Skip to main content
NCBI home page
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2026 Feb 2;40(5):e70172. doi: 10.1002/jcla.70172

Ginsenoside Rb1 Targets the HRD1‐STING Axis to Mitigate Cholesterol‐Induced VSMC Senescence

Haiming Niu 1, Yingzhang Cai 2, Conghui Yu 2, Ning Lin 3, Miaolian Chen 1, Linli Wang 1,4,5,✉
PMCID: PMC13042849  PMID: 41626813

ABSTRACT

Background

Vascular smooth muscle cells (VSMCs) are crucial components of the arterial wall, playing a vital role in maintaining vascular integrity and function. Previous studies have identified HRD1 as a potential target for alleviating senescence in VSMCs. Ginsenoside Rb1 has been shown to counteract endothelial cell senescence triggered by H2O2 or oxidized LDL.

Methods

In this study, Rb1 was investigated to determine if it could protect VSMCs from cholesterol‐induced senescence. VSMCs were pretreated with Rb1 and subsequently exposed to cholesterol to evaluate its effects on SA‐β‐gal activity, reactive oxygen species (ROS) generation, cell viability, and STING pathway activation.

Results

Rb1 treatment significantly reduced the proportion of SA‐β‐gal‐positive cells induced by cholesterol. Moreover, Rb1 suppressed the activation of endoplasmic reticulum (ER) stress markers and inhibited STING signaling. HRD1 knockdown abrogated the Rb1‐mediated reduction of ROS production. Similarly, both Rb1 and an STING inhibitor decreased cholesterol‐induced mitochondrial ROS (MitoSOX) levels.

Conclusion

These findings indicate that Rb1 protects VSMCs against cholesterol‐induced senescence by preserving HRD1 expression, mitigating ER stress, and maintaining mitochondrial function. Therefore, Rb1 holds therapeutic potential for preventing vascular diseases associated with VSMC senescence by modulating the HRD1 and STING pathways.

Keywords: HRD1, Rb1, ROS, STING, VSMC senescence

Schematic representation of the proposed mechanism of action for Ginsenoside Rb1. Suppression of HRD1 expression in VSMCs cholesterol stimulation, leading to ER stress (BiP/XBP1s upregulation), STING pathway activation, ROS accumulation (including mitochondrial ROS), and ultimately, VSMC senescence. Ginsenoside Rb1 reverses these pathological changes, alleviating cholesterol‐induced VSMC aging.

graphic file with name JCLA-40-e70172-g008.jpg

1. Introduction

The global prevalence of chronic diseases, particularly cardiovascular diseases (CVDs), continues to increase with advancing age [1] and dysregulated lipid metabolism [2]. The accumulation of senescent cells is a hallmark of both aging [3] and lipid metabolic dysfunction, driving the pathological progression of several CVDs, including heart failure [4], atherosclerosis [5], and hypertension [6]. Among vascular cell types, vascular smooth muscle cell (VSMC) senescence plays a pivotal role in pathological vascular remodeling and impaired blood pressure regulation [7].

As the primary regulators of arterial contractility [8], VSMCs and the extracellular matrix (ECM) they produce [9] are fundamental to maintain peripheral resistance, controlling blood pressure, regulating blood flow distribution, and supporting arterial repair [10]. Structural changes in VSMCs or the ECM, particularly in large elastic arteries such as the aorta and carotid arteries, can significantly influence arterial compliance [11]. Increased arterial stiffness, reflecting diminished vascular elasticity, compromises the capacity of blood vessels to adaptively regulate blood flow [12]. VSMC senescence, characterized by the senescence‐associated secretory phenotype (SASP), contributes to chronic vascular inflammation [13], arterial dysfunction [14], and the development of age‐related CVDs [15]. Therefore, VSMC senescence represents a central mechanism underlying the onset and progression of vascular disorders [10].

Ginseng, the root of plants belonging to the Panax genus, has long been valued for its extensive health‐promoting properties [16]. Its pharmacological actions are primarily attributed to bioactive constituents such as ginsenosides, polysaccharides, and peptides [17]. Among these, ginsenosides, a class of triterpenoid saponins unique to ginseng, show diverse biological activities [18]. Ginsenoside Rb1 (gRb1; PubChem CID: 9898279) demonstrates potent cardioprotective effects [19]. While its ability to mitigate endothelial cell senescence has been well established [20, 21], its potential influence on VSMC senescence remains largely unexplored.

This study investigated the effects of Rb1 on VSMC senescence and elucidated the underlying molecular mechanisms. Using an HRD1 knockout (HRD1‐KO) cell model, Rb1 was demonstrated to alleviate VSMC senescence by modulating the HRD1/STING pathway. Furthermore, Rb1 attenuated reactive oxygen species (ROS) generation and improved mitochondrial function. These findings provide new mechanistic insights into the protective role of Rb1 and highlight its therapeutic potential against VSMC senescence–associated cardiovascular diseases.

2. Materials and Methods

2.1. Cell Culture and Treatment

The VSMCs were obtained from aortic tissue samples and purchased from Guangzhou BIOSPECIES Company, Guangzhou, China (Lot No. 20220704, 202,000,721, 20,220,805). Cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, USA) supplemented with 10% fetal bovine serum (Batch No. 20240411), 2% antibiotics (1% penicillin and 1% streptomycin; Gibco, USA), and 1% commercially supplied supplementary factors. VSMCs at passages 5–15 were used for all subsequent experiments. Cultures were maintained at 37°C in a humidified incubator with 5% CO₂. The purity of VSMCs was verified by assessing α‐smooth muscle actin (α‐SMA) fluorescence intensity (CST, #19245) (Figure 1C). When cells reached approximately 70% confluence, they were transferred to serum‐free medium before experimental treatments.

FIGURE 1.

FIGURE 1

Open in a new tab

Rb1 Inhibits VSMC senescence promoted by cholesterol stimulation. (A) Representative SA‐β‐Gal staining images of VSMCs treated with Rb1 or cholesterol (scale bar: 100 μm, N = 3 per group). (B) Quantification of SA‐β‐Gal staining from A using an unpaired t‐test. (C) Cell viability of VSMCs treated with Rb1 or cholesterol (50 μg/mL, 72 h) using a CCK‐8 assay. (D–F) Protein expression and statistical analysis of P21 and P53 of VSMCs treated with Rb1 or cholesterol. (G)Immunofluorescence staining for SM‐α‐Actin to confirm VSMC identity; RAW264.7 cells served as a negative control. Nuclei were counterstained with DAPI (blue). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

2.2. Senescence‐Associated‐Galactosidase (SA‐β‐Gal) Staining

The VSMC senescence was evaluated using a Senescence β‐Galactosidase (SA‐β‐Gal) Staining Kit (C0602, Beyotime, China). Cells were fixed with paraformaldehyde for 15 min, rinsed three times with phosphate‐buffered saline (PBS), and incubated overnight with the staining solution at 37°C in the dark. Stained cells were imaged using a Ni‐U fluorescence microscope (Nikon, Japan). The proportion of senescent VSMCs was quantified by calculating the percentage of SA‐β‐Gal–positive (blue‐stained) cells among 200 total cells from five randomly selected high‐power fields.

2.3. Viability Analyses

Afterward, the VSMCs were seeded into 96‐well plates containing growth medium and assigned to four groups: control (H₂O treatment), Rb1 (Victory, Sichuan, China), cholesterol, and Rb1 + cholesterol. For the Rb1 + cholesterol group, cells were pretreated with 10 μM Rb1 for 24 h before cholesterol exposure (cholesterol–methyl‐β‐cyclodextrin complex; Sigma‐Aldrich, C4951; 50 μg/mL for 72 h). Rb1 (G0777, Sigma‐Aldrich; 10 μg/mL, 24 h) was dissolved in dimethyl sulfoxide (DMSO; Sangon, China), with the final DMSO concentration maintained at 0.1% across all experimental groups. Cell viability was determined using a CCK‐8 assay kit (Beyotime, China), and absorbance was measured at 450 nm using a Synergy Neo2 multi‐well plate reader (BioTek, USA).

2.4. CRISPR/Cas9‐Based HRD1 Knockout

HRD1 knockout (HRD1‐KO) was generated using a CRISPR/Cas9‐based lentiviral system. The single guide RNA (sgRNA) sequence targeting HRD1 was 5′‐CACCGATCCATGCGGCATGTCGGGC‐3′. The sgRNA oligonucleotide was inserted into the lentiviral CRISPR v2 vector (Addgene plasmid #52961). Lentiviral packaging plasmids (VSVG and PAX2) were co‐transfected to produce recombinant lentivirus, which was subsequently used to infect VSMCs and establish HRD1‐KO cell lines [22].

2.5. ROS Analyses

Intracellular ROS generation was evaluated after treatment with Rb1 or cholesterol. Following treatment, cells were rinsed with PBS and incubated in DMEM containing either 5 μmol/L dihydroethidium (Beyotime, S0034S, China) or MitoSOX Red dye (MCE, CAS No. 1003197‐00‐9) for 30 min at 37°C in the dark. Fluorescence images were captured using a Nikon Eclipse C1 fluorescence microscope equipped with a Nikon DS‐U3 imaging system. Quantification of intracellular ROS levels was performed using Image J software by measuring green fluorescence intensity (excitation/emission: 480 nm) and red fluorescence intensity (excitation/emission: 510/580 nm).

2.6. Western Blotting

Total protein was extracted from VSMCs using lysis buffer supplemented with protease and phosphatase inhibitors (MCE, USA). Following 30 min of incubation on ice, lysates were centrifuged, and protein concentrations in the supernatants were determined using a BCA Protein Assay Kit (Beyotime, P0009, China). Equal amounts of protein were separated by SDS‐PAGE and subjected to immunoblot analysis. The primary antibodies used included: HRD1 (1:2000; 13473‐1‐AP, Proteintech, Wuhan, China), β‐Actin (1:2000; 20536‐1‐AP, Proteintech, Wuhan, China), P16 (1:2000; ab189034, Abcam, USA), HSP90 (1:2000; 4877S, CST, USA), IRE1α (1:2000; 3294S, CST, USA), BiP (1:2000; ab21685, Abcam, USA), STING (1:2000; 13647S, CST, USA), and XBP‐1s (1:2000; 12782, CST, USA). Protein bands were visualized using a Bio‐Rad chemiluminescence imaging system, and band intensities were quantified with ImageJ software. A molecular weight protein marker (FD0671, Hangzhou FUDE Biological Technology Co. Ltd.) was used to confirm target protein sizes.

2.7. Statistical Analyses

Data analysis was performed using GraphPad Prism 9 (GraphPad Software Inc., USA). Results are expressed as the mean ± standard error of the mean (SEM). Statistical comparisons among multiple groups were conducted using one‐way ANOVA followed by Bonferroni's or Dunn's post hoc test. However, differences between the two groups were analyzed using unpaired Student's t‐tests. A p value of less than 0.05 was considered statistically significant.

3. Results

3.1. Rb1 Inhibits Cholesterol‐Induced VSMC Senescence

In this study, the SA‐β‐Gal staining demonstrated that cholesterol exposure induced pronounced stress‐related senescence in VSMCs. As illustrated in Figure 1A,B, treatment with 50 μg/mL cholesterol for 72 h resulted in a significant increase in SA‐β‐Gal–positive cells, indicating enhanced cellular senescence. In comparison, pretreatment with Rb1 for 1 h before cholesterol exposure significantly decreased the proportion of SA‐β‐Gal–positive cells. Rb1 treatment alone did not cause any detectable cellular damage or morphological abnormalities. Consistent with these findings, the cell viability results obtained from the CCK‐8 assay (Beyotime, China), shown in Figure 1C, confirmed that Rb1 effectively protected VSMCs from cholesterol‐induced cytotoxicity. Furthermore, Western blot analysis revealed that cholesterol exposure increased the expression of senescence‐associated markers p21 and p53, whereas Rb1 treatment notably attenuated this upregulation (Figure 1D–F). The identity of VSMCs was verified by positive immunostaining for smooth muscle alpha‐actin (SM‐α‐actin), as shown in Figure 1G, and also verified by staining SM‐α‐actin and SMMHC, as shown in Figure S1.

3.2. Rb1 Inhibits Cholesterol‐Induced ROS Production

Previous studies have shown that ROS play a central role in promoting VSMC senescence, particularly under conditions of HRD1 deficiency [22]. In line with these observations, cholesterol stimulation in the present study significantly increased intracellular ROS generation [23], as illustrated in Figure 2A,B. Pretreatment with Rb1 for 1 h before cholesterol exposure significantly reduced ROS accumulation, indicating that Rb1 effectively mitigates cholesterol‐induced oxidative stress in VSMCs. These results further elucidate the mechanistic basis of Rb1's protective action against VSMC senescence.

FIGURE 2.

FIGURE 2

Open in a new tab

Rb1 inhibits the ROS production induced by cholesterol stimulation. (A) Representative DCFH‐DA staining images of VSMCs treated with Rb1 or cholesterol, with nuclear counterstaining using Hoechst (blue). (B) Quantification of ROS levels using an unpaired t‐test. Data are means ± SEM (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.3. Rb1 Alleviates Cholesterol‐Driven VSMC Senescence via Increasing HRD1 Levels and Suppressing the STING Pathway

As shown in Figure 3A–I, cholesterol exposure led to a significant downregulation of HRD1, accompanied by the upregulation of several stress‐ and senescence‐related markers, including XBP1s, P16, BiP, and components of the STING signaling pathway (Figure S2A,C,D). These findings are partly consistent with our previous results and further reveal a novel molecular pathway contributing to cholesterol‐induced VSMC senescence. Remarkably, Rb1 treatment effectively suppressed STING pathway activation (Figure S2 B,E,F) and attenuated the expression of ER stress markers XBP1s and BiP, as well as the cell cycle arrest marker P16. These results begin to clarify the molecular mechanism through which Rb1 mitigates cholesterol‐induced VSMC senescence, although further investigations are warranted to delineate the specific interactions among these molecular factors.

FIGURE 3.

FIGURE 3

Open in a new tab

Rb1 Inhibits the activation of the HRD1‐STING signaling pathway induced by cholesterol stimulation. VSMCs were preincubated with 0, 10, 50, or 100 μg/mL cholesterol. (A) Western blotting analysis of XBP1s, HRD1, P16, and BiP expression. (B–E) Densitometric quantification of protein levels (n = 3 per group). (F) Western blotting images of TBK1, STING, and IRF3 in VSMCs treated with cholesterol. (G–I) Quantification of protein levels using an unpaired t‐test. (J) Western blotting analysis of STING, TBK1, IRF3, XBP1s, HRD1, BiP, P16, and β‐Actin in VSMCs treated with Rb1 or cholesterol. (K–Q) The quantification of the results shown in J. Data are presented as means ± SEM, n = 3 per group. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.4. ROS Production Mediates Cholesterol‐Induced VSMC Senescence

Given the established role of ROS in cellular senescence, their contribution to cholesterol‐induced senescence of VSMCs was further investigated. As illustrated in Figure 4A,B, pretreatment with N‐acetylcysteine (NAC), a ROS scavenger, significantly decreased SA‐β‐Gal staining in cholesterol‐treated VSMCs, indicating a reduction in senescence. To further elucidate the molecular mechanisms linking ROS to this process, its effects on STING signaling and P16 expression were assessed. As shown in Figure 4C–G, inhibition of ROS significantly suppressed the cholesterol‐induced upregulation of both STING and P16. These results suggest that ROS functions upstream of the STING pathway in mediating cholesterol‐induced senescence of VSMCs.

FIGURE 4.

FIGURE 4

Open in a new tab

ROS production mediates Cholesterol‐induced senescence of VSMCs (A) SA‐β‐Gal staining was used to analyze senescent VSMCs in 50% confluent VSMCs treated with or without NAC as a ROS inhibitor. (B) Statistical analyses of the results shown in A. (C) Representative Western blotting results for STING, TBK1, and P16 in VSMCs that were 70% confluent and were treated with or without NAC. (D) Representative Western blotting results of p‐IRF3, p‐TBK1 in VSMCs at 70% confluence treated with or without NAC and Chol. (E–G) Statistical analyses of the data shown in C; (H, I) Statistical analyses of the data shown in D. Data are means ± SEM, n = 3/group. Results were compared via unpaired Student's t‐tests. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.5. Rb1 Targets the HRD1/STING Pathway to Inhibit the Cholesterol‐Induced ROS Production in VSMCs

To further investigate the mechanism underlying the effects of Rb1, an HRD1‐knockout (HRD1‐KO) VSMC line was generated using a CRISPR/Cas9‐based approach. Cells transduced with the HRD1‐KO lentivirus were compared with those transfected with an empty vector, which served as controls. As shown in Figure 5A, HRD1 deficiency resulted in STING pathway activation, indicating that HRD1 acts as a regulatory component of this signaling cascade. Notably, the absence of HRD1 abolished the inhibitory effects of Rb1 on ROS production (Figure 5B,C). While Rb1 significantly reduced cholesterol‐induced ROS accumulation in control cells, this effect was not observed in HRD1‐deficient VSMCs. Furthermore, SA‐β‐Gal staining and the expression of senescence markers (p16, p21, and p53; Figure 5D–I) further demonstrated that HRD1 is essential for the protective effects of Rb1 against VSMC senescence. These results suggest that Rb1 mitigates cholesterol‐induced ROS generation through the upregulation of HRD1 expression, and that HRD1 may represent a potential therapeutic target for limiting oxidative stress–mediated vascular aging. However, the current calculation method of ROS quantification will be more perfect if normalizing fluorescence intensity to the number of nuclei per field.

FIGURE 5.

FIGURE 5

Open in a new tab

Rb1 Inhibits cholesterol‐induced ROS production of VSMCs by increasing HRD1 expression (A) At 24 h after transduction with an HRD1‐KO or empty vector control lentivirus (MOI = 100), primary VSMCs were cultured for 48 h in media containing 2 μg/mL puromycin, followed by their transfer into normal media. HRD1 protein expression was assessed across three independent experiments, with β‐Actin as a normalization control. (B) VSMCs transduced with HRD1‐KO or empty vector control lentiviruses were treated for 24 h with or without Rb1, after which cholesterol treatment was performed for 24 h, followed by DCFH‐DA staining and imaging under a Nikon microscope. (C) Statistical analysis of the data shown in B. (D) Representative Western blotting results of P16, P53, and P21 in VSMCs (EV or HRD1‐KO) at 70% confluence treated with or without Rb1 and Chol. (F–H) Statistical analysis of data shown in D. (E) Cholesterol treatment of empty vector or HRD1‐KO cells after treating with Rb1 or not, followed by SA‐β‐gal staining. (F–I) Statistical analysis shown in E. Data were analyzed with unpaired Student's t‐tests. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.6. Rb1 Targets the HRD1/STING Pathway to Suppress Cholesterol‐Induced VSMC Senescence

As shown in Figure 6A,B, depletion of HRD1 significantly aggravated cholesterol‐induced SA‐β‐Gal staining in VSMCs, underscoring the essential role of HRD1 in preserving VSMC homeostasis. To further elucidate the interaction between HRD1 and STING in regulating VSMC senescence, the effects of STING inhibition were examined in HRD1‐deficient cells. As depicted in Figure 6C,D, treatment with the STING inhibitor C‐176 (MCE, CAS No. 314054–00‐7) administered 24 h before other treatments significantly reduced the proportion of SA‐β‐Gal–positive cells, even in the absence of HRD1. These results indicate that HRD1 deficiency promotes VSMC senescence primarily by activating the STING pathway. The findings demonstrate that Rb1 mitigates cholesterol‐induced VSMC senescence by modulating the HRD1/STING signaling axis.

FIGURE 6.

FIGURE 6

Open in a new tab

Rb1 inhibits the cholesterol‐induced senescence of VSMCs via the HRD1/STING pathway. (A) Cholesterol treatment of empty vector or HRD1‐KO cells, followed by SA‐β‐gal staining. (B) Quantification of the SA‐β‐gal staining from A. (C) SA‐β‐gal staining of empty vector or HRD1‐KO cells following STING inhibitor treatment for 24 h. (D) Quantification of the SA‐β‐gal staining from C. Data are presented as means ± SEM (n = 3), and results were compared with unpaired Student's t‐tests.*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

3.7. STING Mediates Cholesterol‐Induced VSMC Senescence via Eliciting mtROS Production

Previous studies have demonstrated a strong association between the STING signaling pathway and mitochondrial function [24]. However, the influence of Rb1 on mitochondrial activity has not been fully elucidated. In the present study, cholesterol exposure significantly increased mitochondrial reactive oxygen species (mtROS) production (Figure 7A,B), indicating mitochondrial dysfunction. Pretreatment with Rb1 for 1 h significantly suppressed mtROS generation, further supporting the notion that Rb1 modulates the STING signaling pathway. Moreover, inhibition of mtROS using MitoTempo (MCE, CAS No. 1334850‐99‐5), administered 24 h before other treatments, significantly reduced cholesterol‐induced SA‐β‐Gal staining (Figure 7C,D). Blockade of STING signaling also diminished mtROS production (Figure 7E,F), suggesting that activation of the STING pathway contributes to mitochondrial dysfunction. These findings clarify the role of Rb1 in attenuating VSMC senescence and provide a mechanistic basis for its potential therapeutic application in cardiovascular diseases.

FIGURE 7.

FIGURE 7

Open in a new tab

STING mediats the cholesterol‐induced senescence of VSMCs through inhibiting mtROS production. (A) When reaching 60% confluence, VSMCs were treated with or without Rb1 and cholesterol, followed by staining with MitoSOX Red. (B) Statistical analyses of the results shown in A. (C) Control or MitoTempo‐pretreated cells were treated with cholesterol and subjected to SA‐β‐gal staining. (D) Statistical analyses of the staining results from C. (E) Control or STING inhibitor‐pretreated cells were performed using cholesterol and subjected to MitoSOX staining according to the manufacturer's instructions. (F) Statistical analyses of the data shown in E. Data are means ± SEM (n = 3), and results were compared with unpaired Student's t‐tests.*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

4. Discussion

In this study, Rb1 treatment significantly reduced SA‐β‐Gal staining, ROS generation, and cholesterol‐induced upregulation of P16 and STING (Figures 1, 2, 3). The protective effects of Rb1 were abolished following HRD1 knockout, whereas inhibition of STING signaling effectively decreased the number of SA‐β‐Gal–positive cells. This study, for the first time, demonstrates the anti‐senescent effects of Rb1 on VSMCs, offering valuable insights for clinicians and pharmacologists. These findings elucidate a critical role of the HRD1/STING axis in mediating the protective actions of Rb1 against cholesterol‐induced VSMC senescence, expanding potential therapeutic targets for aging‐related vascular diseases.

Previous studies have shown that cytosolic DNA released from damaged mitochondria can activate cyclic GMP‐AMP synthase (cGAS), triggering the cGAS–STING signaling cascade, which plays a crucial role in aging‐associated inflammation in both peripheral tissues and the brain [25]. Elevated cGAS–STING activity has been observed in Alzheimer's disease (AD) mouse models [26], and deletion of STING in diabetic mice was reported to attenuate retinal endothelial cell senescence, inflammation, and capillary degeneration [27]. These findings highlight the involvement of STING in mitochondrial dysfunction and cellular senescence, primarily through inflammatory and autophagic mechanisms supported by in vivo evidence. In the present study, activation of the STING pathway was confirmed in cholesterol‐treated VSMCs (Figure 3F–I), and it was significantly suppressed following Rb1 treatment (Figure 3J–Q). Furthermore, pharmacological inhibition of STING in HRD1‐deficient cells significantly reduced both SA‐β‐galactosidase (SA‐β‐Gal) staining (Figure 6) and mtROS generation (Figure 7). Unlike previous studies that focused mainly on inflammation, the current work underscores the role of ROS in STING‐mediated VSMC senescence. Our findings demonstrate that ROS acts as a critical upstream regulator of STING signaling, suggesting that antioxidant‐based interventions may represent an effective strategy to mitigate vascular aging and related pathologies.

Our previous work demonstrated that HRD1 deficiency compromises mitochondrial integrity, as reflected by elevated mtROS production [22]. However, the precise signaling mechanisms linking HRD1 to mitochondrial dysfunction have remained poorly understood. The present findings highlight a pivotal role of STING in bridging HRD1 loss and mitochondrial impairment during vascular senescence, addressing a key gap in our previous research. These results further suggest that targeting the HRD1/STING axis may serve as a promising strategy to counteract cholesterol‐induced VSMC aging. Moreover, this study broadens the understanding of STING's involvement across a broader spectrum of pathological conditions. HRD1 appears to regulate STING activity through two principal pathways. First, as an E3 ubiquitin ligase, HRD1 directly interacts with STING and mediates its K48‐linked polyubiquitination, facilitating proteasomal degradation [28]. Second, reduced HRD1 expression diminishes STING ubiquitination, stabilizing the protein and promoting its accumulation in the cytoplasm, particularly within the endoplasmic reticulum [29]. In this study, cholesterol exposure was found to downregulate HRD1 expression in VSMCs, leading to impaired STING ubiquitination and subsequent upregulation of STING (Figure 5A).

As a core component of the endoplasmic reticulum–associated degradation (ERAD) system, HRD1 plays an essential role in cardiovascular physiology [30]. Previous studies have demonstrated that HRD1 protects against cardiac hypertrophy [31] and ox‐LDL‐induced endothelial apoptosis [32]. However, our previous work established its importance in maintaining VSMC homeostasis [22, 32]. Beyond cardiovascular regulation, emerging evidence has identified a novel SEL1L/HRD1/SigmaR1 regulatory axis implicated in cadmium chloride (CdCl2) exposure–associated Alzheimer's disease [33]. STING, an endoplasmic reticulum–resident adaptor protein, is a central mediator of cytoplasmic DNA sensing that triggers type I interferon production [34]. Moreover, STING has been shown to negatively regulate B cell receptor signaling, modulating immune homeostasis [35]. Under basal conditions, the SEL1L–HRD1 complex mediates STING ubiquitination through HRD1's E3 ligase activity, promoting its proteasomal degradation and preventing aberrant activation within the ER.

Loss of SEL1L or HRD1 stabilizes STING, leading to its accumulation and increased downstream signaling, including TBK1/IRF3 phosphorylation and type I interferon induction [36]. This mechanism highlights the role of ERAD as a critical checkpoint that regulates STING activation, suggesting therapeutic opportunities for fine‐tuning STING‐driven immune responses [37]. Previous studies reported that upon cGAMP binding, STING directly activates endoplasmic reticulum kinase PERK before TBK1‐IRF3 signaling, triggering eIF2α phosphorylation to reshape translation toward inflammation and survival programs, which operates through physical interaction between STING and PERK's intracellular domains, bypassing classical stress responses. The STING‐PERK‐eIF2α axis may drive processes like cellular senescence and organ fibrosis while offering insights into disease mechanisms [38]. In this way, activation of the STING pathway led to VSMC senescence. These findings highlight the pivotal role of HRD1 in regulating cellular senescence, consistent with the present study's results, which suggest that HRD1 targeting may offer a promising strategy for alleviating VSMC aging.

Although numerous therapeutic agents are available for cardiovascular diseases [39], few specifically target vascular senescence or effectively restore vascular function. Ginsenosides have attracted growing interest due to their multitarget pharmacological actions, engagement in diverse signaling pathways, and well‐established safety profiles [40, 41]. In this study, Rb1 treatment significantly reduced SA‐β‐gal–positive staining, intracellular ROS, and mitochondrial ROS levels, while simultaneously increasing HRD1 expression and suppressing STING signaling, preventing mitochondrial dysfunction–induced DNA damage (as shown in Figure 8).

FIGURE 8.

FIGURE 8

Open in a new tab

Schematic representation of the proposed mechanism of action for Ginsenoside Rb1. Suppression of HRD1 expression in VSMCs cholesterol stimulation, leading to ER stress (BiP/XBP1s upregulation), STING pathway activation, ROS accumulation (including mitochondrial ROS), and ultimately, VSMC senescence. Ginsenoside Rb1 reverses these pathological changes, alleviating cholesterol‐induced VSMC aging.

5. Conclusion

In summary, our findings demonstrate that the HRD1/STING axis mediates the anti‐senescent effects of ginsenoside Rb1, underscoring its potential as a complementary therapeutic strategy to conventional single‐target treatments for age‐related vascular disorders. However, certain limitations should be acknowledged, such as further in vivo investigations are required to substantiate the vascular protective effects of Rb1, and studies involving HRD1 overexpression in Rb1's effects remain to be explored, as well as its regulatory influence on STING signaling. These experiments would further clarify HRD1 as a target in Rb1's effects on vascular aging.

Author Contributions

Haiming Niu and Yingzhang Cai contributed to the design and implementation of the research. Conghui Yu, Ning Lin, and Miaolian Chen analyzed the results and wrote the manuscript. Linli Wang conceived and supervised the project.

Funding

This work was supported by the High‐level Chinese Medicine Construction Project (No. SG2024013), the Zhongshan Medical Research Project (No. 2022J140), and the Zhongshan Traditional Chinese Medicine Inheritance Innovation Development Research Project (2024B3054).

Disclosure

Peer and provenance statement: All the authors agreed to the journal’s decision.

Consent

All authors agreed to submit the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1: Supporting Information.

JCLA-40-e70172-s001.docx (278.7KB, docx)

Acknowledgments

The authors thank all lab members for their help with the in vitro experiments.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

References

  • 1. Childs B. G., Durik M., Baker D. J., and van Deursen J. M., “Cellular Senescence in Aging and Age‐Related Disease: From Mechanisms to Therapy,” Nature Medicine 21, no. 12 (2015): 1424–1435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Zeng Q., Gong Y., Zhu N., Shi Y., Zhang C., and Qin L., “Lipids and Lipid Metabolism in Cellular Senescence: Emerging Targets for Age‐Related Diseases,” Ageing Research Reviews 97 (2024): 102294. [DOI] [PubMed] [Google Scholar]
  • 3. van Deursen J. M., “The Role of Senescent Cells in Ageing,” Nature 509, no. 7501 (2014): 439–446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Sano M., Minamino T., Toko H., et al., “p53‐Induced Inhibition of Hif‐1 Causes Cardiac Dysfunction During Pressure Overload,” Nature 446, no. 7134 (2007): 444–448. [DOI] [PubMed] [Google Scholar]
  • 5. Childs B. G., Baker D. J., Wijshake T., Conover C. A., Campisi J., and van Deursen J. M., “Senescent Intimal Foam Cells Are Deleterious at All Stages of Atherosclerosis,” Science 354, no. 6311 (2016): 472–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Chi C., Li D. J., Jiang Y. J., et al., “Vascular Smooth Muscle Cell Senescence and Age‐Related Diseases: State of the Art,” Biochimica et Biophysica Acta, Molecular Basis of Disease 1865, no. 7 (2019): 1810–1821. [DOI] [PubMed] [Google Scholar]
  • 7. Westhoff J. H., Hilgers K. F., Steinbach M. P., et al., “Hypertension Induces Somatic Cellular Senescence in Rats and Humans by Induction of Cell Cycle Inhibitor p16INK4a,” Hypertension 52, no. 1 (2008): 123–129. [DOI] [PubMed] [Google Scholar]
  • 8. Lacolley P., Regnault V., Segers P., and Laurent S., “Vascular Smooth Muscle Cells and Arterial Stiffening: Relevance in Development, Aging, and Disease,” Physiological Reviews 97, no. 4 (2017): 1555–1617. [DOI] [PubMed] [Google Scholar]
  • 9. Ribeiro‐Silva J. C., Nolasco P., Krieger J. E., and Miyakawa A. A., “Dynamic Crosstalk Between Vascular Smooth Muscle Cells and the Aged Extracellular Matrix,” International Journal of Molecular Sciences 22, no. 18 (2021): 10175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Lacolley P., Regnault V., Nicoletti A., Li Z., and Michel J. B., “The Vascular Smooth Muscle Cell in Arterial Pathology: A Cell That Can Take on Multiple Roles,” Cardiovascular Research 95, no. 2 (2012): 194–204. [DOI] [PubMed] [Google Scholar]
  • 11. Shao Y., Li G., Huang S., et al., “Effects of Extracellular Matrix Softening on Vascular Smooth Muscle Cell Dysfunction,” Cardiovascular Toxicology 20, no. 6 (2020): 548–556. [DOI] [PubMed] [Google Scholar]
  • 12. Mistriotis P. and Andreadis S. T., “Vascular Aging: Molecular Mechanisms and Potential Treatments for Vascular Rejuvenation,” Ageing Research Reviews 37 (2017): 94–116. [DOI] [PubMed] [Google Scholar]
  • 13. Fang C., Du L., Gao S., et al., “Association Between Premature Vascular Smooth Muscle Cells Senescence and Vascular Inflammation in Takayasu's Arteritis,” Annals of the Rheumatic Diseases 83, no. 11 (2024): 1522–1535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lin M. J., Hu S. L., Tian Y., et al., “Targeting Vascular Smooth Muscle Cell Senescence: A Novel Strategy for Vascular Diseases,” Journal of Cardiovascular Translational Research 16, no. 5 (2023): 1010–1020. [DOI] [PubMed] [Google Scholar]
  • 15. Gan L., Liu D., Liu J., et al., “CD38 Deficiency Alleviates Ang II‐Induced Vascular Remodeling by Inhibiting Small Extracellular Vesicle‐Mediated Vascular Smooth Muscle Cell Senescence in Mice,” Signal Transduction and Targeted Therapy 6, no. 1 (2021): 223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kaneko H. and Nakanishi K., “Proof of the Mysterious Efficacy of Ginseng: Basic and Clinical Trials: Clinical Effects of Medical Ginseng, Korean Red Ginseng: Specifically, Its Anti‐Stress Action for Prevention of Disease,” Journal of Pharmacological Sciences 95, no. 2 (2004): 158–162. [DOI] [PubMed] [Google Scholar]
  • 17. Park S. Y., Park J. H., Kim H. S., et al., “Systems‐Level Mechanisms of Action of Panax ginseng : A Network Pharmacological Approach,” Journal of Ginseng Research 42, no. 1 (2018): 98–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Leung K. W. and Wong A. S., “Pharmacology of Ginsenosides: A Literature Review,” Chinese Medicine 5 (2010): 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Wang X., Li L., Niu X., et al., “mTOR Enhances Foam Cell Formation by Suppressing the Autophagy Pathway,” DNA and Cell Biology 33, no. 4 (2014): 198–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Shi G., Liu D., Zhou B., et al., “Ginsenoside Rb1 Alleviates Oxidative Low‐Density Lipoprotein‐Induced Vascular Endothelium Senescence via the SIRT1/Beclin‐1/Autophagy Axis,” Journal of Cardiovascular Pharmacology 75, no. 2 (2020): 155–167. [DOI] [PubMed] [Google Scholar]
  • 21. Ke S., Wu L., Wang M., et al., “Ginsenoside Rb1 Attenuates Age‐Associated Vascular Impairment by Modulating the Gas6 Pathway,” Pharmaceutical Biology 59, no. 1 (2021): 1369–1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Wang L., Wang M., Niu H., et al., “Cholesterol‐Induced HRD1 Reduction Accelerates Vascular Smooth Muscle Cell Senescence via Stimulation of Endoplasmic Reticulum Stress‐Induced Reactive Oxygen Species,” Journal of Molecular and Cellular Cardiology 187 (2024): 51–64. [DOI] [PubMed] [Google Scholar]
  • 23. Rogers H. and Munné‐Bosch S., “Production and Scavenging of Reactive Oxygen Species and Redox Signaling During Leaf and Flower Senescence: Similar but Different,” Plant Physiology 171, no. 3 (2016): 1560–1568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Chung K. W., Dhillon P., Huang S., et al., “Mitochondrial Damage and Activation of the STING Pathway Lead to Renal Inflammation and Fibrosis,” Cell Metabolism 30, no. 4 (2019): 784–799.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Gulen M. F., Samson N., Keller A., et al., “cGAS‐STING Drives Ageing‐Related Inflammation and Neurodegeneration,” Nature 620, no. 7973 (2023): 374–380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Hou Y., Wei Y., Lautrup S., et al., “NAD(+) Supplementation Reduces Neuroinflammation and Cell Senescence in a Transgenic Mouse Model of Alzheimer's Disease via cGAS‐STING,” Proceedings of the National Academy of Sciences of the United States of America 118, no. 37 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Liu H., Ghosh S., Vaidya T., et al., “Activated cGAS/STING Signaling Elicits Endothelial Cell Senescence in Early Diabetic Retinopathy,” JCI Insight 8, no. 12 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Tang C. A., Lee A. C., Chang S., et al., “STING Regulates BCR Signaling in Normal and Malignant B Cells,” Cellular & Molecular Immunology 18, no. 4 (2021): 1016–1031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhu R., Zhang L., Zhang H., and Hu Z., “BRD4 Promotes LPS‐Induced Endothelial Cells Senescence via Activating and Cooperating STING‐IRF3 Pathway,” Cellular Signalling 118 (2024): 111127. [DOI] [PubMed] [Google Scholar]
  • 30. Krshnan L., van de Weijer M. L., and Carvalho P., “Endoplasmic Reticulum–Associated Protein Degradation,” Cold Spring Harbor Perspectives in Biology (2022): a041247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Doroudgar S., Völkers M., Thuerauf D. J., et al., “Hrd1 and ER‐Associated Protein Degradation, ERAD, Are Critical Elements of the Adaptive ER Stress Response in Cardiac Myocytes,” Circulation Research 117, no. 6 (2015): 536–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Li Q., Xuan W., Jia Z., et al., “HRD1 Prevents Atherosclerosis‐Mediated Endothelial Cell Apoptosis by Promoting LOX‐1 Degradation,” Cell Cycle (Georgetown, Texas) 19, no. 12 (2020): 1466–1477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Qian B., Li T. Y., Zheng Z. X., et al., “The Involvement of SigmaR1(K142) Degradation Mediated by ERAD in Neural Senescence Linked With CdCl(2) Exposure,” Journal of Hazardous Materials 472 (2024): 134466. [DOI] [PubMed] [Google Scholar]
  • 34. Zhang B. C., Laursen M. F., Hu L., et al., “Cholesterol‐Binding Motifs in STING That Control Endoplasmic Reticulum Retention Mediate Anti‐Tumoral Activity of Cholesterol‐Lowering Compounds,” Nature Communications 15, no. 1 (2024): 2760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Liu D., Wu H., Wang C., et al., “STING Directly Activates Autophagy to Tune the Innate Immune Response,” Cell Death and Differentiation 26, no. 9 (2019): 1735–1749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Ji Y., Luo Y., Wu Y., et al., “SEL1L‐HRD1 Endoplasmic Reticulum‐Associated Degradation Controls STING‐Mediated Innate Immunity by Limiting the Size of the Activable STING Pool,” Nature Cell Biology 25, no. 5 (2023): 726–739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Zhang X., Bai X. C., and Chen Z. J., “Structures and Mechanisms in the cGAS‐STING Innate Immunity Pathway,” Immunity 53, no. 1 (2020): 43–53. [DOI] [PubMed] [Google Scholar]
  • 38. Zhang D., Liu Y., Zhu Y., et al., “A Non‐Canonical cGAS‐STING‐PERK Pathway Facilitates the Translational Program Critical for Senescence and Organ Fibrosis,” Nature Cell Biology 24, no. 5 (2022): 766–782. [DOI] [PubMed] [Google Scholar]
  • 39. Singh H. and Agrawal D. K., “Recent Advances in the Development of Active Hybrid Molecules in the Treatment of Cardiovascular Diseases,” Bioorganic & Medicinal Chemistry 62 (2022): 116706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Zhu G. X., Zuo J. L., Xu L., and Li S. Q., “Ginsenosides in Vascular Remodeling: Cellular and Molecular Mechanisms of Their Therapeutic Action,” Pharmacological Research 169 (2021): 105647. [DOI] [PubMed] [Google Scholar]
  • 41. Lee H. J., Kim B. M., Lee S. H., et al., “Ginseng‐Induced Changes to Blood Vessel Dilation and the Metabolome of Rats,” Nutrients 12, no. 8 (2020): 2238. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1: Supporting Information.

JCLA-40-e70172-s001.docx (278.7KB, docx)

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES