WTAP stabilizes MMP12 expression to promote the malignant phenotypes of esophageal cancer cells

Abstract

Background

Esophageal cancer (EC) is a highly aggressive malignancy with a poor prognosis, largely due to its invasive nature and metabolic reprogramming. Matrix metalloproteinase 12 (MMP12) has been implicated in various cancers, but its specific regulatory mechanisms and functional impact on EC remain unclear. This study aimed to investigate the role of MMP12 in EC progression and its underlying regulatory mechanisms.

Methods

The GSE161533 dataset was analyzed to identify differentially expressed genes (DEGs) between EC and normal tissues, with a focus on genes linked to apoptosis, proliferation, and glycolysis via the GeneCards database. Key signature genes were further screened using lasso regression, support vector machine (SVM), and random forest (RF) algorithms. Gene expression was validated by quantitative real-time polymerase chain reaction and Western blotting. Cell migration and invasion were analyzed by transwell assays. Cell proliferation was analyzed by 5-Ethynyl-2′-deoxyuridine assay. Cell apoptosis was assessed by flow cytometry. Glucose consumption, lactate production, and ATP levels were analyzed by commercial kits. Flow cytometry was used to quantify the number of clusters of differentiation 68 (CD68)-positive cells and CD206-positive macrophages. The interaction between MMP12 and WT1 associated protein (WTAP) was examined using methylated RNA immunoprecipitation (MeRIP) and RNA immunoprecipitation (RIP) assays.

Results

MMP12 was identified as a key gene in EC tissues, and its expression was significantly upregulated in EC tissues and cells in comparison with normal samples. Knockdown of MMP12 suppressed migration, invasion, proliferation, and glycolysis while promoting apoptosis in KYSE150 and TE-10 cells. Additionally, MMP12 silencing inhibited M2 macrophage polarization. Mechanistically, WTAP stabilized MMP12 expression in an m6A-dependent manner. Further, silencing WTAP suppressed the malignant phenotypes of KYSE150 and TE-10 cells by downregulating MMP12 expression.

Conclusion

WTAP stabilized MMP12 expression via m6A modification, thereby enhancing the malignant phenotypes of EC cells. Clinically, targeting the WTAP-MMP12 axis could represent a promising therapeutic strategy to inhibit EC progression.

Graphical abstract

Highlights

• •MMP12 knockdown suppressed the migration, invasion, and proliferation of EC cells.
• •MMP12 silencing inhibited glycolysis and induced apoptosis in EC cells.
• •MMP12 silencing inhibited M2 macrophage polarization.
• •WTAP stabilized MMP12 expression in an m6A-dependent manner.

1. Introduction

According to the latest epidemiological data, esophageal cancer (EC) accounted for 2.6% of all new cancer diagnoses and 4.6% of all cancer-related deaths in 2022, highlighting its substantial disease burden [1]. Histologically, EC is primarily classified into esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma, with ESCC constituting approximately 90% of cases worldwide [2]. Due to the insidious and non-specific nature of early-stage symptoms, the majority of patients are diagnosed at an advanced stage. For these patients, treatment responses are limited, and the five-year survival rate is less than 25% [3]. Currently, a multidisciplinary treatment strategy for EC has been established, including surgical resection, radiotherapy, chemotherapy, and the more recent use of immune checkpoint inhibitors (ICIs). While the application of these therapies has improved patient survival to some extent, their clinical efficacy often remains unsatisfactory [4,5]. Therefore, to more effectively prevent and treat this malignancy, it is imperative to conduct an in-depth and comprehensive investigation into the molecular pathogenesis of EC and to identify novel therapeutic targets and biomarkers.

N6-methyladenosine (m6A), as the most prevalent and crucial internal chemical modification on mRNA, influences multiple core biological processes, including metabolism, tumorigenesis, and immune responses [6]. The deposition of m6A is catalyzed by a core methyltransferase complex, which includes key components such as METTL3, METTL14, and Wilms tumor 1-associated protein (WTAP) [7]. Concurrently, this modification can be reversed by the demethylases FTO and ALKBH5, thereby enabling precise control of RNA methylation levels [8]. Within the methyltransferase complex, WTAP is a nuclear protein associated with the WT1 gene, widely distributed throughout the nucleoplasm and often co-localizing with key proteins such as splicing factors [9,10]. Research indicates that WTAP acts as an oncogenic factor in various malignancies by mediating the m6A modification of target gene mRNAs. For instance, WTAP promoted colon adenocarcinoma progression by regulating the m6A methylation of KLK8 [11]. In prostate cancer, WTAP-mediated m6A modification suppressed the expression of ARG2 mRNA, thereby driving malignant tumor progression [12]. In hepatocellular carcinoma, WTAP promoted the m6A modification and translation of PD-1 mRNA, which accelerated the exhaustion of CD8⁺ T cells and consequently facilitated tumor immune escape and disease progression [13]. It has been reported that its high expression is positively correlated with tumor TNM staging and drive the malignant progression of EC [9].

Matrix metalloproteinases (MMPs) represent a group of zinc-requiring endopeptidases that play a central role in breaking down and restructuring diverse protein elements within the extracellular matrix (ECM) [14]. Among these, matrix metalloproteinase 12 (MMP12), commonly referred to as macrophage metalloelastase, stands out as a significant enzyme. The gene encoding MMP12 is located at band 11q22.3 on the long arm of human chromosome 11 [15]. In recent years, numerous studies have revealed that aberrant expression of MMP12 is closely associated with the development and progression of various solid tumors. Significantly elevated levels of MMP12 have been detected in multiple malignancies, including colon [16] and lung cancer [17]. Specifically, in the context of EC, clinical studies have clearly indicated that high MMP12 expression in tumor tissues is significantly correlated with the key malignant clinical feature of lymph node metastasis and serves as an independent risk factor for reduced survival in EC patients [18]. Although the clinical significance of MMP12 in EC has been preliminarily established, its specific biological functions and the underlying molecular regulatory mechanisms in the development and progression of EC require further in-depth investigation.

Through the prediction of the SRAMP website (http://www.cuilab.cn/m6asiteapp/old), the study discovered that the presence of methylation modification sites in SRAMP. Based on the above evidence, the study proposed that WTAP regulated MMP12 expression in a m6A-depenenr manner. The present study was designed to validate this hypothesis, aiming to identify novel therapeutic targets for EC.

2. Materials and methods

2.1. Clinical samples

Surgical specimens comprising both malignant neoplasms and corresponding adjacent non-cancerous tissues were harvested from a cohort of 30 individuals diagnosed with EC who received medical care at The Second Affiliated Hospital of Shandong First Medical University. It is important to note that none of these participants had been subjected to any preoperative therapeutic interventions, including radiotherapy or chemotherapy. Following the excision, every biological sample was rapidly preserved by snap-freezing in liquid nitrogen inside sterile tubes, after which they were moved to a −80 °C freezer for long-term cryopreservation. The study was also approved by the Ethics Committee of The Second Affiliated Hospital of Shandong First Medical University. Written informed consent was obtained from all patients prior to study begin.

2.2. Cell culture

EC cell (KYSE-150 and TE-10), normal esophageal epithelial cells (HEEC) and THP-1 cells were provided by Procell (Wuhan, China). KYSE-150 cells were cultured in RPMI-1640: Ham's F-12 (1:1) medium (Gibco, Carlsbad, CA, USA), whereas other cells were maintained in RPMI-1640 medium (Procell). These medium was supplemented with 10% fetal bovine serum (Procell) and 1% penicillin/streptomycin (Gibco) during cell culture at 37 °C with 5% CO₂. In particular, medium was added with 0.05 mM β-mercaptoethanol (Maokang Biotech, Shanghai, China) during THP-1 cell culture.

2.3. Cell transfection

Small interfering RNAs (siRNAs) targeting MMP12 (si-MMP12) and WTAP (si-WTAP), a MMP12 overexpression plasmid (oe-MMP12), a WTAP overexpression plasmid (oe-WTAP), and their respective negative controls (si-NC, oe-NC) were purchased from GenePharma (Shanghai, China). EC cells were grown until they reached a confluency level of 80-90%, after which the prepared plasmids and siRNAs were introduced into the EC cells utilizing Lipofectamine 2000 (Invitrogen, USA). All steps involved in the transfection process were carried out according to the manufacturer's guidelines.

2.4. Identification of key genes between EC tissues and normal esophageal tissues

The GSE161533 dataset (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE161533) was analyzed to identify differentially expressed genes (DEGs) between EC tissues (N = 28) and normal esophageal tissues (N = 28) with the screening criteria of P < 0.05 and |logFC| > 3. The resulting list of DEGs was then intersected with a set of genes associated with apoptosis, proliferation, and glycolysis, which was obtained from the GeneCards database (https://www.genecards.org/). The lasso regression model, random forest algorithm, and the support vector machine (SVM) algorithm were applied to the screened genes to further identify key signature genes.

2.5. Quantitative real-time polymerase chain reaction

Total RNA was extracted from cultured cells by employing the RNA Co-extraction Kit along with its associated protocols (Beyotime, Shanghai, China). Synthesis of first-strand cDNA and quantitative PCR were carried out using the PrimeScript RT Reagent kit (TaKaRa, Dalian, China) and SYBR Green Mix (TaKaRa), respectively, following the manufacturer's instructions. The expression levels of target genes were quantified according to the 2^−ΔΔCt method, using β-actin as an internal reference gene. Primer sequences are listed in Table 1.

Table 1.

Primer sequences used in qRT-PCR.

Name		Primers for qRT-PCR (5′-3′)
MMP12	Forward	TTTGGTGGTTTTTGCCCGTG
	Reverse	ATGTCATCAGCAGAGAGGCG
INHBA	Forward	TCATCACGTTTGCCGAGTCA
	Reverse	TGTTGGCCTTGGGGACTTTT
MMP3	Forward	TGAGGACACCAGCATGAACC
	Reverse	ACTTCGGGATGCCAGGAAAG
SPP1	Forward	AATCTCCTAGCCCCACAGACC
	Reverse	CCACACTATCACCTCGGCCA
IL-10	Forward	CTCCGAGATGCCTTCAGCAG
	Reverse	TCACATGCGCCTTGATGTCT
TGF-β	Forward	GGGCTACCATGCCAACTTCT
	Reverse	GCACGATCATGTTGGACAGC
Arg-1	Forward	ACTTAAAGAACAAGAGTGTGATGTG
	Reverse	CATGGCCAGAGATGCTTCCA
β-actin	Forward	ACACAGTGCTGTCTGGTGGT
	Reverse	TGATCTTCATGGTGCTGGGAG

2.6. Western blotting

Total protein was extracted from the cultured cells using an RNA/Protein Co-extraction Kit (Beyotime), and protein concentration levels were determined via the BCA protein assay (Thermo Fisher, Waltham, MA, USA). For electrophoresis, protein samples (20 μg per lane) were resolved on Bis-Tris gels (Thermo Fisher) and subsequently transferred onto PVDF membranes (Servicebio, Wuhan, China), followed by incubation with target-specific antibodies targeting MMP12 (MA5-32011, 1:2000, Thermo Fisher), HK1 (MA5-15675, 1:2000, Thermo Fisher), LDHA (PA5-27406, 1:2000, Thermo Fisher), WTAP (MA563174, 1:1000, Thermo Fisher), E-cadherin (PA5-32178, 1:5000, Thermo Fisher), N-cadherin (PA5-19486, 1:800, Thermo Fisher), and β-actin (PA1-183, 1:2000, Thermo Fisher). Signals were subsequently visualized using the ECL Kit (Beyotime), and the resulting data were analyzed with the ChemiDoc XRS⁺ imaging system.

2.7. Transwell migration and invasion assays

Cell migration and invasion capabilities were evaluated using 24-well Transwell chambers (Corning, Madison, New York). For the invasion assay, inserts were pre-coated with Matrigel (Corning), while uncoated inserts were utilized to assess cell migration. In brief, transfected EC cells under serum starvation and THP-1-M0 cells were plated in the upper chamber. The chambers were subsequently placed into 24-well plates filled with 600–700 μL of complete medium supplemented with 10% FBS (Procell). After 24 h of incubation, cells that had migrated or invaded were fixed and stained with 1% crystal violet. Images were captured using an inverted microscope, and cell counts were performed across a minimum of five randomly selected visual fields.

2.8. 5-Ethynyl-2′-deoxyuridine assay

To evaluate cell proliferation, EC cells were cultured in 96-well plates and subjected to the corresponding transfection treatments. After 48 h, proliferation was measured with the Yefluor 488 EdU Imaging Kit according to the manufacturer's instructions (Yeasen, Shanghai, China). The proportion of EdU-positive cells was calculated in relation to the total number of nuclei identified by blue fluorescent staining.

2.9. Flow cytometry

Flow cytometric analysis was performed with an LSRII instrument (BD Biosciences, San Jose, CA, USA). Apoptosis was evaluated using a Double Staining Apoptosis Kit (Vazyme Biotech, Nanjing, China) following the protocol for Annexin V-FITC and propidium iodide dual staining. Measurement of the apoptotic rate was completed within 1 h after staining. To obtain macrophage phenotypes, THP-1 cells (Procell) were treated with 100 ng/mL of PMA (Selleck, Shanghai, China) over 24 h to trigger differentiation into THP-1-M0 macrophages. For immunophenotyping, single-cell suspensions of both THP-1 and THP-1-M0 cells were labeled with an anti-CD68 antibody (E-AB-F1299L, Elabscience, Wuhan, China). Additionally, to determine the proportion of CD206-positive macrophages, single-cell suspensions of these cells were incubated with a FITC-conjugated anti-CD206 antibody (E-AB-F1161E, Elabscience).

2.10. Glucose metabolism analysis

Measurements of glucose consumption, lactate production, and intracellular ATP content were carried out with commercially available assay kits. Specifically, the Glucose Assay Kit (Sigma, St. Louis, MO, USA), Lactate Assay Kit (Abcam, Cambridge, MA, USA), and ATP Assay Kit (Beyotime) were employed according to the manufacturers’ recommended procedures.

2.11. Methylated RNA immunoprecipitation (MeRIP) and RNA immunoprecipitation (RIP) assays

These assays were carried out with the BeyoRIP™ RIP Assay Kit (Beyotime) following the supplier's instructions. Briefly, EC cell lysates were prepared and incubated overnight with a pre-formed complex consisting of Protein A/G Agarose and specific antibodies targeting m6A (68055-1-Ig, Proteintech, Rosemount, MN, USA), WTAP (60188-1-Ig, Proteintech), or a control Isotype IgG (30000-0-AP, Proteintech). After extensive washing, the immunoprecipitated complexes were collected, and the bound RNA was extracted for subsequent quantification of MMP12 mRNA enrichment levels.

2.12. Statistical analysis

All statistical evaluations were performed with GraphPad Prism version 8.0. Results are presented as mean ± standard deviation. For comparisons between two groups, Student's t-test was applied, whereas one-way ANOVA was used for multi-group comparisons. Differences were considered statistically significant when P < 0.05.

3. Results

3.1. Screening of genes in EC

The study analyzed the GSE161533 dataset to identify DEGs between EC tissues and normal esophageal tissues (P < 0.05, |log2FC|>3). The study also intersected the list of these screened DEGs with a list of genes associated with apoptosis, proliferation, and glycolysis, which was obtained from the GeneCards database (https://www.genecards.org/). The results showed that there were 11 intersecting genes, including CTHRC1, MMP1, MMP3, INHBA, SPP1, MMP12, ADH1B, COL1A1, CXCL8, TGM3, and CXCL5 (Fig. 1A). The study then employed the Lasso regression, SVM, and RF algorithms to further screen the 11 genes and identify key signature genes (Fig. 1B–D). The intersection of the results from the three algorithms yielded four genes (MMP3, INHBA, SPP1, and MMP12) (Fig. 1E).

Fig. 1.

Screening of genes in EC. (A) The Venn diagram shows the intersection between the DEGs in EC and normal esophageal tissues and the genes related to apoptosis, proliferation, and glycolysis. (B-D) The Lasso regression, SVM, and RF algorithms were used to further screen the 11 genes and identify key signature genes. (E) The Venn diagram shows the key genes identified by the Lasso regression, SVM, and RF algorithms.

3.2. MMP12 was identified as a key gene and its expression was upregulated in EC cells

The expression of these four key genes was then analyzed in EC tissues and normal esophageal tissues through the GEPIA database. The results showed that their expression was all upregulated in EC tissues (Fig. 2A). Subsequently, the results showed INHBA mRNA expression was not significant in KYSE150 and TE-10 cells in comparison with HEEC, whereas the mRNA levels of MMP3, MMP12, and SPP1 were upregulated in KYSE150 cells and TE-10 cells (Fig. 2B and Fig. S1A). Given its highest expression in KYSE150 and TE-10 cells, MMP12 was selected for the following study. As shown in Fig. 2C, MMP12 expression was upregulated in pan-cancer tissues, including in EC tissues. Moreover, the results showed a higher MMP12 protein expression in KYSE150 and TE-10 cells when compared with HEEC (Fig. 2D and Fig. S1B). MMP12 expression was also upregulated in EC tissues (Fig. S2). Thus, MMP12 was identified as a key gene and its expression was upregulated in EC cells.

Fig. 2.

MMP12 was identified as a key gene and its expression was upregulated in EC cells. (A) Expression analysis of INHBA, MMP3, MMP12, and SPP1 in EC tissues and normal esophageal tissues through the GEPIA database. (B) Expression analysis of INHBA, MMP3, MMP12, and SPP1 in HEEC and KYSE150 cells. (C) MMP12 expression analysis in pan-cancer tissues and normal tissues through the GEPIA database. (D) qRT-PCR was performed to detect MMP12 protein expression in HEEC and KYSE150 cells. (E) The efficiency of MMP12 knockdown was determined by Western blotting in KYSE150 cells. ns: not significant, ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

3.3. MMP12 knockdown inhibited the malignant phenotypes of KYSE150 and TE-10 cells

The study continued to analyze the effects of MMP12 silencing on the key malignant phenotypes of KYSE150 and TE-10 cells. To achieve this, the study transfected MMP12 siRNA and si-NC into KYSE150 and TE-10 cells. The efficiency of MMP12 knockdown was analyzed by Western blotting assay, and the result is shown in Fig. 2E and Fig. S1C. Subsequently, the results showed that MMP12 knockdown inhibited the migration and invasion of KYSE150 and TE-10 cells, accompanied by increased E-cadherin protein expression and decreased N-cadherin expression (Fig. 3A and B, S1D, S1E, and S3A). MMP12 silencing also inhibited cell proliferation and induced cell apoptosis (Fig. 3C and D, S1F, and S1G). Moreover, knockdown of MMP12 suppressed the expression of glycolytic proteins HK1 and LDHA, which corresponded with reduced glucose consumption, lactate production, and intracellular ATP levels (Fig. 3E–H and S1H–K). THP-1 cells were differentiated into M0 macrophages (THP-1 M0) by treatment with 100 ng/mL PMA for 24 h. Subsequently, KYSE150 and TE-10 cells were co-cultured with the THP-1-derived macrophages using a Transwell co-culture system. The results showed that THP-1-derived M0 macrophages were positive for CD68, but THP-1 cells were not (Fig. 4A). MMP12 knockdown inhibited the mRNA levels of IL-10, Arg-1, and TGF-β (Fig. 4B). As shown in Fig. 4C and S1L, the knockdown of MMP12 reduced the number of the CD206-positive macrophages. The decreased expression of MMP12 inhibited the migration of macrophages (Fig. 4D and S1M). The results also showed that MMP12 overexpression promoted cell migration and proliferation, increased N-cadherin, HK1 and LDHA protein expression, and decreased E-cadherin protein expression (Fig. S4A–C and Fig. S3B). Thus, these results demonstrate that MMP12 knockdown inhibits the malignant phenotypes of KYSE150 and TE-10 cells.

Fig. 3.

MMP12 knockdown inhibited the migration, invasion, proliferation, and glucose metabolism and induced cell apoptosis. KYSE150 cells were transfected with si-MMP12 or si-NC. (A and B) Cell migration and invasion were analyzed by transwell assays. (C) Cell proliferation was analyzed by EdU assay. (D) Cell apoptosis was assessed by flow cytometry. (E) HK1 and LDHA protein expression were detected by Western blotting. (F–H) Glucose consumption, lactate production, and ATP levels were analyzed by commercial kits. ∗∗P < 0.01 and ∗∗∗P < 0.001.

Fig. 4.

MMP12 silencing inhibited M2 macrophage polarization. THP-1 cells were differentiated into M0 macrophages (THP-1 M0) by treatment with 100 ng/mL PMA for 24 h. (A) Flow cytometry was used to quantify the number of CD68-positive cells. Subsequently, KYSE150 cells were co-cultured with the THP-1-derived macrophages using a Transwell system. (B) The mRNA levels of IL-10, Arg-1, and TGF-β were detected by qRT-PCR. (C) Flow cytometry was used to quantify the number of CD206-positive macrophages. (D) Cell migration analysis by transwell migration assay. ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

3.4. WTAP stabilized MMP12 expression in a m6A-dependent manner

The SRAMP website predicted the presence of methylation modification sites in MMP12 (Fig. 5A). WTAP binds to the methyltransferase-like 3 (METTL3) protein to form the METTL3-METTL14-WTAP (MMW) complex, which in turn mediates m6A modification [19]. Our data showed its high expression in EC tissues in comparison with paracancerous tissues (Fig. S2). The study focused on WTAP and analyzed its effect on MMP12 expression. As shown in Fig. 5B and S5A, WTAP silencing inhibited MMP12 protein expression in KYSE150 and TE-10 cells. Moreover, the results showed that WTAP silencing reduced the MMP12 m6A levels in KYSE150 and TE-10 cells (Fig. 5C and S5B). Further, the enrichment of the WTAP antibody to the MMP12 mRNA was inhibited after WTAP knockdown in KYSE150 and TE-10 cells (Fig. 5D and S5C). Thus, WTAP stabilized MMP12 expression in KYSE150 and TE-10 cells.

Fig. 5.

WTAP stabilized MMP12 expression in KYSE150 cells. (A) The SRAMP website predicted the presence of methylation modification sites in MMP12. (B) The effect of WTAP knockdown on the protein levels of MMP12 in KYSE150 cells. (C and D) The association of MMP12 and WTAP was analyzed through the MeRIP and RIP assays in KYSE150 cells. ∗∗P < 0.01 and ∗∗∗P < 0.001.

3.5. WTAP silencing inhibited the malignant phenotypes of KYSE150 and TE-10 cells by regulating MMP12 expression

To investigate the role of WTAP and MMP12 in regulating the malignant progression of KYSE150 and TE-10 cells, the study performed a series of rescue experiments. The study confirmed that WTAP silencing reduced the protein levels of MMP12 in KYSE150 and TE-10 cells, whereas this suppression of MMP12 was effectively rescued by transfection with an MMP12 overexpression plasmid (Fig. 6A and S5D). Subsequent functional assays revealed that the inhibitory effects of WTAP knockdown on cell migration and invasion and N-cadherin protein expression and its promoting effect on E-cadherin protein expression were significantly attenuated by MMP12 overexpression (Fig. 6B and C, S5E, S5F, and S3C). Similarly, WTAP silencing-induced suppression of cell proliferation and induction of apoptosis were also mitigated by ectopic MMP12 expression (Fig. 6D–F, S5G, and S5H). In terms of metabolism, WTAP knockdown suppressed the glycolytic proteins HK1 and LDHA and reduced glucose consumption, lactate production, and intracellular ATP levels; however, these metabolic effects were also reversed by MMP12 overexpression (Fig. 6G–K and S5I-L). WTAP knockdown in KYSE150 and TE-10 cells decreased the mRNA levels of the M2-associated cytokines IL-10, Arg-1, and TGF-β in the co-cultured macrophages, whereas the effect was rescued by MMP12 overexpression (Fig. 7A). Consistent with this, WTAP silencing reduced the population of CD206-positive M2 macrophages and inhibited their migration, but these effects were similarly reversed upon MMP12 overexpression (Fig. 7B–C and S6A-B). Collectively, these findings demonstrate that WTAP promotes the malignant progression of EC cells, at least in part, by upregulating MMP12.

Fig. 6.

WTAP knockdown inhibited the migration, invasion, proliferation, and glucose metabolism and induced cell apoptosis by regulating MMP12 expression. KYSE150 cells were transfected with si-WTAP, MMP12 overexpression plasmid, or the matched control (si-NC and oe-NC). (A) MMP12 protein expression was detected by Western blotting. (B and C) Cell migration and invasion were analyzed by transwell assays. (D and E) Cell proliferation was analyzed by EdU assay. (F) Cell apoptosis was assessed by flow cytometry. (G and H) HK1 and LDHA protein expression were detected by Western blotting. (I–K) Glucose consumption, lactate production, and ATP levels were analyzed by commercial kits. ns: not significant, ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

Fig. 7.

WTAP silencing inhibited M2 macrophage polarization by regulating MMP12. THP-1 cells were differentiated into M0 macrophages (THP-1 M0) by treatment with 100 ng/mL PMA for 24 h. KYSE150 cells were transfected with si-WTAP, MMP12 overexpression plasmid, or the matched control (si-NC and oe-NC). Subsequently, these KYSE150 cells were co-cultured with the THP-1-derived macrophages using a Transwell system. (A) The mRNA levels of IL-10, Arg-1, and TGF-β were detected by qRT-PCR. (B) Flow cytometry was used to quantify the number of CD206-positive macrophages. (C) Cell migration analysis by transwell migration assay. ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

4. Discussion

Our study unveiled a novel molecular axis, the WTAP-MMP12 signaling, that critically contributes to the progression of EC. The study demonstrated for the first time that the m6A writer protein WTAP post-transcriptionally stabilized MMP12 mRNA in an m6A-dependent manner, thereby enhancing the expression of MMP12. This WTAP-mediated upregulation of MMP12 directly promoted the malignant phenotypes of EC cells, including migration, invasion, proliferation, and glycolysis, M2 macrophage polarization, and inhibited cell apoptosis. These findings established a functional link between the oncogenic role of WTAP and EC pathogenesis. Our study established MMP12 as a crucial downstream effector of WTAP, revealing a detailed molecular mechanism by which m6A modification promotes malignant progression in EC.

MMP3 typically exists as an inactive zymogen, with a protein structure composed of three key domains: the N-terminal propeptide domain, the catalytic domain, and the hemopexin domain. This complex structural feature not only serves as the foundation for MMP3's biological functions but also supports its dual role in extracellular matrix degradation and cell signaling regulation [20]. Previous studies have confirmed that MMP3 significantly promotes tumor metastasis in melanoma cancer [21]. MMP3 enhanced the proliferative capacity and metastatic potential of breast cancer cells [22]. Furthermore, research in the field of EC has similarly indicated that MMP3 plays a substantial contributory role in the process of tumor cell invasion [23]. On the other hand, SPP1 belongs to the integrin-binding N-glycoprotein family and is widely expressed in bone and various tissues [24]. Recent investigations have emphasized that SPP1 is deeply involved in malignant activities such as tumor growth, invasion, and migration, with its expression level being significantly correlated with patient prognosis [25,26]. Particularly in EC, SPP1 has been confirmed as a key therapeutic target that promotes cancer progression by driving M2 macrophage infiltration [27] and further advances EC development by activating the focal adhesion pathway [28]. Despite the significant roles of the aforementioned genes in tumor progression, in-depth analysis revealed that among the candidate target genes INHBA, MMP3, MMP12, and SPP1, MMP12 exhibited the most significant expression levels in KYSE150 and TE-10 cell lines; consequently, it was selected as the primary subject of this study.

The oncogenic role of WTAP in EC has been established through several studies elucidating its function as an m6A methyltransferase regulator. For instance, it has been demonstrated that WTAP-driven m6A methylation of circRNA_404908 enhances the proliferation, migration, and invasive capacity of EC cells [29]. Its modification of PDIA3P1 stabilized the transcript and facilitated tumor advancement driven by histone lactylation [30]. Similarly, WTAP has been reported to enhance EC proliferation by epigenetically promoting PTP4A1 expression in an m6A-dependent manner [31]. The present findings significantly expand upon this existing body of work by demonstrating that WTAP knockdown broadly suppressed malignant phenotypes, including migration, invasion, proliferation, and glycolysis, while concurrently promoting apoptosis in EC cells. A key novel aspect of this research is the identification of a direct mechanistic link between WTAP and the stabilization of MMP12 mRNA via m6A modification, a pathway not previously implicated in WTAP-driven EC. This discovery is particularly significant as it connects WTAP's epigenetic regulatory function to a critical effector of extracellular matrix remodeling and metastasis. Furthermore, the observation that silencing WTAP inhibited M2 macrophage polarization introduces a new dimension to WTAP's oncogenic influence. Tumor-associated macrophages, particularly the M2 phenotype, are known to foster a pro-tumorigenic microenvironment by suppressing anti-tumor immunity and releasing growth factors that facilitate cancer cell invasion and metastasis [32]. This suggests that WTAP's role extends beyond intrinsic tumor cell properties to modulating the immunosuppressive tumor microenvironment. Therefore, while previous studies have focused on WTAP's regulation of non-coding RNAs or metabolic-epigenetic crosstalk, these results uncover a distinct WTAP-MMP12 axis that simultaneously drives tumor cell aggressiveness and shapes immune evasion, offering a more comprehensive understanding of WTAP's multifaceted contribution to EC pathogenesis.

The present data also revealed that MMP12 expression was significantly upregulated in EC cells compared to normal esophageal epithelial cells, and its knockdown suppressed migration, invasion, proliferation, and glycolysis while promoting apoptosis in KYSE150 and TE-10 cells. These functional findings align with and substantially extend previous reports confirming elevated MMP12 expression in EC tissues and cell lines, and its essential role in promoting proliferation [33,34]. Beyond its established cell-autonomous oncogenic functions, the novel mechanistic insight from this study reveals that WTAP stabilizes MMP12 transcripts in an m6A-dependent manner, thereby identifying a crucial upstream regulatory mechanism for MMP12 overexpression in ESCC. Furthermore, prior bioinformatic analyses indicated that MMP12-associated genes are involved in extracellular matrix disassembly, metalloendopeptidase activity, and signaling pathways like relaxin and Toll-like receptor [33]. Moreover, MMP12 showed a correlation with immune infiltrates including mast cells and M0 macrophages [33,35]. Based on the integrated analysis of experimental and bioinformatic data, MMP12 may promote EC progression through a multi-faceted mechanism: it directly facilitates tumor invasion and metastasis by degrading extracellular matrix components; it drives cell proliferation and suppresses apoptosis by modulating key oncogenic pathways such as relaxin [36] and Toll-like receptor signaling [37]; it reprograms cellular metabolism towards glycolysis to fuel rapid growth; and it shapes an immunosuppressive tumor microenvironment by recruiting and activating pro-tumor immune cells like M0 macrophages (to M2 macrophages) and mast cells, thereby fostering immune evasion and supporting tumor progression.

Despite the significant findings, this study has several limitations. First, the reliance on in vitro assays means the critical role of this axis within the complex in vivo tumor microenvironment, including its impact on tumor growth and metastasis in vivo, was not validated. Secondly, the upstream regulatory mechanisms governing WTAP expression were not investigated. Further research is required to elucidate the signaling pathways or factors that regulate WTAP in esophageal cancer. In addition, although the WTAP-MMP12 regulatory axis was identified, the precise m6A modification sites on MMP12 mRNA and the specific reader proteins involved remain uncharacterized, leaving a gap in the complete mechanistic understanding.

Taken together, the study establishes the WTAP-MMP12 axis as a pivotal regulator driving EC progression. The findings from this research highlight the WTAP-MMP12 axis as a promising target for therapeutic intervention in EC. Developing small-molecule inhibitors to disrupt the WTAP-MMP12 interaction or to target MMP12 activity itself presents a viable strategy for curtailing tumor growth, metastasis, and immune modulation. Given that MMP12 exerts pleiotropic effects on both cancer cells and the tumor immune microenvironment, its inhibition could offer a multifaceted approach to treating EC.

Authors’ contributions

Xue Han, Yuhua Wei and Min Zhang designed and performed the research; Bei Hu, Tingting Lv and Guoqing Zhang analyzed the data; Min Zhao and Heng Zhang wrote the manuscript. All authors read and approved the final manuscript.

Availability of data and materials

Not applicable.

Ethics approval and consent to participate

Written informed consents were obtained from all participants and this study was permitted by the Ethics Committee of The Second Affiliated Hospital of Shandong First Medical University [Approval Number: 2021-002].

Consent for publication

Written informed consents were obtained from all participants.

Funding

None.

Declaration of competing interest

The authors declare that they have no conflicts of interest.

Appendix A. Supplementary data

The following is/are the supplementary data to this article.

Figure S1.

MMP12 knockdown inhibited the malignant phenotypes of TE-10 cells. (A) Expression analysis of INHBA, MMP3, MMP12, and SPP1 in HEEC and TE-10 cells. (B) qRT-PCR was performed to detect MMP12 protein expression in HEEC and TE-10 cells. (C) The efficiency of MMP12 knockdown was determined by Western blotting in TE-10 cells. (D-K) TE-10 cells were transfected with si-MMP12 or si-NC. (D and E) Cell migration and invasion were analyzed by transwell assays. (F) Cell proliferation was analyzed by EdU assay. (G) Cell apoptosis was assessed by flow cytometry. (H) HK1 and LDHA protein expression were detected by Western blotting assay. (I–K) Glucose consumption, lactate production, and ATP levels were analyzed by commercial kits. (L and M) THP-1 cells were differentiated into M0 macrophages (THP-1 M0) by treatment with 100 ng/mL PMA for 24 h. TE-10 cells were co-cultured with the THP-1-derived macrophages using a Transwell system. (L) Flow cytometry was used to quantify the number of CD206-positive macrophages. (M) Cell migration analysis by transwell migration assay. ns: not significant, ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

Figure S2.

The mRNA levels of MMP12 and WTAP in EC tissues and paracancerous tissues were detected by qRT-PCR. ∗∗∗P < 0.001.

Figure S3.

E-cadherin and N-cadherin protein expression analysis in both KYSE-150 and TE-10 cells with various treatments. (A) KYSE-150 and TE-10 cells were transfected with si-MMP12 or si-NC, and E-cadherin and N-cadherin protein expression were analyzed by Western blotting assay. (B) KYSE-150 and TE-10 cells were transfected with oe-MMP12 or oe-NC, and E-cadherin and N-cadherin protein expression were analyzed by Western blotting assay. (C) KYSE-150 and TE-10 cells were transfected with si-NC + oe-NC, si-WTAP + oe-NC, or si-WTAP + oe-MMP12, and E-cadherin and N-cadherin protein expression were analyzed by Western blotting assay. ∗∗P < 0.01 and ∗∗∗P < 0.001.

Figure S4.

MMP12 overexpression promoted KYSE-150 and TE-10 cell migration and proliferation and HK1 and LDHA protein expression. KYSE-150 and TE-10 cells were transfected with oe-MMP12 or oe-NC. (A) Cell migration was analyzed by Transwell migration assay. (B) Cell proliferation was assessed by EdU assay. (C) HK1 and LDHA protein expression were analyzed by Western blotting. ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

Figure S5.

WTAP knockdown inhibited the migration, invasion, proliferation, and glucose metabolism and induced cell apoptosis in TE-10 cells by regulating MMP12. (A) The effect of WTAP knockdown on the protein levels of MMP12 in TE-10 cells was analyzed by Western blotting assay. (B and C) The association of MMP12 and WTAP was analyzed through the MeRIP and RIP assays in TE-10 cells. (D-L) TE-10 cells were transfected with si-WTAP, MMP12 overexpression plasmid, or the matched control (si-NC and oe-NC). (D) MMP12 protein expression was detected by Western blotting. (E and F) Cell migration and invasion were analyzed by transwell assays. (G) Cell proliferation was analyzed by EdU assay. (H) Cell apoptosis was assessed by flow cytometry. (I) HK1 and LDHA protein expression were detected by Western blotting assay. (J-L) Glucose consumption, lactate production, and ATP levels were analyzed by commercial kits. ns: not significant, ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.

Figure S6.

WTAP silencing inhibited M2 macrophage polarization by regulating MMP12. THP-1 cells were differentiated into M0 macrophages (THP-1 M0) by treatment with 100 ng/mL PMA for 24 h. TE-10 cells were transfected with si-WTAP, MMP12 overexpression plasmid, or the matched control (si-NC and oe-NC). Subsequently, these THP-1 cells were co-cultured with the THP-1-derived macrophages using a Transwell system. (A) Flow cytometry was used to quantify the number of CD206-positive macrophages. (B) Cell migration analysis by transwell migration assay. ∗P < 0.05, ∗∗P < 0.01 and ∗∗∗P < 0.001.