Erianin suppresses lung adenocarcinoma by modulating miR-494-3p/MAPK/ERK pathway

Abstract

Erianin, a compound naturally occurring in Dendrobium, demonstrates a wide spectrum of biological activities, including antitumor properties as well as immunomodulatory actions. Existing studies have found that erianin has inhibitory effects on a variety of cancer cells, including lung cancer. However, the specific mechanism of action of erianin on lung adenocarcinoma (LUAD) has not been fully revealed. This research endeavors to provide preliminary insights into the suppressive effects of eriolin on the progression of LUAD, with a focus on its antitumor mechanisms. The proliferation of LUAD cells in response to erianin was assessed utilizing Cell Counting Kit-8 (CCK-8), wound closure analysis, and colony-forming assays. The impact of erianin on cellular invasion and migration was assessed utilizing the transwell assay methodology. Tube formation assay was used to evaluate the effect of erianin on tumor angiogenesis. The effect of erianin on cell cycle and apoptosis of LUAD cells was determined by flow cytometry. RT-qPCR was used to detect the expression of miR-494-3p in LUAD cells after erianin treatment. In addition, western blotting was used to detect the effect of erianin on protein expression in LUAD cells in vivo and in vitro. Erianin demonstrated the ability to suppress the proliferation, angiogenesis, invasion and migration of LUAD cells in vitro, and arrested the S phase of the cell cycle. Erianin can downregulate the expression of miR-494-3p and exert its anti-cancer effect by affecting the MEGF9/MAPK/ERK/CyclinD1/VEGF-A/Survivin axis in LUAD cells. Our study preliminarily revealed that erianin may exert anti-tumor effects by downregulating the expression of miR-494-3p, thereby regulating the MEGF9/MAPK/ERK/CyclinD1/VEGF-A/Survivin cascade reaction.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-40427-4.

Introduction

Lung cancer, a devastating condition arising in the lungs, occupies a prominent position globally as one of the most prevalent malignant chest tumors. Its incidence and mortality rates have been experiencing a significant and rapid increase in recent years, posing a significant global risk to public health. The alarming pattern highlights the pressing requirement for thorough research, early diagnostic techniques, and efficacious therapeutic approaches to counteract this fatal illness. Based on the most recent information released by GLOBALCAN, it is estimated that there will be 2,480,301 new cases and 1,817,172 deaths of lung cancer worldwide in 2022, ranking first among 36 types of cancer in the world (12.4% and 18.7%)¹. Currently, the surge in smoking rates among females, coupled with alterations in cigarette composition, environmental contaminants, and a myriad of other factors, has led to lung adenocarcinoma overtaking squamous cell carcinoma as the most prevalent subtype of non-small cell lung cancer². The early treatment of lung adenocarcinoma mainly relies on surgery, while the middle and late stages include surgery, chemotherapy, radiotherapy, targeted and immunotherapy, etc. Targeted therapy drugs such as gefitinib, erlotinib, crizotinib, etc.³. Over recent years, clinical practice has incorporated various targeted therapeutic agents, including gefitinib, erlotinib, crizotinib, among others, that are specifically designed to address particular molecular markers such as EGFR, ALK, and ROS1⁴. They are usually less toxic to normal cells and have low side effects. However, due to their substantial medical expenses and the inevitable emergence of drug resistance in nearly all patients, the population that can derive benefit from these treatments is constrained⁵. Therefore, exploring new therapeutic drugs has important clinical value and practical significance for patients with lung adenocarcinoma.

MicroRNAs (miRNAs) belong to a group of briefs, non-protein-coding RNAs. They measure roughly 22 nucleotides in size, that are widely found in both plant and animal species. These molecules have the capability to selectively bind to a majority of mRNAs, thereby altering gene expression level⁶. miRNAs play indispensable roles in fundamental cellular mechanisms, encompassing differentiation, proliferation, migration and the regulation of programmed cell apoptosis⁷. MiR-494-3p is located on human chromosome 14q32.31⁸. Throughout various phases of tumor development, altered expression patterns of miR-494-3p have been observed, functioning either as a cancer-promoting agent or a tumor-inhibiting factor. It is worth noting that miR-494-3p is also highly involved in the occurrence and development of lung cancer as a cancer promoting factor^9,10 and it is speculated that miR-494-3p is a candidate biomarker and therapeutic target for malignant transformation. At present, there is no research on the mechanism of action of miR-494-3p in LUAD. Therefore, in-depth exploration of the specific oncogenic mechanism of miRNA-494-3p is of great significance and value in the clinical treatment of LUAD.

MAPK, a ubiquitous kinase in eukaryotic organisms, becomes activated in response to diverse stimuli encompassing stress, neurotransmitters, hormones, cytokines, and cellular adhesion events¹¹. The MAPK signaling cascade encompasses a highly conserved three-tier kinase sequence. They jointly regulate a variety of important cellular physiological and pathological processes, including cell metabolism, cell proliferation, cell differentiation and apoptosis¹². ERK, a member of the MAPK family, plays a pivotal role in signal transduction cascades. Currently, four MAPK cascades have been defined: ERK1/2, p38-MAPK, JNK, and ERK5¹³. Mutations and dysregulation of key molecules involved in MAPK/signaling are common in human malignancies. The dysregulation of the MAPK signaling pathway has been documented in several types of cancers, including those affecting the ovary, colon, breast, thyroid, pancreas, and other organs¹⁴. The prolonged activation of the MAPK signaling pathway can facilitate the transition of normal cells into tumorigenic states and is implicated in processes like metastatic spread of tumors, breakdown of the extracellular matrix, and the formation of new blood vessels. Consequently, inhibitors targeting MEK, BRAF and other key components of the MAPK signaling pathway have been formulated and are now utilized in clinical settings¹⁵.

Cell proliferation enhancement and apoptosis suppression represent significant biological hallmarks of cancer cells^16,17. The MAPK signaling pathway promotes cellular proliferation and exhibits an anti-apoptotic influence, suggesting its involvement in the advancement of various cancer types. Nonetheless, the MAPK pathway exhibits a dual nature. ERK 1/2 kinase also has the function of inducing apoptosis in tumor cells under certain conditions¹⁸. Apoptosis can be initiated by internal or external stimuli and mediated through both external and internal pathways. Research has shown that the activation of ERK is associated with an intrinsic apoptotic pathway characterized by the activation of the promoter Caspase9¹⁹. Upon exposure to external environmental stressors or receipt of specific apoptotic signals, the extrinsic apoptotic pathway can be activated, triggering a cascade of reactions that include the activation of additional Caspases, like Caspase3. Moreover, miRNAs have demonstrated a role in regulating a multitude of vital signals that are integral to cellular proliferation and programmed cell death. For example, ERK phosphorylates and activates TRBP and subsequently regulates the expression of growth-promoting miRNAs and let-7 tumor suppressors²⁰. MiR-216b, miR-543 and miR-146a have also been shown to be able to inhibit tumor cell growth and survival by suppressing MAPK/ERK signaling pathway²¹.

The invasion and metastasis of malignant cells are important signs of tumor progression, often indicating adverse clinical outcomes²². Regrettably, no approved drugs specifically designed to impede invasion or metastatic processes are currently available. Consequently, inhibiting neovascularization stands as a primary therapeutic option for managing tumor cell metastasis²³. As an example, bevacizumab, a molecule that selectively targets VEGF, operates by normalizing the tumor vasculature, thereby impeding distant tumor invasion and metastasis. Additionally, it mitigates hypoxia within the tumor microenvironment and facilitates increased accumulation of therapeutic agents within the tissue²⁴. Nonetheless, the lasting effectiveness of monotherapy targeting anti-angiogenesis is limited. The intricate and dynamic angiogenic system encompasses a variety of biological molecules that either stimulate or suppress angiogenesis and also incorporates MAPK signaling pathways²⁵. Hence, the combination of anti-angiogenesis with other adjunctive therapies represents another significant area of research.

In the conventional management of LUAD, TCM is considered among the adjunctive therapies employed. The combination of active components of TCM and antitumor drugs has always been favored in clinical treatment. The incorporation of Traditional Chinese Medicine alongside Western medical practices has shown promising results in the treatment of lung cancer, enhancing the responsiveness to chemotherapy and radiotherapy while mitigating toxicity and adverse effects²⁶. Supplementing TCM treatment in LUAD patients can alleviate cancer-related symptoms²⁷. For patients with advanced NSCLC who do not exhibit progression following initial chemotherapy, the survival rate at one year is higher when TCM is combined with maintenance chemotherapy, compared to maintenance chemotherapy administered alone²⁸. The safe, effective and low toxicity of traditional Chinese medicine preparations can enhance the immune function of patients and improve the effect of anti-tumor treatment²⁹.

Naturally sourced, highly efficient and low-toxic small molecule compounds are considered to be potential cancer treatments. Erianin, a dibenzyl compound naturally sourced from Dendrobium, has been included in the Pharmacopoeia of China. Research has confirmed its varied pharmacological effects, which include, among others, antitumor activities, anti-inflammatory capabilities, and immune modulation properties³⁰. Specifically, in relation to its antitumor efficacy, erianin can induce cell apoptosis, block angiogenesis or inhibit cell growth and migration in various cancers through the ERK pathway, ROS mediated JNK/c-Jun and AKT/mTOR pathways, PI3K/AKT/mTOR pathway, calcium/calmodulin dependent ferroptosis pathway, etc.³¹. In addition, pharmacological network target analysis showed that it was also significantly enriched in the cascade of MAPK pathway³². Therefore, this study used LUAD cells line and nude mouse subcutaneous transplant tumor as models to preliminarily explore the anti-tumor mechanism of erianin in LUAD. Intended to provide more options and theoretical support for the clinical treatment of LUAD patients.

Methods and materials

Cell culture

Both A549 cells and SPC-A-1 cells were purchased from Pricella Company.A549 and SPC-A-1 cells were cultured in RPMI-1640 and high-glucose DMEM medium (containing 10% fetal bovine serum and 1% penicillin/streptomycin), respectively, and placed in a 5% CO₂ cell incubator at 37 °C.

Cell viability was assessed using the CCK-8 assay

To assess the effect of erianin on cellular viability and establish its IC₅₀ concentration, the CCK-8 assay was utilized. Cells were plated at a density of 5000 cells per 100 µL in each well of 96-well plates and subsequently cultured. After the cells were in good growth level, the erianin stock solution was prepared into different concentrations (0,1, 15, 30, 60, 120, 240, 480nM) using the culture medium and 100µL was added to each well. After 24 h of treatment, the current culture medium was discarded and fresh medium containing 10% CCK-8 reagent was introduced for incubation in darkness for a period of 30 min. Absorbance was measured at a wavelength of 450nM using a microplate spectrophotometer, from which the IC₅₀ value and cellular viability were subsequently calculated. The concentration gradient of erianin was set according to the IC₅₀ for the subsequent experiments.

Scratch experiment

Cells were plated in 6-well dishes at a density of 5*10⁵ cells per well. Once the cells reached complete confluence, a scratch was gently made across the cell monolayer using a 200µL pipette tip. After gently washing away the cell debris with PBS, add erianin to the culture medium and continue treatment for 24 h. Use a microscope to record the wound width A at 0 and 24 h Scratch healing rate (%) = (A_0h-A_24h)/A_0h × 100%.

Clone formation experiment

The density of the cells to 500 cells/mL vaccination in 6 orifice plate, after waiting for cells to stick wall replacement medium containing erianin, once every 2 ~ 3 day to replace fresh culture medium containing medicines. Upon noting the formation of clonal cell aggregates, the culture medium was removed by aspiration, and the cells were subsequently fixed with 4% paraformaldehyde. Subsequently, the cells were stained with a 0.1% solution of crystal violet, rinsed thoroughly with phosphate-buffered saline (PBS), and then allowed to dry naturally at room temperature. The colonies were photographed and recorded under a microscope, and their counts were tallied using Image J software.

Transwell assay

For the migration assay, 200 µL of serum-depleted medium containing 2 × 10⁵ cells/mL and specific erianin concentrations was added to uncoated Transwell chambers. For the invasion assay, chambers were pre-coated with Matrigel (1:8 dilution, 50 µL/well) and loaded with 200 µL of the same medium containing 3–4 × 10⁵ and erianin. The lower chamber received 600 µL of 20% FBS-containing medium. After 24 h incubation, non-migrated/non-invaded cells were removed, and the remaining cells were fixed, stained with 0.1% crystal violet, imaged, and quantified via ImageJ. The higher seeding density for invasion assays compensated for Matrigel-induced reduced penetration efficiency, ensuring reliable detection of erianin’s effects.

Flow cytometry

Apoptosis and cell cycle dynamics in various cell lines were assayed via flow cytometry. Subsequent to a 24-hour exposure period, the cells from each experimental group were gathered, cleaned, and resuspended in refrigerated PBS. Subsequently, they were fixed in 70% ethanol at a temperature of 4 °C. The cells were stained with Cell Cycle and Apoptosis Analysis Kit and incubated at 37 °C in the dark for 30 min. A flow cytometer was employed to measure fluorescence intensity at an excitation wavelength of 488 nm. The collected data were then processed and analyzed utilizing the Flow J analytical platform.

Tube formation experiment

Blend the matrix gel with medium devoid of serum (1:3), remove 50µ L and vertically spread it to the bottom of a 96 well plate, then place it in an incubator for colloid coagulation. HUVEC cells in optimal condition were initially subjected to a 6–8 h starvation period in serum-free medium, followed by washing with PBS and enzymatic digestion. The HUVECs were resuspended, counted and diluted (3 ~ 5*10⁴ cells/well) using the test medium and disperse evenly onto the surface of the matrix gel layer. Take photos and record them using a microscope after 4–6 h.

RT-qPCR

Cellular total RNA was extracted using the EasyZol Reagent kit. Subsequently, RNA was converted into cDNA through reverse transcription employing the stem-loop methodology, utilizing the Hyper Script TM III miRNA First-Strand cDNA Synthesis Kit. Subsequently, RT-qPCR was performed using the 2xS6 Universal SYBR qPCR Mix provided in the kit. Subsequently, the expression levels of the target genes across different cell types were standardized relative to the expression of U6. Measure the relative expression of genes using the 2^{− △ △ CT} method. The primer sequences utilized in this study are listed in Table 1.

Table 1.

RT-qPCR primer sequence of miRNA.

Name	Sequence(5’ to 3’)
U6 forward	CGCTTCGGCAGCACATATAC
U6 reverse	TTCACGAATTTGCGTGTCAT
miR-494-3p forward	GCCTGAAACATACACGGGAAACCT
miR-494-3p reverse	ATCCAGTGCAGGGTCCGAGG

The detection targets of the RT-qPCR experiments in this study are human lung adenocarcinoma cells (A549, SPC-A-1) and human-derived miR-494-3p in nude mouse xenograft tumor tissues (the xenograft tumor cells are of human origin). Therefore, all the primers used are specific primers designed for human sequences. The absence of non-specific amplification has been confirmed through primer specificity validation experiments (a single peak in the melting curve).

Protein extraction and Western blotting

Employing RIPA buffer, we isolated total protein from the cells that underwent treatment and thereafter assessed its concentration utilizing a BCA-based protein quantification kit. The protein bands were separated using SDS-PAGE and subsequently transferred onto a polyvinylidene fluoride (PVDF) membrane. After incubating with rapid blocking solution for 15 min, dilute the primary antibody according to the instructions and incubate the PVDF membrane at 4℃. After an 8 ~ 12 h period, The PVDF membrane was rinsed three times with TBST and then allowed to incubate with a secondary antibody, conjugated to horseradish peroxidase (HRP), at room temperature for 90 min. Perform chemiluminescence assay on proteins using ECL assay kit. During the blotting process, the blot membrane was cut into separate strips or sections prior to antibody hybridization. Briefly, after the transfer of proteins onto the blot membrane was completed, the membrane was carefully trimmed or sliced into designated fragments using a clean, sharp blade. The cutting was performed in a consistent and reproducible manner (according to the molecular weight range of target molecules) to facilitate subsequent parallel antibody incubation, reduce cross-reactivity between different antibodies, or enable the detection of multiple target molecules on a single original blot. After cutting, each membrane strip/section was processed independently for the subsequent blocking step and antibody hybridization procedure as described in the main protocol.

Tumor formation experiment in nude mice

The Balb/c male nude mice (6 weeks old, SPF grade) required for the experiment were purchased from Jiangsu Jichu Pharmaceutical Kang Company.6-week-old Balb/c male nude mice were housed in independent ventilated cages in SPF grade animal rooms (temperature 20 ~ 26 ℃, humidity 40 ~ 70%, 12 h of daylight alternation). After suspending the cells in 200 µL of matrix gel, they were implanted into the axillary area of nude mice. The tumors’ dimensions, including length (L) and width (W), were assessed every three days, and the volume was calculated using the formula: V = (L * W²)/2. Approximate ten days post-tumor formation, the nude mice were randomly assigned to either a control group or a treatment group. The treatment group received daily intraperitoneal injections of Erianin (100 mg/kg, solvent: sterile corn oil + DMSO), while the control group received daily injections of the same dose of corn oil + DMSO. The injections were carried out daily for 15 days. After the medication was stopped, the mice were observed for three days and then they were euthanized by intraperitoneal injection of 1.25% Avertin at a dose of 0.25 ml per 10 g. The subcutaneous tumors were removed and stored at −80℃. The Ethical Committee for Experimental Animals at Anhui Medical University has granted approval for this study. (No. LLSC 20242224)

Data analysis

All quantitative data in this study were first tested for normality using the Shapiro-Wilk test. For data that conformed to a normal distribution, parametric tests were adopted: independent samples t-test was used for comparisons between two groups, one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test was used for multiple group comparisons. For data that did not conform to a normal distribution, non-parametric alternative tests were employed: Mann-Whitney U test was used for comparisons between two groups, and Kruskal-Wallis H test followed by Dunn’s post-hoc test was used for multiple group comparisons.

Data processing​

All experimental data acquisition, analysis, and visualization in this study were performed using the following software, with detailed information provided below:​.

Flow cytometry data processing: Cytexpert (Version 2.4), a flow cytometry analysis software supported by Beckman Coulter, was used (official download link: CytExpert Software for the CytoFLEX Platform). This software was applied for fluorescent signal acquisition of experimental samples, fluorescence compensation adjustment, gating analysis of cell populations (e.g., gating of total cell population and single-cell population) and statistical analysis of positive cell proportions.​.

Image data quantification: ImageJ (Version 1.54), an image analysis software developed by the National Institutes of Health (NIH, USA), was utilized (official download link: https://imagej.net/ij/index.html). It was used to perform cell counting, fluorescence intensity quantification and grayscale value analysis of experiment-related images (e.g., cell fluorescence staining images). A uniformly set parameter standard was adopted for all image analyses to ensure data consistency.​.

Statistical analysis and result visualization: GraphPad Prism software (Version 9.5.1) was employed for statistical analysis of data (e.g., significance test for differences) and result visualization (e.g., plotting of bar charts and line graphs) (official download link: https://www.graphpad.com/scientific-software/prism/). Statistical results were expressed as “mean ± standard deviation (mean ± SD)”, and a P-value < 0.05 was considered statistically significant.

Results

Erianin inhibited the expression of miR-494-3p in LUAD cells

The CCK-8 kit was used to detect the IC₅₀ values of A549 and SPC-A-1 cells treated with different concentrations of erianin and the concentration gradient was established according to the IC₅₀ value for subsequent experiments. The IC₅₀ values of erianin in A549 and SPC-A-1 cells were 57.69 nM and 33.31nM, respectively (Fig. 1A-B). Following erianin treatment, the expression levels of miR-494-3p in each cell group were assessed using RT-qPCR. The findings indicated that erianin led to a marked downregulation of miR-494-3p expression in both A549 and SPC-A-1 cells. (Fig. 1C-D).

Fig. 1.

Effect of erianin on proliferation and of LUAD cells and the expression of miR-494-3p in vitro. (A) The IC₅₀ value of Eranin in A549 cells was 57.69 nM. (B) The IC₅₀ value of 5ranin in SPC-A-1 cells was 33.31 nM. (C, D) After 24 h of treatment with erianin, the level of miR-494-3p in A549 and SPC-A-1 cells decreased significantly. (E, F) The cell viability of A549 and SPC-A-1 cells after eranin treatment was measured by CCK-8. The proliferation of A549 and SPC-A-1 cells after Eranin treatment was determined by (G–J) wound healing assay and (K–N) cell colony-forming assay. (ns: p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, **** p < 0.0001).

Erianin inhibited the proliferation of LUAD cells in vitro

After treatment of LUAD cells with erianin for 24 h, the effect of erianin on cell proliferation was evaluated by CCK-8, wound healing and colony formation assays. The results of the CCK-8 assay revealed that erianin treatment resulted in a significant reduction in cell viability when compared to the control group.(Fig. 1E,F).The cell scratch experiment results indicated that the wound healing rate of the treatment group cells was notably slower compared to that of the control group.(Fig. 1G–J).The cloning assay showed a substantial decline in the number of colonies formed by A549 and SPC-A-1 cells in the treated group, when compared to the untreated control group. Additionally, within the range of concentrations deemed safe, the inhibitory effect became more pronounced as the concentration of erianin increased. (Fig. 1K–N).Our findings indicate that erianin exhibits a dose-dependent inhibitory effect on the proliferation of LUAD cells in vitro, as evidenced by the results obtained, exhibiting a significant effect. Within the therapeutic range of the drug, an increase in the concentration of erianin led to a more pronounced inhibitory effect.

Erianin inhibited the migration and invasion of LUAD cells in vitro

We evaluated the effects of erianin on the migratory and invasive capabilities of A549 and SPC-A-1 cells by employing the transwell assay. Compared to the control group, erianin treatment resulted in a significant inhibition of both migration and invasion in A549 cells (Fig. 2A–D). In SPC-A-1 cells, although both cell migration and invasion were inhibited after treatment with erianin compared with the control group, the comparison of cell invasion inhibition between the two groups at a concentration of 20nM showed no statistically significant difference (Fig. 2E–H).

Fig. 2.

Effect of erianin on migration, invasion, cell death and cell cycle arrest of LUAD cells in vitro. (A–D) The migration and invasion of A549 cells after eranin treatment were determined by Transwell assay. (E–H) The migration and invasion of SPC-A-1 cells after eranin treatment were determined by Transwell assay. (I–L) The apoptosis of A549 and SPC-A-1 cells in vitro after eranin treatment was determined by flow cytometry. (M–P) And the cell cycle of A549 and SPC-A-1 cells after eranin treatment was detected by flow cytometry. (ns: p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

Erianin induced the apoptosis of LUAD cells in vitro

Flow cytometry was used to detect the apoptosis of A549 and SPC-A-1 cells treated with different concentrations of erianin in vitro. The results showed that the in vitro apoptosis of A549 cells (Fig. 2I-J) and SPC-A-1 cells (Fig. 2K,L) was significantly increased after the treatment with different concentrations of erianin compared with the control group.

Effect of erianin on LUAD cell cycle in vitro

Evaluate the cell cycle changes of A549 and SPC-A-1 cells after treatment with different concentrations of erianin using flow cytometry. In A549 cells (Fig. 2M,N), after 24 h of treatment with erianin (Fig. 2O,P), the G0/G1 phase of each group of cells was significantly shortened and the S phase was significantly prolonged compared to the control group. Taken together with the inhibitory effects of erianin on the proliferation of LUAD cells detected in wound healing and cell cloning, we hypothesized that erianin might exert its therapeutic effect by arresting the cell cycle of LUAD at S and G2/M phases.

Erianin inhibited the formation of new blood vessels in LUAD cells in vitro

Tumor angiogenesis represents a key characteristic of malignant tumor progression and elevated levels of angiogenesis are intimately associated with tumor proliferation, invasion and metastatic potential. We explored the effect of erianin on the neovascularization of LUAD through the tube forming experiment of HUVEC cells. The findings indicated that, in both A549 and SPC-A-1 cells (Fig. 3A–D), the vascular branch length in the erianin-treated group was notably shorter compared to the control group, indicating that erianin has an inhibitory effect on the generation of new blood vessels in LUAD.

Fig. 3.

Effects of erianin on angiogenesis and protein expression of LUAD cells in vitro. (A–D) In the angiogenesis assay, the total length of vascular branches of A549 and SPC-A-1 cells were significantly decreased compared with the control group. (E) Dual-luciferase reporter assay confirmed that MEGF9 directly targets and regulates MAPK13. The proteins expression in the (F–K) in vitro cells models of the erianin group and control group were detected by Western blotting. Western blotting results of A549 xenograft tumor tissues. GAPDH was used as the internal control for MEGF9, MAPK13, p-MAPK13, VEGF-A, Bcl-2 and Survivin; β-actin was used as the internal control for ERK1/2 and p-ERK1/2; Tubulin was used as the internal control for Cyclin D1, Caspase3, Caspase9 and Bax. (ns: p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, **** p < 0.0001).

Effect of erianin on protein expression in LUAD cells in vitro

In our prior research, we conducted RNA-seq sequencing and analyzed protein-protein interaction networks, Initially, our analysis revealed a significant enrichment of differentially expressed genes in the MAPK13 signaling pathway, specifically in the context of the miR-494-3p overexpression model in LUAD cells (Fig. 3E). Dual luciferase assay confirmed that miR-494-3p could target MEGF9 to play a role in promoting LUAD cells. In the earlier section of this investigation, we have confirmed that miR-494-3p was downregulated in LUAD cell lines by RT-qPCR. Therefore, the effects of erianin on miR-494-3p/MEGF9/MAPK13 axis were further explored.

After a 24-hour exposure to erianin, protein expression levels of critical factors were assessed through Western blot analysis in both A549 and SPC-A-1 cell lines (Fig. 3F,I). The results demonstrated that MEGF9 expression in LUAD cells showed an upward trend following erianin treatment compared to the control group. The expression of MEGF9 was statistically different in A549 cells when the concentration of erianin was 60nM. In SPC-A-1 cells, the expression of MEGF9 was significantly different when the concentration of erianin was 40 ~ 60nM. In the MAPK/ERK related pathway, the expression of MAPK13 and P-MAPK13 proteins was significantly down-regulated in A549, but there was no statistical difference in the expression of p-MAPK13 when erianin concentration was 20nM. In SPC-A-1 cells, the expression levels of MAPK13 showed significant changes at erianin concentrations of 40–60 nM. Furthermore, when the erianin concentration reached 60 nM, the expression of p-MAPK13 was markedly suppressed. With the increase of erianin concentration, the expression of ERK1/2 protein was significantly increased in the two lung adenocarcinoma cell lines. Notably, the p-ERK1/2 protein levels both in A549 and SPC-A-1 cells have no significant changes (Fig. 3G,J). This phenomenon suggests that it mainly regulates the expression or stability of ERK1/2, rather than activating its phosphorylation dependent signaling pathway. This pattern may reflect a compensatory feedback mechanism of cells when upstream kinase activity is limited, namely, maintaining signal homeostasis by upregulating ERK1/2. In addition, Erianin may enhance the stability of ERK1/2 protein or partially inhibit the activity of MEK, resulting in an increase in total amount but no change in phosphorylation level. Overall, these results indicate that Erianin can regulate the abundance of ERK1/2 without triggering activation of the classical ERK pathway.

In the early stages of our investigation, a thorough array of cellular functional assessments revealed that erianin potently inhibits the proliferation, angiogenesis, invasive capabilities, and migration of LUAD cells, while concurrently augmenting apoptosis. To deepen our understanding, we conducted a comprehensive analysis of protein expression profiles in vitro, focusing on LUAD cell lines. Our findings suggested a notable downregulation in the expression of Cyclin D1, a pivotal regulator of the cell cycle, when compared to the control group. Furthermore, the expression levels of bcl2 and survivin, inhibitor of apoptosis, and VEGF-A, a crucial mediator of angiogenesis, were markedly reduced when compared to the control group. However, in A549 and SPC-A-1 cells, there was no significant increase in the expression levels of pro-apoptotic proteins such as Caspase-3, Caspase-9 and Bax (Fig. 3H,K).

Effect of erianin on miR-494-3p and protein expression in LUAD cells in vivo

To assess the anti-tumor efficacy of erianin in vivo, subcutaneous xenograft tumor models of A549 and SPC-A-1 cell lines were established in nude mice. Throughout the sustained administration period, the rate of expansion of the transplanted tumor volume in the treatment group was slower compared to that observed in the control group. Following 15 days of uninterrupted administration. In comparison to the control group, a significant decrease in the size of the transplanted tumors was observed in the treatment group.(Fig. 4A–F). Furthermore, RT-qPCR analysis of transplanted tumor tissues indicated that the expression of miR-494-3p was notably downregulated in vivo in tumor tissues following erianin treatment, in contrast to the control group (Fig. 4G,H). Analysis using Western blot revealed a marked increase in MEGF9 gene expression in vivo in tumor tissues following erianin treatment, when compared to the control group. Besides, erianin significantly downregulated the expression levels of CyclinD1, VEGF-A and Survivin proteins while markedly upregulating ERK1/2 protein expression in tumor tissues. The findings obtained from the cellular model are consistent with these results. The expression of MAPK13 and p-MAPK13 proteins was significantly inhibited in A549 tissues. Notably, unlike in the cellular model, MAPK13, p-MAPK13 and Bcl2 protein expression were not significantly decreased in SPC-A-1 tumor tissues following erianin treatment (Fig. 4I–N). This may be because the microenvironment in tumor tissues is more complex and significantly different from single-cell culture conditions, and further studies are needed to reveal the specific mechanisms.

Fig. 4.

Western blotting results of transplanted tumor models in vivo. (A, D) A549 and SPC-A-1-Xenogragted tumors models of control group and experimental group in vivo. (B, E) A549 and SPC-A-1-Xenogragted tumors volume growth curves of control group and experimental group. (C, F) A549 and SPC-A-1-Xenogragted tumors weight of control group and experimental group in vivo. (G, H) The level of miR-494-3p in A549 and SPC-A-1-Xenogragted tumors models of the experimental group and control group. (I–N) Western blotting assay and expression analysis of proteins in tumor tissues of the control and experimental groups. Western blotting results of A549 xenograft tumor tissues. GAPDH was used as the internal control for MEGF9, MAPK13, p-MAPK13, VEGF-A, Bcl-2 and Survivin; β-actin was used as the internal control for ERK1/2 and p-ERK1/2; Tubulin was used as the internal control for Cyclin D1, Caspase3, Caspase9 and Bax. (ns: p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, **** p < 0.0001).

Discussion

In recent years, erianin has received much attention for its potential role in tumor treatment. Early research indicates that erianin can effectively suppress the proliferation of estrogen receptor-positive breast cancer T47D cells and arrest cell cycle progression at the G2/M phase by inhibiting the expression of cyclin-dependent kinases, thereby impacting cellular proliferation and cell cycle regulation³³. Wang et al. discovered that erianin suppressed the proliferation of osteosarcoma cells by inducing the production of ROS and concurrently increasing the expression of cell cycle-associated proteins p-Cdk1 and p-Cdc25c, leading to cell cycle arrest at the G2 phase³⁴. In present study, we found that erianin inhibited the proliferation of LUAD cells in vitro and in vivo in a dose-dependent manner and arrested the cells in the S and G2/M phases to exert its anti-tumor effect. Cyclin D1 serves as a crucial mediator facilitating the transition of LUAD cells from the G1 to the S phase³⁵. Therapeutic approaches aimed at Cyclin D1 and its associated pathways have yielded promising outcomes, particularly with the clinical implementation of CDK4/6 inhibitors. This discovery offers fresh hope for individuals battling cancer³⁶. Furthermore, targeting Cyclin D1 can be integrated with novel therapies such as those that address tumor angiogenesis and immune checkpoints. For example, in melanoma studies, concurrently inhibiting Cyclin D1 and the immune checkpoint protein PD-L1 has been shown to synergistically boost anti-tumor immune responses, suppress tumor growth, and prevent metastasis³⁷. Yan et al. predicted that cyclinD1 is also one of the targets of hollisterine in the treatment of lung cancer³². In our study, we found that erianin can effectively inhibit the expression of cyclin D1 in lung adenocarcinoma cells.

During the process of apoptosis, the caspase family enzymes play a key role in the regulation of apoptosis and erianin can induce apoptosis in esophageal squamous cell carcinoma and cervical carcinoma through caspase cascade reactions^38,39. When cells are exposed to internal stress signals, including DNA damage, oxidative stress, or endoplasmic reticulum stress, among various other triggers, this process is accompanied by activation of caspase-3, caspase-7,and caspase-9.Caspase-3 is considered the main executor and plays a central role in cell apoptosis.Caspase-9 is one of the key factors in the endogenous apoptosis pathway, which can activate caspase-3 to initiate the execution stage of cell apoptosis, this prevents the repair of DNA damage and leads to alterations in cell morphology⁴⁰. Bax/Bcl-2, a classic apoptotic protein pair, is nearly ubiquitous across all cancers and the equilibrium between Bax and Bcl-2 dictates the fate of cancer cell survival⁴¹. Erianin, acting as a pro-oxidant, can augment the expression of Bax while inhibiting the expression of Bcl-2. This, in turn, modifies the permeability of the mitochondrial membrane and promotes the apoptotic process in cancer cells⁴². In this study, we observed that Erianin induced apoptosis in lung adenocarcinoma LUAD cells and significantly downregulated the anti-apoptosis-related protein Bcl-2. Interestingly, no significant changes were observed in Caspase3/9 and Bax. Survivin is a member of the apoptosis inhibitor protein family, and its abnormal activation is associated with signaling pathways including PI3K/AKT, MAPK/ERK, and Wnt/β-catenin, which affect tumor cell proliferation and invasion⁴³. Therefore, we speculate that Erianin-induced apoptosis may primarily result from the inhibition of Survivin and the activation of non-caspase-dependent or alternative apoptosis pathways, rather than the transcriptional induction of classical pro-apoptotic proteins. Consequently, Survivin may serve as a key mediator in the mechanism of Erianin-induced cell proliferation inhibition and apoptosis induction.

Tumor metastasis is a complex process in which angiogenesis plays a crucial role. In various cancer types, such as lung and breast cancer, the expression level of VEGF-A has been found to positively associate with tumor vessel density, tumor size, and metastatic potential⁴⁴. In this study, we preliminarily confirmed that erianin could promote and inhibit angiogenesis by HUVEC tube formation assay. As a result, a substantial decrease in VEGF-A protein levels was also noted in both in vitro and in vivo overexpression models. Therefore, VEGF-A may also be one of the therapeutic targets of erianin.

The MAPK/ERK pathway plays a key role in tumor cell migration and invasion. In tumor cells, Abnormal activation of the MAPK/ERK signaling pathway can enhance cell proliferation by expediting the progression through the cell cycle. It can elevate the expression of cell cycle proteins, enabling tumor cells to bypass normal cell cycle checkpoints and proceed with division⁴⁵. Concurrently, the modulation of anti-apoptotic proteins such as Bcl-2 renders tumor cells resistant to drug-induced apoptotic signals, thereby enabling their sustained survival⁴⁶. The MAPK/ERK pathway can also interact with angiogenesis signals. It can also regulate the expression of angiogenesis-related factors, such as VEGF, furnishing the necessary blood supply for tumor growth and metastasis⁴⁷. Taking into account the structural features of erianin, several studies have hypothesized potential targets for this compound, with a specific focus on the intricately connected MAPK pathway³².

A multitude of research studies have validated that therapeutic approaches targeting microRNAs in cancer exhibit substantial chemo-preventive benefits. Despite the growing body of evidence indicating that erianin can suppress the proliferation of multiple cancer cell types, the pivotal role of miRNA in this inhibitory process has yet to be thoroughly investigated. Considered a potential biomarker and therapeutic target, miR-494-3p has shown associations with patient prognosis. Studies have demonstrated increased levels of miR-494-3p expression in glioblastoma tissue, as compared to non-cancerous brain tissue in humans. Inhibiting its expression can activate the PTEN/AKT pathway and improve the malignant potential of the tumor⁴⁸. Analogously, miR-494-3p plays a crucial part in the initiation and advancement of lung cancer. Hua et al. found that circVAPA could activate the PI3K/AKT signaling pathway by regulating the miR-494-3p/IGF1R axis to accelerate the progression of small cell lung cancer¹⁰. Existing studies have reported that miR-494-3p can enhance the migration and invasion abilities of non-small cell lung cancer cells by targeting SET/I2PP2A. As an inhibitor of protein phosphatase 2 A, abnormal expression of SET/I2PP2A can affect tumor progression by regulating pathways such as AKT and ERK⁴⁹. This study found that downregulation of miR-494-3p can mediate the inhibition of the MEGF9/MAPK/ERK pathway, suggesting that miR-494-3p may exert pro-tumor effects through multi-target regulation in lung adenocarcinoma—it can not only activate the AKT/ERK pathway by targeting SET/I2PP2A but also indirectly regulate the MAPK13/ERK signaling axis by inhibiting MEGF9. These two regulatory modes may act synergistically at different stages of tumor progression or in different microenvironments to jointly promote cell proliferation, migration and invasion. Future studies can further verify the synergistic regulatory relationship between miR-494-3p and SET/I2PP2A, MEGF9, and clarify its regulatory preference in different subtypes of lung adenocarcinoma, providing a basis for the development of more precise targeted therapy strategies. Our research group developed a model for overexpressing miR-494-3p, screened the target gene MEGF9 that is associated with patient prognosis and performed PPI network analysis on the DEGs of the model to predict the key gene MAPK13 in the MAPK pathway. The results of this study showed that Erianin could effectively inhibit the expression of miR-494-3p, significantly reduce the protein level of MEGF9, down-regulate MAPK13 and up-regulate ERK1/2 protein levels.

In this study, GAPDH, β-actin, and Tubulin were selected as internal control genes for WB based on the following considerations: First, these three housekeeping genes belong to different functional categories (glycolytic enzyme, cytoskeletal protein and microtubule protein, respectively) and exhibit high expression stability across different cell cycles, drug treatments and tissue microenvironments, thereby avoiding biases caused by expression fluctuations of a single internal control. Second, their application scenarios are complementary in lung adenocarcinoma cells and tissues: GAPDH is suitable for the quantification of cytoplasmic proteins, β-actin for membrane proteins and cytoskeleton-related proteins and Tubulin for the quantitative calibration of cell cycle- and apoptosis-related proteins. This multi-internal control strategy enhances the reliability of protein quantification results.

In summary, we speculate that erianin can regulate the proliferation, migration, invasion, and angiogenesis of LUAD cells by modulating the miR-494-3p/MEGF9/MAPK13/ERK/Survivin/CyclinD1/VEGF-A axis. This provides a new strategy for erianin to potentially become a compound for treating LUAD.

Conclusion

Our results identified another anti-tumor mechanism of erianin by down-regulating the expression of miR-494-3p, increasing the expression level of its target gene MEGF9, and affecting the MAPK/ERK signaling pathway. The objective is to promote apoptosis and regulate the cell cycle, while concurrently inhibiting the proliferation, migration, and neovascularization of LUAD cells. Erianin holds promise as a potential compound for the therapy of lung adenocarcinoma.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

T Wang conceived the study. LX Tang, LJ Zhou, CL Li and YL Ruan were tasked with conducting the literature search. T Wang, YL Ruan and LX Tang collaborated on writing the manuscript, providing scientific insights, and creating graphical representations. All authors played a role in contributing to the article and have approved the final version submitted for publication.

Funding

This work was supported by the Natural Science Foundation of Hefei (No. 2022034), the Discipline Construction Funds of Wang Tong (No. 2021LCZD15), and the Clinical research and cultivation project of Second Affiliated Hospital of Anhui Medical University (No. JF20235989).

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

The Ethics Committee of Anhui Medical University (No. LLSC20242224) granted approval for this study. All methods were carried out in accordance with relevant guidelines and regulations and it was confirmed that our research was reported in accordance with the ARRIVE guidelines.