providing offspring with maternal antibodies. However, due to antigenic variation and mismatch between vaccine strains and emerging field isolates, current commercial vaccines fail to provide effective protection against newly evolved ARV variants, leading to an increasing prevalence of ARV infections (Liu et al., 2023). The immune failure associated with traditional vaccination poses significant challenges to the effective prevention and control of ARV. Therefore, the development of region-specific vaccines based on locally representative strains and covering distinct phylogenetic lineages may offer a more effective strategy for ARV control.

Animal use

The research was approved by the Institutional Review Board of Shihezi University (Approval number: A2024-152; Approval date: October 2024).

Funding

This research was funded by the Tianshan Talents Training Program, grant number 2024D14009; the China Postdoctoral Science Foundation (General Program), grant number 2023MD734234; and the Natural Science Foundation of Xinjiang Uygur Autonomous Region (Young Scientists Fund), grant number 2022D01B198.

CRediT authorship contribution statement

Weiqi Li: Writing – original draft, Data curation. Yayin Qi: Writing – review & editing, Methodology, Data curation, Conceptualization. Xin Ma: Methodology, Data curation. Lin Yang: Software, Methodology. Xinyu Dang: Software, Data curation. Zhipeng Zuo: Validation, Data curation. Xin Zheng: Validation, Data curation. Yuxin Zhang: Investigation. Yongjie Wang: Writing – review & editing, Supervision. Shilei Zhang: Supervision, Resources, Project administration, Methodology.

Disclosures

There is no conflict of interest.