Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Mar 31.
Published in final edited form as: Environ Pollut. 2026 Mar 17;397:127968. doi: 10.1016/j.envpol.2026.127968

Cellular responses of human Muller glia exposed to test dust pollution

Maumita Datta 1, Brandon M Bessen 1, Milin J Patel 1, Abigail S Hackam 1,*
PMCID: PMC13034449  NIHMSID: NIHMS2158471  PMID: 41850516

Abstract

Air pollution is a global environmental hazard and is associated with increased severity and progression of several retinal diseases, including glaucoma and age-related macular degeneration. Muller glial are radial glia in the retina that play essential roles in metabolic support, redox balance and neuroprotection. Despite their importance, the effects of pollution on retinal glial responses are not well characterized. The objectives of this study were to determine the effects of a test dust preparation on viability, injury responses and oxidative stress levels in human Muller glia cell line. Arizona test dust (ATD) contains silica, oxides, particulate matter smaller than 10 microns and other potentially harmful components. Subconfluent cultures of Muller glia MIO-M1 cells were exposed to ATD (0.1 – 50 μg/mL) and cell viability, reactive oxygen species (ROS) production, antioxidant gene expression and transcriptomic analyses were performed. ATD exposure led to increased ROS without reducing viability, and was accompanied by reduced expression of antioxidant genes NRF2 and SOD1. Bulk RNA-seq analysis demonstrated downregulation of numerous mitochondrial genes and alterations in genes regulating migration, inflammation and adhesion. Therefore, these findings indicate that ATD pollution disrupts antioxidant protective mechanisms and mitochondrial gene expression in Muller glia, potentially leading to oxidative imbalance and transcriptional alterations that could contribute to retinal dysfunction.

Keywords: air pollution, Muller glia, bulk RNA-seq, oxidative stress, retina

Graphical Abstract

graphic file with name nihms-2158471-f0001.jpg

Introduction

Ambient air pollution is recognized by the World Health Organization as a significant risk factor contributing to the global burden of disease (Cohen et al., 2017). Prolonged exposure to pollutants such as micron-size particulate matter (PM2.5 and PM10), nitrogen oxides, sulfur dioxide, and ozone is associated with increased mortality rates and adverse health effects. In the central nervous system (CNS), particulate matter exposure does not generally cause overt toxicity but instead induces glial activation and gliosis, neuroinflammation and neuronal dysfunction (Xu et al., 2022). Furthermore, studies using in vitro and in vivo model systems indicate that harmful effects of pollution involve changes to multiple cellular pathways, including reactive oxygen species (ROS) production, mitochondrial dysfunction, inflammation and DNA damage, which lead to tissue damage and degeneration (Li et al., 2023; Reddam et al., 2022; Redza-Dutordoir and Averill-Bates, 2016; Shimura, 2023; Vilas-Boas et al., 2024). However, the effect of pollution on these deleterious pathways in the retina is not well characterized, and it is unknown how retinal glia and homeostatic responses are affected by exposure to pollutants.

The eye is exposed to pollution particles directly through contact with the ocular surface as well as indirectly from inhalation and ingestion. Recent epidemiological studies have linked pollution to progression of age-related macular degeneration (Wang et al., 2025), increased prevalence of glaucoma (Lin et al., 2022)(Sun et al., 2024), retinal thinning and diabetic retinopathy (Lin et al., 2022) (Wang et al., 2025). Studies in zebrafish demonstrated that exposure to pollutants in crude oil suppressed retinal gene expression, caused Muller glia damage and reduced vision (Magnuson et al., 2020). Similarly, analysis of pollution effects in rodents demonstrated that pollutants such as microplastics and PM2.5 enter the retina and induce oxidative stress, apoptosis and disrupt tissue integrity (Gu et al., 2023) (Li et al., 2022a) (Zheng et al., 2025). Furthermore, mice exposed to PM2.5-containing polluted air showed reduced retinal responses to light, cell death, induction of inflammatory genes and oxidative stress (Li et al., 2022b). These studies indicate that there is a detrimental association between pollution exposure and retinal health, similar to other tissues.

Muller glia are the principal radial glial cells of the retina and play a crucial role in maintaining retinal homeostasis by providing structural, metabolic, and functional support to retinal neurons. Muller glia are also involved in maintaining the blood-retinal barrier, protecting against oxidative stress and modulating inflammatory responses. Studies using the well-characterized MIO-M1 human Muller glia cell line have revealed varied glial responses to toxic insults, including cell death, reactive gliosis and other stress-related alterations (Mahaling et al., 2023; Matsuda et al., 2017). Therefore, characterizing Muller glia responses is important for understanding their vulnerability to pollution and their potential role in detoxification and protecting the retina. Although the effects of pollutants, particularly PM2.5, have been analyzed in ocular cells such as endothelial cells, lacrimal gland, and RPE, the effects of air pollution components on Muller glia have not been investigated.

Arizona test dust (ATD) is a standardized reference material containing potentially harmful components such as silica, oxides, microorganisms and particulate matter smaller than 10 microns (Tomasek et al., 2025). ATD is produced by jet milling and processing of naturally occurring sand collected from Salt River Valley, Arizona, USA and is used as a surrogate for ambient pollution due to its well-characterized composition. The objectives of this study were to examine the effect of ATD pollution on human Muller glia, with a focus on oxidative stress, viability and injury responses. Using cell-based assays and RNA-seq, we demonstrated that Muller glia exposed to ATD had higher ROS and lower expression of oxidative stress detoxification genes and transcriptomic analysis revealed that ATD pollution exposure reduced expression of multiple mitochondrial genes. Together, these findings suggest that ATD pollution suppressed oxidative damage responses in Muller glia. Because these cells play an essential role in maintaining retinal homeostasis, these results suggest potential mechanisms by which air pollution contributes to retinal dysfunction and diseases.

Materials and Methods

Arizona Fine Test Dust Preparation and Endotoxin Testing

A1 Ultra fine Arizona Test Dust ISO 12103–1 (Powder Technology Inc., Arden Hills, MN) was used in all experiments. This test dust is a mixture of sand, road dust and other particulate matter with defined size distributions and is used as a standard to simulate exposure to dust in equipment and filtration testing (Supplemental Figure 1). Although processing and standardization of ATD means that it does not fully reflect the complexity of real-world road dust exposure, ATD is used because it has a defined composition that is important for reproducibility. ATD has been used in studies investigating effects of mineral dust air pollution exposure (Moazami et al., 2023)(Ichinose et al., 2008). All handling of the dry ATD particulate matter was performed under a hood while wearing an N95 respirator. The dust was suspended in sterile, endotoxin-free phosphate-buffered saline (Invitrogen) in a 10 mg/mL stock solution and vortexed at high speed for 5 min to ensure uniform dispersion prior to experimental use. The stock was covered in foil and stored in the cold. ATD was revortexed and diluted immediately prior to each experiment. To assay for potential endotoxin content, we used the Chromogenic Endotoxin Quantification Kit (Thermo Scientific, Waltham, MA), following the manufacturer’s directions. Briefly, ATD pollution samples were diluted to final concentrations of 5–100 μg/mL in endotoxin-free water (Invitrogen) and were assayed in triplicate wells of a pre-warmed 96-well plate. A standard curve was prepared using recommended dilutions of endotoxin provided in the kit. The reactions were terminated using 25% acetic acid and optical density (OD) at 405 nm was measured. The average OD of the blank was subtracted from the average absorbance of each standard and sample replicate and compared to the standard curve to calculate the amount of endotoxin in the ATD.

Human MIO-M1 Cell Culture

The human Muller cell line (MIO-M1) was generously provided by Dr. Astrid Limb (Limb et al., 2002) and maintained as previously described (Nakamura et al., 2007) in low-glucose Dulbecco’s Modified Eagle Medium (Corning, NY, USA) supplemented with 10% fetal bovine serum (GeminiBio, West Sacramento, CA, USA) and 1% penicillin-streptomycin (100 U/mL penicillin, 100 μg/mL streptomycin), in a humified 5% CO2 incubator at 37°C. Cells were passaged using 0.05% trypsin and all assays were performed on cells between passages 39 and 43 to ensure consistency across experiments.

Cell Viability Assay

Muller glia were seeded into 96 well plates at a density of 4 × 104 per well in growth medium and allowed to adhere overnight. The cells were then treated with increasing concentrations of Arizona Test Dust pollution (final concentrations diluted in growth media: 0.1, 1.0, 2.5, 5 and 50 μg/mL), and hydrogen peroxide (0.1 mM) was used as the positive control. This concentration range was selected based on the dose range used in published studies for other pollutants on cultured cells (Karakocak et al., 2019) as well as preliminary dose-response experiments that identified sub-cytotoxic doses in MIO-M1 cells. Untreated cells served as the negative control. Cell viability was assessed after 24 and 48 hours of ATD incubation using the CellTiter-Blue Cell Viability Assay (Promega Corporation, Madison, WI, USA) according to the manufacturer’s instructions. Absorbance was measured at 560 nm excitation and 590 nm emission wavelength using a FLUOstar Omega microplate reader (BMG Labtech, Ortenberg, Germany). Each condition was tested in quadruplicate.

Reactive Oxygen Species (ROS) Assay

Intracellular ROS levels were quantified using a Cellular ROS Assay kit (Abcam, Cambridge, MA, USA). Muller glia were seeded in a 96 well plate at a density of 7 × 104 cells in complete growth medium and incubated at 37°C with 5% CO2 until they reached 60–70% confluency. The cells were preloaded with a fluorescent ROS detection reagent then incubated with ATD pollution at final concentrations of 1.0, 2.5, 5, 10 and 50 μg/mL for 60 minutes. A short incubation period was used to detect acute changes in ROS, as reported by others (Melzi et al., 2023; Mahalny et al., 2022). Hydrogen peroxide (H2O2, 0.1 mM) was used as the positive control while untreated cells served as a negative control. Fluorescence intensity of the ROS detector was measured at 520 nm excitation and 605 nm emission wavelength using a FLUOstar Omega microplate reader (BMG Labtech, Ortenberg, Germany). Each treatment condition was performed in quadruplicate and experiments were repeated at least three independent times.

RNA isolation and Quantitative PCR

Cells were seeded at a density of 1.2 × 105 in 6 well plates and when they reached approximately 50% density they were incubated with ATD for 48 hours. The cells were harvested, pelleted by centrifugation, and total RNA was extracted using Quick RNA MiniPrep Plus (Zymo Research) according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from 300 ng of total RNA using the iScript Reverse Transcription Supermix (Bio-Rad Laboratories, Hercules, CA, USA) following the supplier’s protocol. Quantitative real-time PCR (QPCR) was performed using 2X Universal SYBR Green Fast qPCR Mix (ABclonal, Woburn, MA, USA) on a RealPlex real-time PCR system (Eppendorf AG, Hamburg, Germany). Primers specific to the target genes were designed using NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and were selected to span exon-exon junctions or intron-spanning regions to ensure cDNA specificity and avoid genomic DNA amplification. The following primer sequences were used: HMOX1 (NM_002133), Forward GACCCATGACACACCAAGGACC, Reverse GCCACCAGAAAGCTGAGTGT; NRF2 (NM_001313903) Forward AACACACGGTCCACAGCTC, Reverse GCTCATACTCTTTCCGTCGCT; NQO1 (NM_ _000903.3) Forward TGGAGTCCCTGCCATTCTGA, Reverse ACCAGTGGTGATGGAAAGCA; SOD1 (NM_000454) Forward ACAAAGATGGTGTGGCCGAT, Reverse AACGACTTCCAGCGTTTCC; ARP (NM_001002) Forward ATCTGCTGCATCTGCTTG, Reverse CGACCTGGAAGTCCAACTAC. Each sample was tested in triplicate and amplification specificity was confirmed through melting curve analysis or agarose gel electrophoresis. Relative gene expression levels were calculated using the delta-delta Ct method, with the acidic ribosomal phosphoprotein (ARP) gene used as the internal reference housekeeping control (Garces et al., 2020).

RNA-seq analysis

Bulk RNA-seq analysis was used to examine gene expression changes in Muller glia exposed to ATD for 48 hrs. RNA isolation and sequencing was performed by Novogene Inc. (Sacramento, CA) (untreated control, 1.0 and 2.5 μg/mL, n=3). RNA was isolated and quality and quantity were measured using a Bioanalyzer instrument (Agilent) and all samples had RIN scores > 7.4. RNA-seq libraries were prepared by purifying mRNA using polyT-oligo attached magnetic beads, and random hexamer primers were then used to synthesize first strand cDNA, followed by second strand synthesis, end repair and adapter ligation. The cDNA strands were size-selected, amplified and purified, and quantified libraries were sequenced on Illumina platforms from both ends. FASTQ files were uploaded to the BioProject database and are available under the accession number PRJNA1357888. Quality control was performed on raw data to remove low quality reads followed by aligning and comparison to the reference genome (version hg38) using HISAT2 (2.2.1). Mapped reads were assembled by StringTie (v2.2.3) and featureCounts (2.0.6) was used to count the reads numbers mapped to each gene. One of the control samples did not pass quality control metrics and was removed from further analysis. FPKM for each gene were calculated based on the length of the gene and mapped read counts. Differential expression analysis, sample clustering and principal component analysis were performed using the DESeq2 R package using iDEP2.0 (integrated Differential Expression & Pathway analysis) (Ge et al., 2018). PANTHER (Mi et al., 2019) and ShinyGO (Ge et al., 2020) were used for gene ontology (GO) enrichment analysis, using a pathway size of 3 genes minimum and FDR <0.05. Genes were considered expressed if their FPKM values exceeded 0.1 across all biological replicates within a treatment group. The total number of expressed genes per group was quantified accordingly. Venn diagrams representing shared total gene expression and differential gene expression between treatment groups were made using InteractiVenn (Heberle et al., 2015).

Statistical analysis

Data was analyzed using GraphPad Prism 10 software. Comparisons among treatment and control groups were analyzed using one-way ANOVA followed by Dunnett’s and Holm-Sidak’s post-hoc tests for multiple groups and the results were expressed as mean ± standard deviation. A p-value < 0.05 was considered statistically significant.

Results

Endotoxin levels in ATD

The amount of contaminating endotoxin in ATD or other commercially available pollution preparations has not been reported. Our previous studies demonstrated that endotoxin LPS induced inflammatory pathways in cultured Müller glia (Yi et al., 2012). Therefore, endotoxin levels were quantified in the ATD preparations used in this study. We demonstrated that endotoxin levels were 0.0083 EU/μg (data not shown). Furthermore, the highest ATD concentration used in the study, 50 μg/mL ATD, had approximately 0.4 EU/mL of endotoxin, which is considered negligible levels of contamination. The U.S. FDA recommended limits for endotoxin contamination in medical devices in contact with blood is 0.5 EU/mL, which is higher than the amount of contaminating endotoxin in the ATD concentrations used. Therefore, the ATD used in this study does not have significant endotoxin contamination.

ATD pollution does not alter Muller glia viability

Typical ambient concentrations of pollution in the US may not induce immediate cytotoxicity, and instead cause accumulating subtoxic damage that leads to disruption of normal cellular function over time (Hahad et al., 2020). We used cellular viability assays to evaluate potential toxicity of ATD pollution on the Muller glia cell line. As shown in Figure 1, no statistically significant change in viability was observed at any of the ATD concentrations tested (0.1–50 μg/mL) after 24 and 48 hr incubation, compared to untreated controls (p > 0.05). Therefore, ATD did not cause cytotoxic effects in Muller glia.

Figure 1. Test dust pollution did not change cellular viability.

Figure 1.

Open in a new tab

Cell Viability of human Muller glia following exposure to ATD pollution (P) at concentrations 0.1–50 μg/mL for (A) 24 hours and (B) 48 hours. Mean ± SD are shown from four independent experiments (n = 3). Error bars represent standard deviations and the black dots represent experimental replicates. Statistical analysis using one-way ANOVA and post-hoc tests for multiple groups revealed no statistically significant differences in viability between ATD-treated groups and untreated controls at either the early 24-hour or delayed 48-hour time points, and the response remained consistent across all tested concentrations.

ATD pollution induced elevated oxidative stress in Muller glia

Intracellular ROS levels were measured to evaluate oxidative stress from ATD exposure using a cell permeant fluorogenic probe that emits fluorescence upon oxidation by ROS. Although Muller glia express enzymes that scavenge ROS, exposure to strong oxidative-stress inducing compounds cause increased ROS levels. As shown in Figure 2, H2O2-treated cells used as the positive control resulted in a mild but significant increase in ROS production relative to the control, confirming the assay’s sensitivity. Incubating Muller glia with ATD resulted in increased ROS production (p < 0.05) for concentrations 2.5 μg/mL and higher. The 1.0 μg/mL dose did not lead to increased ROS (Figure 2). These findings indicate that ATD pollution induces sub-lethal oxidative stress levels in Muller glia.

Figure 2.

Figure 2.

Open in a new tab

Reactive oxygen species (ROS) levels in human Muller glia following pollution exposure. Cells were treated with varying concentrations of ATD pollution (P) at concentrations 1.0–50 μg/mL and intracellular ROS generation was measured. Data are presented as mean ± SD from four independent experiments (n = 4). Error bars represent standard deviations and the black dots represent experimental replicates. Statistical analysis using one-way ANOVA and post-hoc tests for multiple groups revealed a significant increase in ROS levels in ATD concentrations 2.5 μg/mL and higher compared with control (p < 0.05). * p<0.05, ** p<0.001.

ATD pollution induced changes in oxidative stress response genes

Next, we analyzed expression of key oxidative stress related genes to further investigate the effect of ATD on oxidative stress responses in Muller glia. To mitigate ROS-mediated damage, cells utilize a complex antioxidant defense network comprising of enzymatic components such as superoxide dismutase (SOD) and heme oxygenase (HO) (Brieger et al., 2012). The expression of these and other antioxidant enzymes is primarily regulated by the transcription factor nuclear factor erythroid 2-related factor 2 (NRF2). QPCR analysis of treated human Muller glia showed altered expression of NRF2, HMOX1, NQO1 and SOD1 genes (Figure 3). Gene expression of NRF2, which is an essential transcription factor involved in cellular antioxidant defense, showed reduced expression in all ATD concentrations. Unexpectedly, we observed a reverse-dose response, with NRF2 levels reduced to 80%, 63% and 57% of control for 1.0, 2.5 and 5.0 μg/mL concentrations respectively (p<0.05). Similarly, expression of SOD1, an antioxidant enzyme that protects cells from oxidative stress, was suppressed to 95%, 92% and 70% of control for 1.0, 2.5 and 5.0 μg/mL respectively (p<0.05). In contrast, expression of NQO1, a detoxification enzyme, was altered only for 1.0 μg/mL ATD and was downregulated by 98% (p < 0.05), while HMOX1, a cytoprotective heme catabolizing enzyme, was upregulated to 222% in cells treated with 2.5 μg/mL ATD pollution.

Figure 3.

Figure 3.

Open in a new tab

The relative expression levels of NRF2, SOD1, HMOX1 and NQO1 were assessed in human Muller glia following exposure to ATD pollution (P) at concentrations 1.0 – 5.0 μg/mL using QPCR. Data are presented as mean ± SD. Error bars represent standard deviations and the black dots represent experimental replicates. Statistical analysis using one-way ANOVA and post-hoc tests for multiple groups revealed significant downregulation of NRF2 and SOD1 across all doses. In contrast, HMOX1 showed upregulation with 2.5 μg/mL and NQO1 showed downregulation with 1.0 μg/mL compared with control. * p<0.05

Bulk RNA-seq analysis was next performed to further characterize gene expression changes in ATD pollution-treated cells and to identify potential cellular pathways that are differentially regulated by an ATD pollution concentration that induced oxidative stress (2.5 μg/mL) compared with an ATD concentration that did not (1.0 μg/mL) (Figure 4, Table 1). Subtoxic concentrations of the ATD pollution were used to increase the likelihood of identifying specific molecular and cellular pathways that are affected by pollution without contribution from pathways stimulated during cell death. Because the phenotype of increased oxidative stress without reducing viability is subtle, we selected all genes with FDR<0.05 at any fold change. As shown in Tables 2–4, RNA-seq analysis of control and oxidative-stress inducing ATD concentration (2.5 μg/mL ATD) demonstrated differential expression of 30 genes with FDR<0.05. The non-oxidative stress inducing ATD concentration (1.0 μg/mL ATD) identified 25 differentially expressed genes (FDR<0.05), and the comparison between ATD pollution concentrations identified only 12 differentially expressed genes (FDR<0.05) (Supplemental data). As shown in Figure 4, although several differentially expressed genes were shared between the higher and lower pollution concentrations, the conditions exhibited distinct gene sets. Notably, mitochondrial genes were selectively downregulated in the oxidative-stress inducing ATD pollution concentration compared to control, whereas changes to mitochondrial genes were absent at the non-oxidative stress inducing concentration. The cell stress response gene GFAP and Wnt inhibitor SFRP4 showed decreased expression in both ATD concentrations compared to control.

Figure 4.

Figure 4.

Open in a new tab

Bulk RNA sequencing was performed on human Muller glia incubated with ATD. (A) Muller glia were treated with either a non-oxidative stress concentration (1.0 μg/mL), an oxidative stress-inducing concentration (2.5 μg/mL), or control media. Cells are depicted in blue, media is pink or orange, and black “O2−” represent the production of reactive oxygen species that occurs with exposure to the higher ATD dose. (B) Genes expressed in each treatment group were defined as those with FPKM greater than 0.1 and visualized using a Venn diagram generated with InteractiVenn. (C) Venn diagram showing the number of distinct and overlapping differentially expressed genes upregulated in the 1.0 μg/mLgroup versus control (FDR<0.05) and in the 2.5 μg/mL group versus control (FDR<0.05). (D) Venn diagram showing the number of distinct and overlapping differentially expressed genes downregulated in the 1.0 μg/mL group versus control (FDR<0.05) and in the 2.5 μg/mLgroup versus control (FDR<0.05).

Table 1.

Gene ontology (GO) analysis of RNA-seq results using Panther and ShinyGO. A summary of the distinct GO categories for each analysis is shown.

Treatment ALL/UP/DOWN GO Category # Genes Present Fold Enrichment FDR
P 2.5 v C ALL Response to interferon-alpha 3 62.39 4.10E-03
UP Cell migration 5 10.1 1.00E-02
DOWN Respiratory electron transport chain 9 90.9 8.13E-13
Response to stress 14 3.7 5.31E-04
P 1.0 v C ALL Regulation of growth 6 7.22 4.59E-02
Regulation of cell migration 10 7.78 1.16E-03
Positive regulation of cell migration 6 7.92 3.18E-02
UP Regulation of BMP signaling pathway 3 54.64 2.27E-02
Cellular response to growth factor stimulus 5 18.52 7.79E-03
DOWN Brain-derived neurotrophic factor binding 2 >200 2.56E-02
Interleukin-1 binding 2 200 2.69E-02
P 2.5 v P1.0 ALL / DOWN Oxidative phosphorylation 10 166.67 2.40E-18
Mitochondrial ATP synthesis coupled e- transport 7 175 1.28E-12
Response to oxidative stress 4 19.65 8.19E-03
UP NONE N/A N/A N/A
Open in a new tab

Table 2.

Differentially expressed genes identified using RNA-seq (FDR<0.05) in the oxidative stress-inducing pollution concentration (2.5 μg/mL). The primary function of each gene is shown.

Gene ID Gene Name logFC Adjusted P value Protein Function
MMP3 Matrix metalloproteinase 3 1.414 3.83E-02 ECM remodeling
PODXL Podocalyxin-like protein 0.921 1.05E-05 Cell adhesion and migration
SERPINE1 Plasminogen activator inhibitor 1 0.500 1.28E-03 ECM remodeling/Cell migration
PRICKLE2 Prickle-like protein 2 0.490 1.03E-02 Wnt signaling
AXL AXL receptor tyrosine kinase 0.422 6.67E-04 Immune regulation
IGFBP3 Insulin-like growth factor-binding protein 3 0.393 1.55E-04 Cell adhesion and migration/Apoptosis regulation
TGFBI Transforming growth factor-beta-induced protein ig-h3 0.301 1.59E-02 Cell adhesion and migration
GPNMB Transmembrane glycoprotein NMB −0.370 6.67E-04 Membrane-bound signaling molecule
PROS1 Vitamin K-dependent protein S −0.417 1.31E-03 Immune regulation
ARRDC4 Arrestin domain-containing protein 4 −0.470 1.39E-02 Immune regulation
IFITM3 Interferon-induced transmembrane protein 3 −0.564 3.28E-03 Defense/immunity protein
CEBPD CCAAT/enhancer-binding protein delta −0.603 3.36E-02 Basic leucine zipper transcription factor
C1Ra Complement C1r-A subcomponent −0.607 1.87E-09 Defense/immunity protein
MT-ND6 NADH-ubiquinone oxidoreductase chain 6 −0.625 1.34E-04 Oxidative phosphorylation
C1S1 Complement C1s-1 subcomponent −0.633 1.33E-05 Defense/immunity protein
MT-CO2 Cytochrome c oxidase subunit 2 −0.636 3.31E-03 Oxidative phosphorylation
MT-ND4 NADH-ubiquinone oxidoreductase chain 4 −0.685 1.34E-04 Oxidative phosphorylation
MT-CO1 Cytochrome c oxidase subunit 1 −0.690 8.30E-06 Oxidative phosphorylation
MT-ND2 NADH-ubiquinone oxidoreductase chain 2 −0.693 2.91E-05 Oxidative phosphorylation
MAOB Amine oxidase [flavin-containing] B −0.700 8.23E-03 Oxidative phosphorylation
MT-ND1 NADH-ubiquinone oxidoreductase chain 1 −0.717 4.04E-05 Oxidative phosphorylation
MT-ATP6 ATP synthase subunit a −0.724 2.09E-09 Oxidative phosphorylation
MT-CO3 Cytochrome c oxidase subunit 3 −0.731 1.33E-05 Oxidative phosphorylation
MT-ND3 NADH-ubiquinone oxidoreductase chain 3 −0.734 3.31E-03 Oxidative phosphorylation
GFAP Glial fibrillary acidic protein −0.735 4.02E-02 Cell stress response
MT-CYB Cytochrome b −0.752 1.05E-05 Oxidative phosphorylation
IFITM2 Interferon-induced transmembrane protein 2 −0.766 3.31E-03 Defense/immunity protein
MT-ATP8 ATP synthase protein 8 −0.849 1.55E-02 Oxidative phosphorylation
ACTG2 Actin, gamma-enteric smooth muscle −1.206 6.31E-04 Cell motility
SFRP4 Secreted frizzled-related sequence protein 4 −1.780 4.66E-04 Wnt signaling
Open in a new tab

Table 4.

Comparison of gene expression between oxidative stress-inducing concentration and non-oxidative stress-inducing concentration using RNA-seq (FDR<0.05). Protein function of each gene is shown.

Gene ID Gene Name logFC Adjusted P value Protein Function
MT-ND4 NADH-ubiquinone oxidoreductase chain 4 −0.507 1.53E-02 Oxidative phosphorylation
MT-ND2 NADH-ubiquinone oxidoreductase chain 2 −0.524 3.59E-03 Oxidative phosphorylation
EBAG9 Epithelial cell adhesion molecule B-associated gene 9 −0.527 2.26E-02 Transmembrane protein
MT-CYB Cytochrome b −0.537 4.27E-03 Oxidative phosphorylation
MT-ND1 NADH-ubiquinone oxidoreductase chain 1 −0.538 4.87E-03 Oxidative phosphorylation
MT-CO1 Cytochrome c oxidase subunit 1 −0.603 1.49E-05 Oxidative phosphorylation
MT-ATP6 ATP synthase subunit a −0.607 1.31E-07 Oxidative phosphorylation
MT-ND6 NADH-ubiquinone oxidoreductase chain 6 −0.669 1.49E-06 Oxidative phosphorylation
MT-CO3 Cytochrome c oxidase subunit 3 −0.674 1.02E-05 Oxidative phosphorylation
MT-ND3 NADH-ubiquinone oxidoreductase chain 3 −0.727 9.45E-04 Oxidative phosphorylation
MT-CO2 Cytochrome c oxidase subunit 2 −0.733 1.49E-05 Oxidative phosphorylation
Open in a new tab

We used gene ontology (GO) software tools to identify potential cellular pathways regulated by ATD pollution exposure (Table 1). The differentially genes in 2.5 μg/mL ATD compared with control showed enrichment of genes involved in respiratory electron transport chain (91-fold enrichment), response to stress (3.7-fold enrichment) and response to interferon-alpha (62-fold enrichment). Several immune effectors were differentially expressed, including pro-inflammatory C1S1, C1Ralpha, IFITM2, IFITM3, which were decreased, and the anti-inflammatory gene AXL, which was increased (Table 2). A large number of genes that are involved in mitochondrial functions, such as MT-ND1, 2, 3 and 4, MT-CO2 and 3, showed reduced expression (Table 2). This finding suggests that exposure to ATD pollution causes mitochondrial dysfunction, fragmentation or impaired mitochondrial biogenesis, although functional mitochondrial assays are needed to confirm the precise effect on mitochondria. Reduced mitochondrial gene expression is consistent with increased oxidative stress observed in Muller glia exposed to 2.5 μg/mL ATD. Additionally, upregulated genes included GO categories related to cell migration (10-fold enrichment), suggesting an injury-induced migration effect in the Muller glia. Therefore, these results suggest that ATD pollution primarily affects energy metabolism and motility in Muller glia.

Comparison of the lower pollution concentration (1.0 μg/mL ATD) with control treated cells showed enrichment of GO categories involved in regulation of growth (7-fold enrichment) and positive regulation of cell migration (8-fold enrichment) (Table 1). Unlike 2.5 μg/mL ATD treated cells, the 1.0 μg/mL ATD treated cells did not show differential expression of genes involved in mitochondrial function and oxidative stress, consistent with lack of ROS induction. Instead, GO categories for various signaling pathways were enriched in the set of increased genes in 1.0 μg/mL ATD, including BMP signaling (55-fold enrichment), and decreased genes were enriched for BDNF and IL-1 binding (>200-fold enrichment). Furthermore, genes involved in cell death were not differentially expressed in either ATD concentration. Therefore, the RNA-seq data is consistent with the oxidative stress and viability results and reveals potential changes in mitochondrial function, cellular signaling and motility.

Discussion

Exposure to air pollution is associated with the progression of retinal diseases but the effects of pollution on detoxification capacities in the retina are unknown. Muller glia play a vital role in maintaining retinal homeostasis by providing metabolic and neurotrophic support and removing excess reactive oxygen species in the retina (Güngör Kobat, 2020; Salman et al., 2021). The goal of this study was to characterize pathologic effects of sub-toxic levels of a pollution particulate matter preparation, ATD, on a human Muller glia cell line. We demonstrated that ATD increased ROS levels and reduced expression of multiple mitochondrial genes but did not affect cellular viability. Furthermore, ATD altered expression of genes involved in migration, adhesion and inflammation. Although we note the limitation of interpreting small-magnitude RNA-seq changes, an important direction for future work will be confirming the effects of ATD on the cellular pathways identified in this study. The results from this study suggest that ATD pollution exposure leads to mitochondrial dysfunction in Muller glia, and suppress their ability to reduce ROS. Because of the importance of Muller glia to the health of the retina, our results identify potential cellular pathways by which pollution could contribute to retinal pathologies.

ATD is obtained from environmental sources by jet milling of sand obtained from Salt River Valley, Arizona, USA and is frequently used as a source of natural mineral dust in environmental studies (Tomasek et al., 2025). The biological mechanisms of the effects of ATD may be attributed to oxidative potential from its mineral components, especially Fe2O3 (Tomasek et al., 2025), PM10- and PM2.5-related cellular damage, crystalline silica, microbial molecules or potentially through synergistic effects of ATD combined with the low levels of endotoxin. Although processing and standardization of ATD means that it does not fully reflect the complexity of real-world road dust exposure, our study demonstrating its effects on glia provides a foundation for understanding the toxicity of ambient air pollutants on Muller glia. It is possible that components present in ambient pollution samples, such as toxic metals and PAHs (Kim and Koh, 2020), are more likely to exacerbate oxidative stress and inflammatory signaling, suggesting that our findings with ATD may underestimate, rather than overstate, the impact of real-world pollution on retinal glia. Our results showing that ATD induced molecular changes to genes from multiple signaling pathways including cellular migration, stress and oxidative stress handling genes, provides important insight into potential molecular effects in Muller glia from environmental samples that would be investigated in future studies. Future work comparing ATD with locally collected road dust would be valuable to further assess real-world relevance.

Mitochondria are the main site of ROS production, and reduced mitochondrial function contributes to lower respiration and ROS accumulation (Wang et al., 2022) (Böhm et al., 2023). It is established that oxidative stress results from a disruption in the equilibrium between ROS production and cellular antioxidant defense mechanisms. Our observation of ATD-induced ROS is consistent with published reports that demonstrated environmental toxins induced oxidative stress and mitochondrial disturbances in various glial cell types, such as astrocytes (D’Mello et al., 2017) (Gómez-Budia et al., 2020). Additionally, reduced expression was noted for genes that regulate cellular ROS levels, NRF2, SOD1 and NQO1. Downregulation of these genes in Muller glia suggests impaired ROS clearance, which would potentially lead to further oxidative damage and amplification of mitochondrial dysfunction (Daiber et al., 2020).

The NRF2 pathway is a master regulator of antioxidant defense genes and is generally increased and activate under oxidative stress conditions where it functions to remove damaging reactive oxygen species (Nakagami, 2016). Our findings of downregulated NRF2 at ATD concentrations greater than 2.5 μg/mL indicates impaired cellular defense responses in pollution exposed glia. Similar observations were reported in studies in which sustained oxidative stress suppressed NRF2 activity and weakened antioxidant responses, including in astrocytes exposed to environmental toxins (Gómez-Budia et al., 2020) and in mouse retinas exposed to toxic levels of light (Cha et al., 2023) (Yu et al., 2023). Although NRF2 usually increases in response to oxidative injury, reduced expression during elevated or prolonged oxidative stress has been described previously. For example, Muller glia cultures treated with H2O2 showed reduced NRF2 expression (Cha et al., 2023), and exposure to high glucose induced oxidative stress by reducing expression of Nrf2 and its regulator Keap1 (Albert-Garay et al., 2022). In lung tissue, reduced NRF2-mediated protection was caused by suppressed NRF2 expression by environmental oxidants, including diesel exhaust particles and cigarette smoke, and is believed to be an important factor in oxidative damage (Cho et al., 2006). Decreased NRF2 signaling is also associated with various diseases of the retina in which oxidative stress is a factor, including AMD and diabetes (Zhang et al., 2023).

Similarly, SOD1 is another key antioxidant enzyme that was downregulated in Muller glia exposed to ATD pollution. Reduced Sod1 expression has been reported in mouse airway tissue exposed to PM2.5 (Wang et al., 2019) and in rat brain exposed to urban pollution (Gómez-Budia et al., 2020). In contrast, HMOX1, another component of cellular antioxidant defense responses, was upregulated in Muller glia treated with 2.5 μg/mL ATD. Thus, HMOX1 induction may represent a protective mechanism, although depending on the duration and extent of exposure, elevated levels of HMOX1 could also contribute to detrimental cellular outcomes (Li et al., 2021). These findings suggest that dysregulated antioxidant expression is predicted to compromise the ability of Muller glia to further buffer oxidative insults. Future studies will characterize the relationship between ATD pollution and mitochondrial function, increased oxidative damage and reduced expression of oxidative stress response genes in Muller glia cultures and in vivo.

Another interesting finding was downregulation of GFAP in ATD-treated Muller glia. GFAP is an intermediate filament involved in neuroinflammatory responses and its expression typically increases in reaction to cellular stress; therefore, it would be expected to be increased due to ATD toxicity and ROS generation. GFAP expression is regulated by a complex network of transcription factors and signaling proteins (Brenner and Messing, 2021). Interestingly, Rosato et al. (2022) demonstrated in a rat Muller glia cell line that GFAP was not elevated after exposure to stress conditions (Rosato et al., 2022). Additionally, consistent with our findings, reduced GFAP expression was also demonstrated in mouse brain after short term exposure to microplastics (Gaspar et al., 2023), and in early stages of pathology in a mouse model of Alzheimer’s disease (Olabarria et al., 2010). Brain region-specific reduction of GFAP was also shown in rats exposed to traffic-related air pollution (Patten et al., 2020). Furthermore, reduced GFAP expression is associated with deficits in glial and neuronal glutamate transporter function, which is predicted to alter glutamate levels (Hughes et al., 2004). However, the role of reduced GFAP is unknown at this time, and may be a further indicator of dysfunctional Muller glial stress responses from exposure to ATD, or could suggest dedifferentiation or Muller glia dysfunction. Further studies are needed to determine the role of reduced GFAP on Muller homeostatic functions, including investigating the time course of GFAP reduction and whether GFAP levels correlate with altered glutamate transport or other essential glial activities.

To our knowledge, the effect of environmental pollution on mitochondrial genes in Muller glia has not previously been reported. However, several studies demonstrated reduced mitochondrial function in another glia type, astrocytes, exposed to toxins. For example, exposure of astrocytes to various environmental toxins reduced mitochondrial activity and energy generation without reducing viability (Steiner et al., 2013) and astrocytes from different brain regions showed different susceptibility to mitochondrial damage that was associated with neuronal damage (Kubik and Philbert, 2015). Similarly, mice exposed to O3 and PM2.5 had mitochondrial damage and reduced electron transport chain activity in brain astrocytes (Yang et al., 2025). Choi et al. demonstrated that the oxidative stress inducer paraquat also reduced expression of oxphos proteins without causing cell death in Muller glia, while inducing loss of mitochondrial membrane potential and inducing oxidative damage (Choi et al., 2024). Our finding of reduced mitochondrial genes in Muller glia suggests that ATD induces mitochondrial dysfunction, which suppresses the ability of the cells to reduce ROS. However, future studies are needed to characterize mitochondrial function and morphology to further understand the reason for reduced mitochondrial gene expression in Muller glia.

A Muller glia cell line was used in this study to allow a reductionist approach to determine cellular responses to pollutants, with a particular focus on detoxification proteins and mechanisms. A limitation is that the ATD was added to culture media and particles may precipitate such that local concentrations of some components could vary across the culture dish. However, our findings provide insight into potential cellular mechanisms that are triggered by microparticles and other pollution components. While ATD did not result in immediate glial death, it altered key oxidative stress-response pathways. Although extrapolation from cell culture to the in vivo situation is imperfect, given the essential role of Muller glia in retinal homeostasis, our findings suggest ATD pollution leads to lower glial energy production, which would impede activities of Muller glia and lead to reduced retinal function. It is important to note that an acute model system was used and chronic exposure to pollutants might elicit different responses. Future studies using animal exposure systems will investigate whether chronic pollution exposure leads to similar effects in Muller glia in vivo, and if such changes lead to functional impairments in retinal health and visual performance.

Conclusion

Air pollution has been shown to induce retinal toxicity, but despite the importance of Muller glia to retinal homeostasis, the effects of pollution on retinal glial responses have not been characterized. The involvement of Muller glia in protecting the retina positions them as key responders to environmental challenges such as exposure to toxins and pollution. This study demonstrates for the first time that exposure to test dust pollution induces oxidative stress responses in human Muller glia without significantly affecting their viability. Increased ROS levels were observed along with downregulation of antioxidant and stress-related genes, reduced mitochondrial gene expression, and changes in cellular pathways involved in glial function and migration. These results suggest that even brief exposure of Muller glia to pollutants may compromise their function. Although we used ATD as a surrogate for environmental pollution, this study suggests that pollution may compromise the ability of Muller glia to reduce oxidative stress, which may worsen existing retinal pathology or cause the retina to be more susceptible to chronic stress or subsequent injuries. Furthermore, this study identifies potential pathways regulated by pollution that may contribute to retinal pathology and provides a foundation for future studies investigating the effects of long-term pollution exposure on the retina in vivo.

Supplementary Material

1

Supplemental Figure 1. ATD composition, as provided by the manufacturer.

2

Supplemental Data: FPKM values for the differentially expressed genes in each sample.

Table 3.

Differentially expressed genes identified using RNA-seq (FDR<0.05) in the non oxidative stress inducing pollution concentration (1.0 μg/mL) compared to control. The primary function of each gene is shown.

Gene ID Gene Name logFC Adjusted P value Protein Function
ASB9 Ankyrin repeat and SOCS box protein 9 1.053 2.50E-02 Ubiquitin-protein ligase
NOG Noggin 0.839 1.79E-02 Cell stress response
MARCHF4 E3 ubiquitin-protein ligase MARCHF4 0.837 2.05E-02 Ubiquitin-protein ligase
POSDX Podocalyxin-like protein 0.802 8.42E-04 Cell adhesion and migration
FST Follistatin 0.689 1.71E-05 Signaling regulator
SERPINE1 Plasminogen activator inhibitor 1 0.478 6.74E-03 ECM remodeling/Cell migration
DUSP10 Dual specificity protein phosphatase 10 0.438 2.05E-02 Cell stress response
CAV1 Caveolin-1 0.430 6.74E-03 Scaffold/adaptor protein
IGFBP3 Insulin-like growth factor-binding protein 3 0.413 1.32E-04 Cell adhesion and migration/Apoptosis regulation
ALCAM Activated leukocyte cell adhesion molecule 0.361 2.64E-02 Immunoglobulin superfamily cell adhesion molecule
AXL Tyrosine-protein kinase receptor UFO 0.352 2.83E-02 Immune regulation
GPM6B Neuronal membrane glycoprotein M6-b −0.461 2.50E-02 Myelin protein
DCN Decorin −0.468 4.09E-03 Immune regulation
WISP1 WNT1 inducible signaling pathway protein 1 −0.503 2.52E-02 Growth factor
C1S1 Complement C1s-1 subcomponent −0.623 5.93E-05 Defense/immunity protein
C1Ra Complement C1r-A subcomponent −0.628 3.39E-10 Defense/immunity protein
PLEKHS1 Pleckstrin homology domain containing S1 −0.673 5.06E-05 Phototransduction regulation
SCRG1 Scrapie-responsive protein 1 −0.779 1.67E-02 Cell stress response
IL1R1 Interleukin-1 receptor type 1 −0.800 2.50E-02 Defense/immunity protein
ICAM1 Intercellular adhesion molecule 1 −0.808 2.83E-02 Defense/immunity protein
MAOB Monoamine oxidase B −0.812 1.50E-03 Neurotransmitter metabolism
A2M Alpha-2-macroglobulin −0.814 2.17E-03 Protease inhibitor
IFI44L Interferon induced protein 44 like −0.835 2.95E-03 Defense/immunity protein
GFAP Glial fibrillary acidic protein −0.866 6.74E-03 Cell stress response
SFRP4 Secreted frizzled-related sequence protein 4 −1.713 2.60E-03 Wnt signaling
Open in a new tab

Key findings:

  1. Effects of Arizona test dust (ATD) were analyzed in a human Muller glia cell line.

  2. ATD induced oxidative stress and reduced mitochondrial genes and defense pathways.

  3. ATD pollution suppresses the ability of Muller glia to respond to oxidative stress.

  4. We identified cellular pathways by which ATD pollution may contribute to retinal disease.

Acknowledgements:

This study was supported in part by the National Institutes of Health/National Eye Institute EY036169 and NIH Core grant P30 EY014801, and the Research to Prevent Blindness Foundation’s Unrestricted Grant GR004596-1.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflict of interest statement: The authors have nothing to declare.

Declaration of interests

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Abigail Hackam reports financial support was provided by National Eye Institute. Abigail Hackam reports financial support was provided by Research to Prevent Blindness. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data deposit:

All RNA-seq gene expression data are deposited in the NCBI Sequence Read Archive under BioProject PRJNA1357888 (SRA run accessions SRR35955003–SRR35955010).

References

  1. Albert-Garay JS, Riesgo-Escovar JR, Salceda R, 2022. High glucose concentrations induce oxidative stress by inhibiting Nrf2 expression in rat Müller retinal cells in vitro. Sci Rep 12, 1261. 10.1038/s41598-022-05284-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Böhm EW, Buonfiglio F, Voigt AM, Bachmann P, Safi T, Pfeiffer N, Gericke A, 2023. Oxidative stress in the eye and its role in the pathophysiology of ocular diseases. Redox Biology 68, 102967. 10.1016/j.redox.2023.102967 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brenner M, Messing A, 2021. Regulation of GFAP Expression. ASN Neuro 13, 1759091420981206. 10.1177/1759091420981206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brieger K, Schiavone S, Miller FJ Jr., Krause K-H, 2012. Reactive oxygen species: from health to disease. Swiss Med Wkly 142, w13659. 10.4414/smw.2012.13659 [DOI] [PubMed] [Google Scholar]
  5. Cha Z, Yin Z, A L, Ge L, Yang J, Huang X, Gao H, Chen X, Feng Z, Mo L, He J, Zhu S, Zhao M, Tao Z, Gu Z, Xu, 2023. Fullerol rescues the light-induced retinal damage by modulating Müller glia cell fate. Redox Biology 67, 102911. 10.1016/j.redox.2023.102911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cho H-Y, Reddy SP, Kleeberger SR, 2006. Nrf2 Defends the Lung from Oxidative Stress. Antioxidants & Redox Signaling 8, 76–87. 10.1089/ars.2006.8.76 [DOI] [PubMed] [Google Scholar]
  7. Choi S, Choi S-H, Bastola T, Kim K-Y, Park S, Weinreb RN, Miller YI, Ju W-K, 2024. AIBP Protects Müller Glial Cells Against Oxidative Stress-Induced Mitochondrial Dysfunction and Reduces Retinal Neuroinflammation. Antioxidants 13, 1252. 10.3390/antiox13101252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cohen AJ, Brauer M, Burnett R, Anderson HR, Frostad J, Estep K, Balakrishnan K, Brunekreef B, Dandona L, Dandona R, Feigin V, Freedman G, Hubbell B, Jobling A, Kan H, Knibbs L, Liu Y, Martin R, Morawska L, Pope CA, Shin H, Straif K, Shaddick G, Thomas M, Van Dingenen R, Van Donkelaar A, Vos T, Murray CJL, Forouzanfar MH, 2017. Estimates and 25-year trends of the global burden of disease attributable to ambient air pollution: an analysis of data from the Global Burden of Diseases Study 2015. The Lancet 389, 1907–1918. 10.1016/S0140-6736(17)30505-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Daiber A, Kuntic M, Hahad O, Delogu LG, Rohrbach S, Di Lisa F, Schulz R, Münzel T, 2020. Effects of air pollution particles (ultrafine and fine particulate matter) on mitochondrial function and oxidative stress – Implications for cardiovascular and neurodegenerative diseases. Archives of Biochemistry and Biophysics 696, 108662. 10.1016/j.abb.2020.108662 [DOI] [PubMed] [Google Scholar]
  10. D’Mello F, Braidy N, Marçal H, Guillemin G, Rossi F, Chinian M, Laurent D, Teo C, Neilan BA, 2017. Cytotoxic Effects of Environmental Toxins on Human Glial Cells. Neurotox Res 31, 245–258. 10.1007/s12640-016-9678-5 [DOI] [PubMed] [Google Scholar]
  11. Garces K, Carmy T, Illiano P, Brambilla R, Hackam AS, 2020. Increased Neuroprotective Microglia and Photoreceptor Survival in the Retina from a Peptide Inhibitor of Myeloid Differentiation Factor 88 (MyD88). J Mol Neurosci 70, 968–980. 10.1007/s12031-020-01503-0 [DOI] [PubMed] [Google Scholar]
  12. Gaspar L, Bartman S, Coppotelli G, Ross JM, 2023. Acute Exposure to Microplastics Induced Changes in Behavior and Inflammation in Young and Old Mice. IJMS 24, 12308. 10.3390/ijms241512308 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ge SX, Jung D, Yao R, 2020. ShinyGO: a graphical gene-set enrichment tool for animals and plants. Bioinformatics 36, 2628–2629. 10.1093/bioinformatics/btz931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ge SX, Son EW, Yao R, 2018. iDEP: an integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinformatics 19, 534. 10.1186/s12859-018-2486-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gómez-Budia M, Konttinen H, Saveleva L, Korhonen P, Jalava PI, Kanninen KM, Malm T, 2020. Glial smog: Interplay between air pollution and astrocyte-microglia interactions. Neurochemistry International 136, 104715. 10.1016/j.neuint.2020.104715 [DOI] [PubMed] [Google Scholar]
  16. Gu Y, Sheng F, Gao M, Zhang L, Hao S, Chen S, Chen R, Xu Y, Wu D, Han Y, Chen L, Liu Y, Lu B, Zhao W, Lou X, Chen Z, Li P, Wang X, Yao K, Fu Q, 2023. Acute and continuous exposure of airborne fine particulate matter (PM2.5): diverse outer blood–retinal barrier damages and disease susceptibilities. Part Fibre Toxicol 20, 50. 10.1186/s12989-023-00558-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Güngör Kobat S, 2020. Importance of Müller Cells. Beyoglu Eye J. 10.14744/bej.2020.28290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hahad O, Lelieveld J, Birklein F, Lieb K, Daiber A, Münzel T, 2020. Ambient Air Pollution Increases the Risk of Cerebrovascular and Neuropsychiatric Disorders through Induction of Inflammation and Oxidative Stress. IJMS 21, 4306. 10.3390/ijms21124306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Heberle H, Meirelles GV, Da Silva FR, Telles GP, Minghim R, 2015. InteractiVenn: a web-based tool for the analysis of sets through Venn diagrams. BMC Bioinformatics 16, 169. 10.1186/s12859-015-0611-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hughes EG, Maguire JL, McMinn MT, Scholz RE, Sutherland ML, 2004. Loss of glial fibrillary acidic protein results in decreased glutamate transport and inhibition of PKA-induced EAAT2 cell surface trafficking. Molecular Brain Research 124, 114–123. 10.1016/j.molbrainres.2004.02.021 [DOI] [PubMed] [Google Scholar]
  21. Ichinose T, Yoshida S, Sadakane K, Takano H, Yanagisawa R, Inoue K, Nishikawa M, Mori I, Kawazato H, Yasuda A, Shibamoto T, 2008. Effects of Asian Sand Dust, Arizona Sand Dust, Amorphous Silica and Aluminum Oxide on Allergic Inflammation in the Murine Lung. Inhalation Toxicology 20, 685–694. 10.1080/08958370801935133 [DOI] [PubMed] [Google Scholar]
  22. Karakocak, Patel S, Ravi N, Biswas P 2019. Investigating the Effects of Stove Emissions on Ocular and Cancer Cells. Sci Rep, 9(1):1870. doi: 10.1038/s41598-019-38803-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kim EA, Koh B Utilization of road dust chemical profiles for source identification and human health impact assessment. Sci Rep 10, 14259 (2020). 10.1038/s41598-020-71180-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kubik LL, Philbert MA, 2015. The Role of Astrocyte Mitochondria in Differential Regional Susceptibility to Environmental Neurotoxicants: Tools for Understanding Neurodegeneration. Toxicological Sciences 144, 7–16. 10.1093/toxsci/kfu254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lee H, Hwang-Bo H, Ji SY, Kim MY, Kim SY, Park C, Hong SH, Kim G-Y, Song KS, Hyun JW, Choi YH, 2020. Diesel particulate matter2.5 promotes epithelial-mesenchymal transition of human retinal pigment epithelial cells via generation of reactive oxygen species. Environmental Pollution 262, 114301. 10.1016/j.envpol.2020.114301 [DOI] [PubMed] [Google Scholar]
  26. Li H, Liu B, Lian L, Zhou J, Xiang S, Zhai Y, Chen Y, Ma X, Wu W, Hou L, 2021. High dose expression of heme oxigenase-1 induces retinal degeneration through ER stress-related DDIT3. Mol Neurodegeneration 16, 16. 10.1186/s13024-021-00437-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li K, Geng Y, Lin B, Xi Z, 2023. Molecular mechanisms underlying mitochondrial damage, endoplasmic reticulum stress, and oxidative stress induced by environmental pollutants. Toxicology Research 12, 1014–1023. 10.1093/toxres/tfad094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Li L, Song M, Zhou J, Sun X, Lei Y, 2022. Ambient particulate matter exposure causes visual dysfunction and retinal neuronal degeneration. Ecotoxicology and Environmental Safety 247, 114231. 10.1016/j.ecoenv.2022.114231 [DOI] [PubMed] [Google Scholar]
  29. Limb GA, Salt TE, Munro PMG, Moss SE, Khaw PT, 2002. In vitro characterization of a spontaneously immortalized human Müller cell line (MIO-M1). Invest Ophthalmol Vis Sci 43, 864–869. [PubMed] [Google Scholar]
  30. Lin C-C, Chiu C-C, Lee P-Y, Chen K-J, He C-X, Hsu S-K, Cheng K-C, 2022. The Adverse Effects of Air Pollution on the Eye: A Review. IJERPH 19, 1186. 10.3390/ijerph19031186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Magnuson JT, Bautista NM, Lucero J, Lund AK, Xu EG, Schlenk D, Burggren WW, Roberts AP, 2020. Exposure to Crude Oil Induces Retinal Apoptosis and Impairs Visual Function in Fish. Environ. Sci. Technol 54, 2843–2850. 10.1021/acs.est.9b07658 [DOI] [PubMed] [Google Scholar]
  32. Mahaling B, Sinha NR, Sokupa S, Addi UR, Mohan RR, Chaurasia SS, 2023. Mustard gas exposure instigates retinal Müller cell gliosis. Experimental Eye Research 230, 109461. 10.1016/j.exer.2023.109461 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Matsuda M, Krempel PG, Marquezini MV, Sholl-Franco A, Lameu A, Monteiro MLR, Miguel NCDO, 2017. Cellular stress response in human Müller cells (MIO-M1) after bevacizumab treatment. Experimental Eye Research 160, 1–10. 10.1016/j.exer.2017.04.005 [DOI] [PubMed] [Google Scholar]
  34. Mi H, Muruganujan A, Ebert D, Huang X, Thomas PD, 2019. PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Research 47, D419–D426. 10.1093/nar/gky1038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Moazami TN, Svendsen KVH, Buhagen M, Jørgensen RB, 2023. Comparing PM2.5, respirable dust, and total dust fractions using real-time and gravimetric samples in an exposure chamber study. Heliyon 9, e16127. 10.1016/j.heliyon.2023.e16127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nakagami Y, 2016. Nrf2 Is an Attractive Therapeutic Target for Retinal Diseases. Oxidative Medicine and Cellular Longevity 2016, 7469326. 10.1155/2016/7469326 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nakamura RE, Hunter DD, Yi H, Brunken WJ, Hackam AS, 2007. Identification of two novel activities of the Wnt signaling regulator Dickkopf 3 and characterization of its expression in the mouse retina. BMC Cell Biol 8, 52. 10.1186/1471-2121-8-52 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Olabarria M, Noristani HN, Verkhratsky A, Rodríguez JJ, 2010. Concomitant astroglial atrophy and astrogliosis in a triple transgenic animal model of Alzheimer’s disease. Glia 58, 831–838. 10.1002/glia.20967 [DOI] [PubMed] [Google Scholar]
  39. Patten KT, González EA, Valenzuela A, Berg E, Wallis C, Garbow JR, Silverman JL, Bein KJ, Wexler AS, Lein PJ, 2020. Effects of early life exposure to traffic-related air pollution on brain development in juvenile Sprague-Dawley rats. Transl Psychiatry 10, 166. 10.1038/s41398-020-0845-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Reddam A, McLarnan S, Kupsco A, 2022. Environmental Chemical Exposures and Mitochondrial Dysfunction: a Review of Recent Literature. Curr Envir Health Rpt 9, 631–649. 10.1007/s40572-022-00371-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Redza-Dutordoir M, Averill-Bates DA, 2016. Activation of apoptosis signalling pathways by reactive oxygen species. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1863, 2977–2992. 10.1016/j.bbamcr.2016.09.012 [DOI] [PubMed] [Google Scholar]
  42. Rosato C, Bettegazzi B, Intagliata P, Balbontin Arenas M, Zacchetti D, Lanati A, Zerbini G, Bandello F, Grohovaz F, Codazzi F, 2022. Redox and Calcium Alterations of a Müller Cell Line Exposed to Diabetic Retinopathy-Like Environment. Front. Cell. Neurosci 16, 862325. 10.3389/fncel.2022.862325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Salman A, McClements M, MacLaren R, 2021. Insights on the Regeneration Potential of Müller Glia in the Mammalian Retina. Cells 10, 1957. 10.3390/cells10081957 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Shimura T, 2023. Mitochondrial Signaling Pathways Associated with DNA Damage Responses. IJMS 24, 6128. 10.3390/ijms24076128 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Steiner SR, Milton E, Philbert MA, 2013. A comparative study of protein carbonylation and mitochondrial dysfunction using the neurotoxicants 1,3-dinitrobenzene, 3-nitropropionic acid, and 3-chloropropanediol. NeuroToxicology 37, 74–84. 10.1016/j.neuro.2013.04.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sun Z, Stuart KV, Luben RN, Auld AL, Strouthidis NG, Khaw PT, Jayaram H, Khawaja AP, Foster PJ, on behalf of the UK Biobank Eye and Vision Consortium, 2024. Association of Ambient Air Pollution Exposure With Incident Glaucoma: 12-Year Evidence From the UK Biobank Cohort. Invest. Ophthalmol. Vis. Sci 65, 22. 10.1167/iovs.65.12.22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tomašek I, Eychenne J, Damby D, Hornby A, Romanias R, Moune S, et al. 2025. Physicochemical Properties and Bioreactivity of Sub-10 μm Geogenic Particles: Comparison of Volcanic Ash and Desert Dust. Geohealth 8;9(1):e2024GH001171. doi: 10.1029/2024GH001171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Vilas-Boas V, Chatterjee N, Carvalho A, Alfaro-Moreno E, 2024. Particulate matter-induced oxidative stress – Mechanistic insights and antioxidant approaches reported in in vitro studies. Environmental Toxicology and Pharmacology 110, 104529. 10.1016/j.etap.2024.104529 [DOI] [PubMed] [Google Scholar]
  49. Wang J, Li M, Geng Z, Khattak S, Ji X, Wu D, Dang Y, 2022. Role of Oxidative Stress in Retinal Disease and the Early Intervention Strategies: A Review. Oxidative Medicine and Cellular Longevity 2022, 7836828. 10.1155/2022/7836828 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wang J, Shanmugam A, Markand S, Zorrilla E, Ganapathy V, Smith SB, 2015. Sigma 1 Receptor regulates the oxidative stress response in primary retinal Müller glial cells via Nrf2 signaling and system xc−, the Na+-independent glutamate-cystine exchanger. Free Radic Biol Med 86, 25–36. 10.1016/j.freeradbiomed.2015.04.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang L, Xu J, Liu H, Li J, Hao H, 2019. PM2.5 inhibits SOD1 expression by up-regulating microRNA-206 and promotes ROS accumulation and disease progression in asthmatic mice. International Immunopharmacology 76, 105871. 10.1016/j.intimp.2019.105871 [DOI] [PubMed] [Google Scholar]
  52. Wang Z, Yu Y, Ye Y, Wang L, Bao Y, Wang X, Zhou X, Zhao J, 2025. Associations Between Ambient Air Pollution and Five Common Vision-Threatening Ocular Diseases in Middle-Aged and Older Adults: A Large Prospective Cohort Study. American Journal of Ophthalmology 274, 276–285. 10.1016/j.ajo.2025.03.009 [DOI] [PubMed] [Google Scholar]
  53. Xu Y, Zhao H, Wang Z, Gao H, Liu J, Li K, Song Z, Yuan C, Lan X, Pan C, Zhang S, 2022. Developmental exposure to environmental levels of cadmium induces neurotoxicity and activates microglia in zebrafish larvae: From the perspectives of neurobehavior and neuroimaging. Chemosphere 291, 132802. 10.1016/j.chemosphere.2021.132802 [DOI] [PubMed] [Google Scholar]
  54. Yang L, Zhao S, Wu Q, Zeng Y, Zhang A, Sun H, Xu F, Shi S, Li J, An Z, Li H, Wu H, Zhuo L, Song J, Chen W, Wu W, 2025. Ozone and PM2.5 co-exposure induced neurodegenerative alterations in mice: Implication of mitochondrial dysfunction in glial cells. Environment International 204, 109802. 10.1016/j.envint.2025.109802 [DOI] [PubMed] [Google Scholar]
  55. Yi H, Patel AK, Sodhi CP, Hackam DJ, Hackam AS, 2012. Novel Role for the Innate Immune Receptor Toll-Like Receptor 4 (TLR4) in the Regulation of the Wnt Signaling Pathway and Photoreceptor Apoptosis. PLoS ONE 7, e36560. 10.1371/journal.pone.0036560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yu D, Cai W, Shen T, Wu Y, Ren C, Li T, Hu C, Zhu M, Yu J, 2023. PM2.5 exposure increases dry eye disease risks through corneal epithelial inflammation and mitochondrial dysfunctions. Cell Biol Toxicol 39, 2615–2630. 10.1007/s10565-023-09791-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zhang J, Zhang T, Zeng S, Zhang X, Zhou F, Gillies MC, Zhu L, 2023. The Role of Nrf2/sMAF Signalling in Retina Ageing and Retinal Diseases. Biomedicines 11, 1512. 10.3390/biomedicines11061512 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zheng J, He L, Shi Q, Wang M, Ma Y, Yu W, Liu L, Yu G, Liu X, Wang B, Zhong J, 2025. In vivo and In vitro assessment of the retinal toxicity of polystyrene nanoplastics. Environment International 198, 109420. 10.1016/j.envint.2025.109420 [DOI] [PubMed] [Google Scholar]
  59. Mahaling B, Pandala N, Wang HC, Lavik EB. 2022. Azithromycin Protects Retinal Glia Against Oxidative Stress-Induced Morphological Changes, Inflammation, and Cell Death. ACS Bio Med Chem Au. 2(5):499–508. doi: 10.1021/acsbiomedchemau.2c00013. eCollection 2022 Oct 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Melzi G, Nozza E, Frezzini MA, Canepari S, Vecchi R, Cremonesi L, Potenza M, Marinovich M, Corsini E. 2023. Toxicological Profile of PM from Different Sources in the Bronchial Epithelial Cell Line BEAS-2B. Toxics. 11(5):413. doi: 10.3390/toxics11050413. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Supplemental Figure 1. ATD composition, as provided by the manufacturer.

NIHMS2158471-supplement-1.pdf (111.4KB, pdf)
2

Supplemental Data: FPKM values for the differentially expressed genes in each sample.

NIHMS2158471-supplement-2.xlsx (25.2KB, xlsx)

Data Availability Statement

All RNA-seq gene expression data are deposited in the NCBI Sequence Read Archive under BioProject PRJNA1357888 (SRA run accessions SRR35955003–SRR35955010).

RESOURCES