Skip to main content
NCBI home page
Genetics logoLink to Genetics
. 2024 Aug 28;228(2):iyae133. doi: 10.1093/genetics/iyae133

Transformation of meiotic drive into hybrid sterility in Drosophila

Jackson Bladen 1, Hyuck-Jin Nam 2, Nitin Phadnis 3,✉,2
Editor: K Dyer
PMCID: PMC13031091  PMID: 39196789

Abstract

Hybrid male sterility is one of the fastest evolving intrinsic reproductive barriers between recently isolated populations. A leading explanation for the evolution of hybrid male sterility involves genomic conflicts with meiotic drivers in the male germline. There are, however, few examples directly linking meiotic drive to hybrid sterility. In this study, we report that the Sex-Ratio chromosome of Drosophila pseudoobscura, which causes X-chromosome drive within the USA subspecies, causes near-complete male sterility when it is moved into the genetic background of the Bogota subspecies. In addition, we show that this new form of sterility is genetically distinct from the sterility of F1 hybrid males in crosses between USA males and Bogota females. Our observations provide a tractable study system where noncryptic drive within species is transformed into strong hybrid sterility between very young subspecies.

Keywords: meiotic drive, hybrid incompatibility, Sex-Ratio, Drosophila, speciation, genomic conflict

Genomic conflicts involving meiotic drivers are thought to explain the rapid evolution of hybrid male sterility between recently diverged populations. There are, however, few examples directly linking meiotic drive to hybrid sterility. Here, the authors report that the Sex-Ratio chromosome of Drosophila pseudoobscura, which causes X-chromosome drive within the USA subspecies, causes near complete male sterility when moved into the genetic background of the Bogota subspecies.

Introduction

Hybrid male sterility is one of the fastest evolving intrinsic reproductive barriers between geographically isolated populations (Wu 1992; Wu and Davis 1993; Coyne and Orr 1997). This rapid evolution of hybrid male sterility is thought to be driven by intragenomic conflicts, particularly those involving meiotic drivers (Frank 1991; Hurst and Pomiankowski 1991; Henikoff et al. 2001; Tao and Hartl 2003). Meiotic drivers are selfish chromosomes that eliminate gametes that carry competing homologous chromosomes and thus over-transmit themselves above Mendelian expectations (Gershenson 1928; Sandler and Novitski 1957). These drivers can rapidly spread through populations due to their selfish transmission and, in turn, can be silenced by the rapid evolution of suppressors of drive (Hamilton 1967; Jaenike 2001; Hall 2004). When a driver is silenced, normal Mendelian segregation is restored and a history of meiotic drive becomes difficult to detect; such suppressed drive systems are therefore referred to as “cryptic drive systems” (Tao et al. 2001; Orr and Irving 2005; Presgraves and Meiklejohn 2021). The unmasking of such cryptic drive systems in hybrids is central to our understanding of the observed rapid evolution of male sterility between recently diverged populations (Frank 1991; Hurst and Pomiankowski 1991).

There are at least 2 ways by which the unmasking of cryptic drive systems may lead to hybrid male sterility. Under the first version, which we refer to as the “crossfire” model, when 2 populations of a species are geographically isolated, each population may go through its private history of accumulating cryptic drivers. When these 2 populations hybridize, multiple cryptic drivers accumulated in each parental lineage may become simultaneously unmasked in a naïve hybrid genetic background. A cross-firing of multiple drive systems in hybrids could eliminate all gametes and cause sterility. Under the second version, which we refer to as the “misfire” model, a single cryptic drive system in 1 population may be sufficient to explain the evolution of hybrid male sterility. When a cryptic drive system is unmasked in hybrids, it may misfire and destroy all gametes rather than destroying only targeted gametes, causing hybrid male sterility. Instead of simply remanifesting as drive upon unmasking, this misfiring of drive necessitates a genetic background–dependent transformation of drive within a population into sterility between populations.

The best example of the “crossfire” model comes from within-species sterility of hybrids between isolates of the fission yeast Schizosaccharomyces pombe, which are sterile due to the unmasking of multiple wtf meiotic drive genes (Zanders et al. 2014; Hu et al. 2017; Nuckolls et al. 2017; Bravo Núñez et al. 2020). There are, however, no examples where interspecies hybrids are known to be sterile due to the unmasking of multiple meiotic drivers. The best example of the “misfire” model comes from interspecies hybrids between the Bogota and the USA subspecies of Drosophila pseudoobscura (Orr and Irving 2005; Phadnis and Orr 2009). F1 hybrid males from crosses between Bogota mothers and USA fathers are sterile (Prakash 1972) but recover weak fertility when they become aged and show X-chromosome segregation distortion (Orr and Irving 2005). Here, hybrid male sterility and X-chromosome meiotic drive have a shared genetic basis (Orr and Irving 2001, 2005; Phadnis 2011), and at least 1 gene, named Overdrive, is required for both phenotypes (Phadnis and Orr 2009). Genetic analyses are consistent with the idea that unmasking a single cryptic Bogota X-chromosome driver causes hybrid male sterility; there is no evidence for multiple meiotic drivers in these hybrids.

Another line of evidence supporting the “misfire” model involves asking whether known meiotic drivers within populations can cause sterility when they are crossed into a naïve genetic background. The best examples of this approach involve studies of X-chromosome meiotic drivers [Sex-Ratio (SR) chromosomes] in Drosophila subobscura (Hauschteck-Jungen 1990; Verspoor et al. 2018) and Drosophila simulans (Merçot et al. 1995; Cazemajor et al. 1997). In these species, the unmasking of locally suppressed SR chromosomes leads to a reduction in male fertility when they are crossed to strains that do not carry suppressors of drive (Hauschteck-Jungen 1990; Merçot et al. 1995; Cazemajor et al. 1997; Verspoor et al. 2018). However, the reduction in male fertility in the above cases is modest and does not appear substantially different from that expected from the reduction in the number of sperms due to drive alone (Montchamp-Moreau and Joly 1997; Verspoor et al. 2018).

In this study, we report that the SR chromosome of the USA subspecies of D. pseudoobscura causes near-complete hybrid male sterility when it is moved into an otherwise Bogota genetic background. This new form of hybrid male sterility is genetically distinct from the sterility of F1 hybrid males in crosses between Bogota mothers and USA fathers. Our results show that even a single unsuppressed driving chromosome is sufficient to cause male sterility when it is moved into a naïve genetic background. Although the role of meiotic drive–related genomic conflicts in the evolution of hybrid sterility is a long-debated topic in biology, the lack of suitable biological systems to study these phenomena remains a key limiting factor. Our discovery provides a strong study system to understand how a single meiotic driver within species can transform into male sterility between species.

Results

The D. pseudoobscura SR chromosome is an X-chromosome meiotic driver segregating in the USA subspecies of D. pseudoobscura (Sturtevant and Dobzhansky 1936). The USA SR chromosome is an unsuppressed drive system; no suppressors against this SR chromosome have been found despite repeated surveys of natural populations since its original discovery more than 85 years ago (Sturtevant and Dobzhansky 1936; Policansky and Dempsey 1978; Beckenbach et al. 1982; Price et al. 2014). This SR chromosome carries 3 nonoverlapping chromosomal inversions on the right arm of the metacentric X-chromosome (XR) (Sturtevant and Dobzhansky 1936; Fuller et al. 2020). The genetic basis of meiotic drive in this SR chromosome is thought to be complex (Wu and Beckenbach 1983), and all genes necessary for drive are located on the inversion-bearing XR.

USA and Bogota are very young subspecies in the earliest stages of divergence and are estimated to have been geographically separated for only ∼155–230 K years (Schaeffer and Miller 1991; Machado et al. 2002). The USA SR chromosome, in contrast, is ancient and is estimated to be ∼1 million years old (Babcock and Anderson 1996; Fuller et al. 2020). Although the Bogota subspecies harbors some of the chromosomal inversion polymorphisms found in the USA subspecies, the SR chromosome is not found in Bogota (Dobzhansky et al. 1963). The SR chromosome has been present in the ancestor of Bogota and USA for a major part of its 1-million-year existence, except for the last 150–230 K years, where it has existed only in the USA population. If Bogota has evolved suppressors against the SR chromosome, it could explain the absence of SR in this subspecies.

To test whether Bogota harbors dominant suppressors against SR, we generated F1 hybrid males that carry the USA SR chromosome. F1 hybrid males between USA mothers and Bogota fathers are fertile and show normal segregation patterns (Prakash 1972; Orr and Irving 2005). We crossed USA females carrying the SR X-chromosome with Bogota males from several strains. The resulting F1 hybrid males, which carry the USA SR chromosome in a hybrid autosomal background, are fertile and produce nearly 100% female progeny. The average proportion of female offspring produced by F1 hybrid males carrying the USA SR chromosome and the USA ST chromosome, across 6 Bogota strains, is 97 and 46%, respectively. These results confirm that Bogota does not carry dominant suppressors of the USA SR chromosome, which is consistent with previous findings (Orr and Irving 2005).

Next, to test whether Bogota harbors recessive suppressors against the SR chromosome, we introgressed the USA SR chromosome into an otherwise homozygous Bogota genetic background. We performed this introgression through repeated backcrossing to Bogota while selecting for the SR chromosome in each generation. Because there are no visible genetic markers to assist with this introgression, we first developed PCR-based markers that detect all 3 SR-associated inversions. Because recombination is suppressed along the whole SR chromosome (Fuller et al. 2020), tracking our introgression with a single molecular marker is sufficient to move the entire SR chromosome arm into Bogota. We used a PCR-based marker on the Basal inversion to select for SR chromosome-bearing females in each generation for 10 generations of repeated backcrosses with Bogota males (Fig. 1). The USA SR chromosome arm is thus maintained in this crossing scheme, while the remaining genetic background becomes increasingly Bogota with each backcross generation.

Fig. 1.

Fig. 1.

Open in a new tab

A crossing scheme for the introgression of the USA SR chromosome into a Bogota genetic background. An introgression scheme to generate introgression males carrying the SR chromosome in a largely Bogota genetic background. Starting with the F2 generation, females were backcrossed individually with Bogota males. After mating, the females were collected from crosses and genotyped using PCR to identify whether they carried the SR polymorphism or the Bogota X-chromosome. If the female carried the SR chromosome, her female offspring of unknown genotype were backcrossed individually with Bogota males. This process was independently repeated for 9 generations with 3 Bogota strains. The SR chromosome remains unaltered through the introgression procedure because it suppresses recombination along the entire XR chromosome arm. USA chromosomes are shown with empty ovals, USA SR chromosomes with diagonally striped ovals, and Bogota chromosomes with dark gray ovals. Only the sex chromosomes and second autosomes are shown for clarity.

At the end of the introgression procedure, females in this cross are heterozygous at the right arm of the X-chromosome, carrying 1 copy of USA SR and 1 copy of Bogota XR in an otherwise Bogota genetic background (Fig. 2a). When these females are crossed with Bogota males, 2 types of sons are produced. The first type of sons is pure Bogota males. As expected, pure Bogota males produced from this cross are fertile and show normal Mendelian segregation (Fig. 2b). The second type of sons is identical to the first type, except that they carry USA SR on XR (Fig. 2a). Surprisingly, we found that males carrying USA SR in a Bogota background are sterile (Fig. 2b, Supplementary File 1). Normally, males carrying a USA Standard (ST) XR in a Bogota background are fertile (Phadnis and Orr 2009). Here, we tested 83 SR introgression males across 3 different Bogota genetic backgrounds. Almost none of them produce any progeny; only 3 exceptional males produce fewer than 4 progeny. Simply replacing ST with SR—even though they both represent USA material on XR—results in male sterility in a Bogota genetic background. The phenotype of the SR chromosome thus appears to transform from meiotic drive in a USA background into male sterility in a Bogota genetic background.

Fig. 2.

Fig. 2.

Open in a new tab

The USA SR chromosome causes near-complete sterility in a Bogota genetic background. a) After 9 generations of backcrossing with Bogota males, SR introgression females were crossed with Bogota males. These crosses produce 2 types of sons. The first type of sons is pure Bogota males (Bogota control males); the second type of sons is identical to the first type, except that they carry the USA SR on XR (SR introgression male). These males, of unknown genotype, were crossed individually with Bogota females from the Bogota strain used during the introgression procedure. After mating, males were collected from crosses and genotyped using PCR to identify whether they carried the SR polymorphism or the Bogota X-chromosome. Bogota chromosomes are shown with dark gray ovals, and the USA SR chromosome arm is shown with diagonally striped ovals. b) Total progeny counts of Bogota control males and SR introgression males from 3 Bogota strains. Data points corresponding to Bogota control males and SR introgression males from the same Bogota strain share a color. Progeny counts from Bogota control males are shown with dark gray boxes (Susa-3, n = 20; Susa-5, n = 28; Toro-1, n = 21). Progeny counts from SR introgression males are shown by the absence of boxes (Susa-3, n = 19; Susa-5, n = 38; Toro-1, n = 26). Floating bars with an asterisk above indicate treatments that were significantly different from each other (pairwise Wilcoxon’s rank sum test, P < 1.80e−6 for all comparisons).

The SR chromosome is recombinationally inert when it is heterozygous with the ST chromosome even in large colinear regions spanning several megabases (Fuller et al. 2020). Although the reasons for this near-complete suppression of recombination outside of inversions remain mysterious, recombination between inversions can occur at a low, nonzero rate (Wallace 1948; Fuller et al. 2020). If the observed male sterility is an artifact of some incidental alteration in the SR chromosome during the introgression procedure, then the chromosome may no longer be capable of causing meiotic drive even when it is reintroduced into an F1 hybrid background. If the introgressed SR chromosome remains intact, however, then the male sterility caused by SR is predicted to revert to X-chromosome meiotic drive when the SR chromosome is reintroduced into an F1 hybrid background. To test this idea, we crossed the heterozygous introgression females carrying 1 copy of Bogota ST and 1 copy of the USA SR with USA males (Fig. 3). These crosses produce 2 types of sons. The first type of sons is reconstituted F1 hybrid males from crosses between Bogota mothers and USA fathers (Fig. 3a). As expected, these sons produce almost no progeny (Fig. 3b). The second type of sons is identical to the first type, except that they carry USA SR on XR (Fig. 3a). These sons are fertile and produce nearly 100% daughters (Fig. 3b). This reversion of phenotype from hybrid male sterility back to X-chromosome meiotic drive shows that the introgressed SR chromosome remains intact and is capable of causing drive even after 10 generations of backcrosses. We conclude that meiotic drive caused by the USA SR chromosome within species transforms into male sterility between species.

Fig. 3.

Fig. 3.

Open in a new tab

The USA SR chromosome remains capable of distortion after 10 generations of backcrossing. a) After 9 generations of backcrossing with Bogota males, SR introgression females were crossed with USA males. These crosses produce 2 types of sons. The first type of sons is reconstituted F1 hybrid control males, nearly identical to those produced from crosses between Bogota females and USA males. The second type of sons is identical to the first type, except that they carry USA SR on XR (SR introgression hybrid male). These hybrid males, of unknown genotype, were crossed individually with Bogota females from the respective Bogota strain used during the introgression procedure. After mating, hybrid males were collected from crosses and genotyped using PCR to identify whether they carried the SR polymorphism or the Bogota X-chromosome. USA chromosomes are shown with empty ovals, USA SR chromosomes with diagonally striped ovals, and Bogota chromosomes with dark gray ovals. b) Total progeny counts of reconstituted F1 hybrid control males and SR introgression hybrid males. Data points corresponding to reconstituted F1 hybrid control males and SR introgression hybrid males from the same Bogota strain share a color. Progeny counts from reconstituted F1 hybrid control males are shown by the absence of boxes (Susa-3, n = 38; Susa-5, n = 35; Toro-1, n = 46). Progeny counts from SR introgression hybrid males are shown with diagonally striped boxes (Susa-3, n = 35; Susa-5, n = 29; Toro-1, n = 41). Floating bars with an asterisk above indicate treatments that were significantly different from each other (pairwise Wilcoxon’s rank sum test, P < 3.08e−9 for all comparisons). c) Progeny sex-ratios of SR introgression hybrid males from each Bogota strain. Sex-ratio is calculated as the proportion of female progeny produced by each male. Sex-ratio values were not calculated if a male produced fewer than 10 offspring.

Discussion

The Bogota and USA subspecies of D. pseudoobscura are considered paradigmatic of the earliest stages of speciation (Lewontin 1974). Previous work has largely focused on understanding the genetic basis of male sterility and meiotic drive in F1 hybrid males from crosses between Bogota mothers and USA fathers (Prakash 1972; Dobzhansky 1974; Orr 1989a, 1989b; Orr and Irving 2001, 2005; Phadnis and Orr 2009; Phadnis 2011). This F1 hybrid male sterility between Bogota mothers and USA fathers involves a complex interaction between factors on the left and right arms of the Bogota X-chromosome and dominant USA autosomal factors (Prakash 1972; Orr and Irving 2001; Phadnis 2011). In contrast, the sterility of the USA SR chromosome in an otherwise Bogota genetic background involves an interaction between factors on the USA SR XR and recessive Bogota autosomal factors. This new form of SR-induced sterility that we describe here thus appears genetically unrelated to F1 hybrid male sterility between Bogota mothers and USA fathers.

Previous explanations for the evolution of hybrid male sterility have focused on the unmasking of cryptic drive systems. The D. pseudoobscura SR chromosome is not a cryptic drive system; no suppressors of SR have been identified. Yet, a cryptic suppressor may potentially explain our observations. The USA SR-induced sterility described here must result from evolutionary changes accumulated after the USA–Bogota split. Consider a scenario where the SR chromosome—after this split—has gone through one or more bouts of suppression followed by escape from suppression in the USA population. The current unsuppressed state of the SR chromosome may thus represent a transient state in an evolutionary arms race where it currently holds the upper hand. When reintroduced to a naïve Bogota genetic background, an imbalance between drive and the missing suppressors may lead to the indiscriminate destruction of all gametes. A cryptic suppression system may thus better explain hybrid male sterility caused by the SR chromosome in a Bogota genetic background.

The transformation of meiotic drive into sterility observed here necessitates a mechanism where the driving SR chromosome—in addition to destroying Y-chromosomes—gains a new property of also destroying itself. Drivers that destroy themselves, known as “suicide chromosomes,” have been isolated in the Segregation Distorter system in Drosophila melanogaster (Sandler and Hiraizumi 1960; Hartl 1974; Larracuente and Presgraves 2012). These suicide chromosomes, however, are artificially generated recombinant chromosomes where the target of drive is moved onto the driving chromosome. This scenario does not explain our observed transformation of drive into sterility because recombination is absent between sex chromosomes. Other natural cases of genetic background-dependent change in the direction of SR drive have been described in Drosophila affinis. In D. affinis, nullo-Y males are fertile (Voelker and Kojima 1971). When the D. affinis SR chromosome is present in a nullo-Y male, it destroys itself and produces a male-biased progeny sex ratio. This phenomenon is known as Male Sex Ratio (Msr) (Novitski 1947; Voelker 1972). Although the mechanisms of this “drive rebound” remain unknown, the SR chromosomes in an Msr genetic background can destroy gametes that carry themselves (Ma et al. 2022). Cases of drive rebound, however, remain fertile despite a reversal of the direction of drive and thus cannot fully explain our observed SR-induced sterility.

A mechanistic framework analogous to a toxin–antidote system may better explain our observations. Consider an X-chromosome driver that produces a toxin to which both X- and Y-bearing gametes are susceptible to differing degrees. If Y-bearing gametes are more susceptible to this toxin than X-bearing gametes, this can generate X-chromosome drive. The evolution of suppressors of drive may act as an antidote to this toxin. An evolutionary arms race between drive and suppression may involve a gradual increase in dosage of the toxin balanced by an increase in dosage of the antidote through stepwise co-evolution. In a hybrid background where the dosage of the toxin and antidote is imbalanced, the excessive toxin may destroy both X- and Y-bearing gametes and cause male sterility.

Our study shows that a single driving chromosome is sufficient to cause hybrid male sterility between species. Whether the driver or the suppressor is cryptic within a population appears to not matter for the manifestation of hybrid male sterility between populations. The USA SR-induced sterility in a Bogota genetic background provides a strong case study for the misfire model of the rapid evolution of hybrid male sterility in a tractable system where drive within species is transformed into hybrid sterility between species. Further analyses may clarify whether the mechanism of drive alone is sufficient to cause hybrid sterility in a foreign genetic background or whether other linked genes on the SR chromosome contribute to sterility. Our ongoing studies to identify the causal genes and understand the molecular and developmental mechanisms of USA SR-induced sterility in a Bogota genetic background may shed light on how drive systems that have evolved to selectively destroy targeted gametes may inadvertently destroy all gametes in hybrids, thus contributing to the origins of new species.

Materials and methods

Fly strains and culture conditions

The SR chromosome was identified from natural population collections in Zion National Park, Utah, in September 2013. The base SR stock was created by reisolation of the SR chromosome and 7 generations of backcrossing to an inbred stock with the Standard arrangement X-chromosome carrying visible mutations sepia and short on the right arm of the X-chromosome. The resulting SR chromosome stock segregates for SR and Standard X-chromosomes, the latter being identified by visible mutations. A comprehensive list of all other fly strains used in this study is given in Table 1. All experimental crosses were performed on food containing standard cornmeal molasses Drosophila media seeded with live yeast. After the adults were removed from the crosses, the food was hydrated as needed with 0.5% v/v propionic acid. Unless otherwise stated, all crosses were maintained at room temperature on a 14:10-h light–dark cycle.

Table 1.

List of fly strains used in this study.

Name Species Origin
Sex-Ratio USA Phadnis Lab
w152 USA Drosophila Species Stock Center
se1, sh1 USA Drosophila Species Stock Center
Susa-2 Bogota Drosophila Species Stock Center
Susa-3 Bogota Drosophila Species Stock Center
Susa-5 Bogota Drosophila Species Stock Center
Toro-1 Bogota Drosophila Species Stock Center
Toro-4 Bogota Drosophila Species Stock Center
Potosi-1 Bogota Drosophila Species Stock Center
Open in a new tab

Test for dominant suppressors

To test whether the Bogota population carries dominant suppressors for the SR chromosome, we crossed USA females heterozygous for the SR polymorphism with Bogota males from 5 different inbred Bogota strains—Susa-2, Susa-3, Susa-5, Toro-4, and Potosi-1. Each cross consisted of 10 unmated USA SR females and 10 Bogota males. These crosses produced F1 hybrid males hemizygous for the SR polymorphism in a hybrid autosomal background. The F1 hybrid males from each of the 5 treatments were individually mated to virgin females from USA white. After all flies had eclosed, we scored the sex of the F2 progeny. The sex-ratio phenotype was measured as the count of female offspring divided by the total number of offspring. For statistical analyses, crosses producing >10 total offspring were used for calculating sex-ratio phenotype.

Introgression procedure

We first crossed USA females homozygous for the SR polymorphism with Bogota males. All F1 hybrid females were heterozygous for the SR polymorphism. We backcrossed these F1 hybrid females with Bogota males to generate F2 females, which were either heterozygous for the SR polymorphism or homozygous for the Bogota X-chromosome. We randomly selected 10–15 of these virgin females and crossed each female independently with 3 Bogota males. After 5–7 days of mating, we disposed of the males and retrieved the female from each cross. We performed PCR on the genomic DNA from each female to identify which F2 females carried the SR polymorphism. When PCR confirmed that the F2 mother carried the SR polymorphism, we selected 10–15 of her unmated female progeny (F3) and crossed each female independently with 3 Bogota males. We repeated this procedure for a total of 10 generations. The introgression procedure was performed using 3 strains caught within Bogota, Columbia—Susa-3, Susa-5, and Toro-1. To track the SR chromosome through the introgression procedure, we designed PCR primers that amplify DNA within the Basal inversion of SR—forward primer: TCTTATCAAAGGGATTGACC and reverse primer: CCTATGTGGACATCATCTTT. Importantly, these primers do not amplify DNA from any of the USA or Bogota strains used in this study.

After 10 generations of backcrossing with Bogota males, we randomly selected introgression males from each treatment and crossed each male individually with virgin Bogota females from the respective Bogota strains. The introgression males carried either the USA XR SR chromosome or the Bogota X-chromosome in a largely Bogota genetic background. After 7 days of mating, we disposed of the females and retrieved the male from each cross. We used our PCR-based molecular marker to identify whether males carried the SR polymorphism or the Bogota X-chromosome. We scored the sex of the F2 progeny after all flies had eclosed.

Validation of the introgression procedure

To test whether the SR chromosome was altered during the introgression procedure, we crossed F9 introgression females, who carry 1 copy of the USA SR chromosome in a largely Bogota genetic background, with USA white males. We randomly selected F1 males from each introgression strain and crossed them individually with virgin Bogota females from the respective Bogota strains used during the introgression procedure. After 7 days of mating, we disposed of the females and retrieved the male from each cross. We used our PCR-based molecular marker to identify whether males carried the SR polymorphism or the Bogota X-chromosome. We scored the sex of the F2 progeny after all flies had eclosed.

Supplementary Material

iyae133_Supplementary_Data
iyae133_supplementary_data.xlsx (22.7KB, xlsx)

Acknowledgments

The authors are grateful to Jackson Ridges and Rob Unckless for helpful discussions and feedback in improving this manuscript.

Contributor Information

Jackson Bladen, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Hyuck-Jin Nam, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Nitin Phadnis, School of Biological Sciences, University of Utah, Salt Lake City, UT 84112, USA.

Data availability

Raw data are available in Supplementary File 1. Strains are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are available within the article, figures, and tables.

Supplemental material available at GENETICS online.

Funding

This work was supported by the National Institute of Health grants 5T32GM141848-3 to J.B. and R01GM141422 to N.P.

Literature cited

  1. Babcock  CS, Anderson  WW. 1996. Molecular evolution of the Sex-Ratio inversion complex in Drosophila pseudoobscura: analysis of the Esterase-5 gene region. Mol Biol Evol. 13(2):297–308. doi: 10.1093/oxfordjournals.molbev.a025589. [DOI] [PubMed] [Google Scholar]
  2. Beckenbach  AT, Curtsinger  JW, Policansky  D. 1982. Fruitless experiments with fruit flies: the ‘sex ratio’ chromosomes of D. pseudoobscura. Drosoph Inf Serv. 58:9. [Google Scholar]
  3. Bravo Núñez  MA, Sabbarini  IM, Eickbush  MT, Liang  Y, Lange  JJ, Kent  AM, Zanders  SE. 2020. Dramatically diverse Schizosaccharomyces pombe wtf meiotic drivers all display high gamete-killing efficiency. PLoS Genet. 16(2):e1008350. doi: 10.1371/journal.pgen.1008350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cazemajor  M, Landré  C, Montchamp-Moreau  C. 1997. The sex-ratio trait in Drosophila simulans: genetic analysis of distortion and suppression. Genetics. 147(2):635–642. doi: 10.1093/genetics/147.2.635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Coyne  JA, Orr  HA. 1997. Patterns of speciation in Drosophila revisited. Evolution. 51(1):295–303. doi: 10.1111/j.1558-5646.1997.tb02412.x. [DOI] [PubMed] [Google Scholar]
  6. Dobzhansky  T. 1974. Genetic analysis of hybrid sterility within the species Drosophila pseudoobscura. Hereditas. 77(1):81–88. doi: 10.1111/j.1601-5223.1974.tb01356.x. [DOI] [PubMed] [Google Scholar]
  7. Dobzhansky  T, Hunter  AS, Pavlovsky  O, Spassky  B, Wallace  B. 1963. Genetics of natural populations. XXXI. Genetics of an isolated marginal population of Drosophila pseudoobscura. Genetics. 48(1):91–103. doi: 10.1093/genetics/48.1.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Frank  SA. 1991. Divergence of meiotic drive-suppression systems as an explanation for sex-biased hybrid sterility and inviability. Evolution. 45(2):262–267. doi: 10.1111/j.1558-5646.1991.tb04401.x. [DOI] [PubMed] [Google Scholar]
  9. Fuller  ZL, Koury  SA, Leonard  CJ, Young  RE, Ikegami  K, Westlake  J, Richards  S, Schaeffer  SW, Phadnis  N. 2020. Extensive recombination suppression and epistatic selection causes chromosome-wide differentiation of a selfish sex chromosome in Drosophila pseudoobscura. Genetics. 216(1):205–226. doi: 10.1534/genetics.120.303460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gershenson  S. 1928. A new sex-ratio abnormality in Drosophila obscura. Genetics. 13(6):488–507. doi: 10.1093/genetics/13.6.488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hall  DW. 2004. Meiotic drive and sex chromosome cycling. Evolution. 58(5):925–931. doi: 10.1111/j.0014-3820.2004.tb00426.x. [DOI] [PubMed] [Google Scholar]
  12. Hamilton  WD. 1967. Extraordinary sex ratios. A sex-ratio theory for sex linkage and inbreeding has new implications in cytogenetics and entomology. Science. 156(3774):477–488. doi: 10.1126/science.156.3774.477. [DOI] [PubMed] [Google Scholar]
  13. Hartl  DL. 1974. Genetic dissection of segregation distortion. I. Suicide combinations of SD genes. Genetics. 76(3):477–486. doi: 10.1093/genetics/76.3.477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hauschteck-Jungen  E. 1990. Postmating reproductive isolation and modification of the “sex ratio” trait in Drosophila subobscura induced by the sex chromosome gene arrangement A2 + 3 + 5 + 7. Genetica. 83(1):31–44. doi: 10.1007/BF00774686. [DOI] [PubMed] [Google Scholar]
  15. Henikoff  S, Ahmad  K, Malik  HS. 2001. The centromere paradox: stable inheritance with rapidly evolving DNA. Science. 293(5532):1098–1102. doi: 10.1126/science.1062939. [DOI] [PubMed] [Google Scholar]
  16. Hu  W, Jiang  ZD, Suo  F, Zheng  JX, He  WZ, Du  LL. 2017. A large gene family in fission yeast encodes spore killers that subvert Mendel's law. Elife. 6:e26057. doi: 10.7554/elife.26057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hurst  LD, Pomiankowski  A. 1991. Causes of sex ratio bias may account for unisexual sterility in hybrids: a new explanation of Haldane's rule and related phenomena. Genetics. 128(4):841–858. doi: 10.1093/genetics/128.4.841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jaenike  J. 2001. Sex chromosome meiotic drive. Annu Rev Ecol Syst. 32(1):25–49. doi: 10.1146/annurev.ecolsys.32.081501.113958. [DOI] [Google Scholar]
  19. Larracuente  AM, Presgraves  DC. 2012. The selfish segregation distorter gene complex of Drosophila melanogaster. Genetics. 192(1):33–53. doi: 10.1534/genetics.112.141390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lewontin  RC. 1974. The Genetic Basis of Evolutionary Change. New York (NY): Columbia University Press. [Google Scholar]
  21. Ma  W-J, Knoles  EM, Patch  KB, Shoaib  MM, Unckless  RL. 2022. Hoisted with his own petard: how sex-ratio meiotic drive in Drosophila affinis creates resistance alleles that limit its spread. J Evol Biol. 35(12):1765–1776. doi: 10.1111/jeb.14077. [DOI] [PubMed] [Google Scholar]
  22. Machado  CA, Kliman  RM, Markert  JA, Hey  J. 2002. Inferring the history of speciation from multilocus DNA sequence data: the case of Drosophila pseudoobscura and close relatives. Mol Biol Evol. 19(4):472–488. doi: 10.1093/oxfordjournals.molbev.a004103. [DOI] [PubMed] [Google Scholar]
  23. Merçot  H, Atlan  A, Jacques  M, Montchamp-Moreau  C. 1995. Sex-ratio distortion in Drosophila simulans: co-occurence of a meiotic drive and a suppressor of drive. J Evol Biol. 8(3):283–300. doi: 10.1046/j.1420-9101.1995.8030283.x. [DOI] [Google Scholar]
  24. Montchamp-Moreau  C, Joly  D. 1997. Abnormal spermiogenesis is associated with the X-linked sex-ratio trait in Drosophila simulans. Heredity (Edinb).  79(1):24–30. doi: 10.1038/hdy.1997.119. [DOI] [Google Scholar]
  25. Novitski  E. 1947. Genetic analysis of anomalous sex ratio condition in Drosophila affinis. Genetics. 32(5):526–534. doi: 10.1093/genetics/32.5.526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Nuckolls  NL, Bravo Núñez  MA, Eickbush  MT, Young  JM, Lange  JJ, Yu  JS, Smith  GR, Jaspersen  SL, Malik  HS, Zanders  SE. 2017. Wtf genes are prolific dual poison-antidote meiotic drivers. Elife. 6:e26033. doi: 10.7554/eLife.26033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Orr  HA. 1989a. Genetics of sterility in hybrids between two subspecies of Drosophila. Evolution. 43(1):180–189. doi: 10.2307/2409173. [DOI] [PubMed] [Google Scholar]
  28. Orr  HA. 1989b. Localization of genes causing postzygotic isolation in two hybridizations involving Drosophila pseudoobscura. Heredity (Edinb).  63(2):231–237. doi: 10.1038/hdy.1989.96. [DOI] [PubMed] [Google Scholar]
  29. Orr  HA, Irving  S. 2001. Complex epistasis and the genetic basis of hybrid sterility in the Drosophila pseudoobscura Bogota-USA hybridization. Genetics. 158(3):1089–1100. doi: 10.1093/genetics/158.3.1089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Orr  HA, Irving  S. 2005. Segregation distortion in hybrids between the Bogota and USA subspecies of Drosophila pseudoobscura. Genetics. 169(2):671–682. doi: 10.1534/genetics.104.033274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Phadnis  N. 2011. Genetic architecture of male sterility and segregation distortion in Drosophila pseudoobscura Bogota-USA hybrids. Genetics. 189(3):1001–1009. doi: 10.1534/genetics.111.132324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Phadnis  N, Orr  HA. 2009. A single gene causes both male sterility and segregation distortion in Drosophila hybrids. Science. 323(5912):376–379. doi: 10.1126/science.1163934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Policansky  D, Dempsey  B. 1978. Modifiers and “sex ratio” in Drosophila pseudoobscura. Evolution. 32(4):922–924. doi: 10.1111/j.1558-5646.1978.tb04647.x. [DOI] [PubMed] [Google Scholar]
  34. Prakash  S. 1972. Origin of reproductive isolation in the absence of apparent genic differentiation in a geographic isolate of Drosophila pseudoobscura. Genetics. 72(1):143–155. doi: 10.1093/genetics/72.1.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Presgraves  DC, Meiklejohn  CD. 2021. Hybrid sterility, genetic conflict and complex speciation: lessons from the Drosophila simulans clade species. Front Genet. 12:669045. doi: 10.3389/fgene.2021.669045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Price  TA, Bretman  A, Gradilla  AC, Reger  J, Taylor  ML, Giraldo-Perez  P, Campbell  A, Hurst  GD, Wedell  N. 2014. Does polyandry control population sex ratio via regulation of a selfish gene? Proc. Biol Sci. 281(1783):20133259. doi: 10.1098/rspb.2013.3259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sandler  L, Novitski  E. 1957. Meiotic drive as an evolutionary force. Am Nat. 91(857):105–110. doi: 10.1086/281969. [DOI] [Google Scholar]
  38. Sandler  L, Hiraizumi  Y. 1960. Meiotic drive in natural populations of Drosophila melanogaster. V on the nature of the Sd region. Genetics. 45:1671–1689. doi: 10.1093/genetics/45.12.1671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Schaeffer  SW, Miller  EL. 1991. Nucleotide sequence analysis of Adh genes estimates the time of geographic isolation of the Bogota population of Drosophila pseudoobscura. Proc Natl Acad Sci U S A. 88(14):6097–6101. doi: 10.1073/pnas.88.14.6097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sturtevant  AH, Dobzhansky  T. 1936. Geographical distribution and cytology of “sex ratio” in Drosophila pseudoobscura and related Species. Genetics. 21(4):473–490. doi: 10.1093/genetics/21.4.473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tao  Y, Hartl  DL. 2003. Genetic dissection of hybrid incompatibilities between Drosophila simulans and D. mauritiana. III. Heterogeneous accumulation of hybrid incompatibilities, degree of dominance, and implications for Haldane's rule. Evolution. 57(11):2580–2598. doi: 10.1111/j.0014-3820.2003.tb01501.x. [DOI] [PubMed] [Google Scholar]
  42. Tao  Y, Hartl  DL, Laurie  CC. 2001. Sex-ratio segregation distortion associated with reproductive isolation in Drosophila. Proc Natl Acad Sci U S A. 98(23):13183–13188. doi: 10.1073/pnas.231478798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Verspoor  RL, Smith  JML, Mannion  NLM, Hurst  GDD, Price  TAR. 2018. Strong hybrid male incompatibilities impede the spread of a selfish chromosome between populations of a fly. Evol Lett. 2(3):169–179. doi: 10.1002/evl3.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Voelker  RA. 1972. Preliminary characterization of “sex ratio” and rediscovery and reinterpretation of “male sex ratio” in Drosophila affinis. Genetics. 71(4):597–606. doi: 10.1093/genetics/71.4.597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Voelker  RA, Kojima  K-I. 1971. Fertility and fitness of XO males in Drosophila I. Qualitative study. Evolution. 25(1):119–128. doi: 10.1111/j.1558-5646.1971.tb01865.x. [DOI] [PubMed] [Google Scholar]
  46. Wallace  B. 1948. Studies on sex-ratio in Drosophila pseudoobscura; selection and sex-ratio. Evolution. 2:189–217. doi: 10.1111/j.1558-5646.1948.tb02741.x. [DOI] [PubMed] [Google Scholar]
  47. Wu  C-I. 1992. A note on Haldane's rule: hybrid inviability versus hybrid sterility. Evolution. 46(5):1584–1587. doi: 10.2307/2409965. [DOI] [PubMed] [Google Scholar]
  48. Wu  CI, Beckenbach  AT. 1983. Evidence for extensive genetic differentiation between the sex-ratio and the standard arrangement of Drosophila pseudoobscura and D. persimilis and identification of hybrid sterility factors. Genetics. 105(1):71–86. doi: 10.1093/genetics/105.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wu  CI, Davis  AW. 1993. Evolution of postmating reproductive isolation: the composite nature of Haldane's rule and its genetic bases. Am Nat. 142(2):187–212. doi: 10.1086/285534. [DOI] [PubMed] [Google Scholar]
  50. Zanders  SE, Eickbush  MT, Yu  JS, Kang  JW, Fowler  KR, Smith  GR, Malik  HS. 2014. Genome rearrangements and pervasive meiotic drive cause hybrid infertility in fission yeast. Elife. 3:e02630. doi: 10.7554/eLife.02630. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

iyae133_Supplementary_Data
iyae133_supplementary_data.xlsx (22.7KB, xlsx)

Data Availability Statement

Raw data are available in Supplementary File 1. Strains are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are available within the article, figures, and tables.

Supplemental material available at GENETICS online.

Articles from Genetics are provided here courtesy of Oxford University Press

RESOURCES