Total saponins of Gynostemma pentaphyllum mitigate chronic heat stress-induced thymus and spleen inflammation in broilers via NF-κB pathway activation

Abstract

Heat stress (HS) can induce inflammatory conditions in the immune organs of poultry, thereby affecting their immune functions. Gynostemma pentaphyllum total saponins (GP) are a natural plant active component with significant possess anti-inflammatory properties and exhibit immunomodulatory impacts. Thus, this study investigates GP’s effects on growth performance, thymus/spleen indices, serum biochemical markers, antioxidant enzyme activities in these organs, and transcriptional/protein expression of NF-kB pathway-related genes in cyclically HS broilers. A total of 200 broilers at 28 days of age were chosen for this experiment and randomly partitioned into five cohorts. The CON cohort was provided with a basal feed and reared in an environment with a normal temperature(24 ± 1 °C), while the HS, HSLGP, HSMGP and HSHGP cohorts were raised in a high-temperature environment (33 ± 1 °C, 8 h/d) with the basal diet fortified with 0, 200, 300 and 450 mg/kg GP, respectively. The results showed that compared with the CON cohort, the ADG and ADFI of broilers in the HS cohort were significantly reduced to 35 and 42 days (P < 0.05). GP exerts a positive influence on the growth traits of HS broilers by elevating ADG and ADFI, while concurrently reducing the F: G. GP improved the live weight, thymus, spleen index and tissue structure of HS broilers, and decreased the amounts of serum TC, LDL and LDH, while increasing the levels of TP, HDL, Ca and Mg (P < 0.05). Concurrently, GP supplementation enhanced the antioxidant enzyme activities in the thymus and spleen, increasing T-AOC, GSH-PX and T-SOD levels and significantly reducing MDA levels (P < 0.05). Additionally, compared with HS broilers, GP downregulated P65 protein levels, elevated the expression intensities of NF-kB genes and proteins, and triggered the expression activation of downstream inflammatory genes including HO-1, IKBα and Nrf2. In summary, GP modulates NF-kB pathway-associated gene/protein expression by suppressing inflammation, mitigates immune organ damage in broilers, and thereby enhances growth efficiency under HS.

Introduction

With the increasing intensification of poultry breeding, heat stress (HS) has emerged as a significant environmental element influencing the well - being and productive performance of poultry. Poultry, lacking sweat glands and covered with feathers, has limited heat dissipation capacity and is particularly sensitive to environments characterized by elevated temperatures. When the surrounding temperature surpasses its thermal comfort zone, the body responds to HS by activating a series of physiological and biochemical reactions, among which the inflammatory response is the core pathological link. Research demonstrates that HS disrupts the oxidative-antioxidant balance, leading to excessive reactive oxygen species (ROS) accumulation. This activates inflammatory signaling pathways such as NF-κB, promoting the release of pro-inflammatory cytokines (e.g., IL-6, TNF-α). Several Chinese herbal medicines and their extracts have been shown to alleviate HS-induced damage in poultry by modulating antioxidant capacity, immune function, and digestive performance, thereby improving production outcomes (Sarker et al., 2025). In addition, inflammatory responses and oxidative stress form a vicious cycle, collectively resulting in a reduction in the growth performance of poultry, a worsening of muscle quality, and a decline in production efficiency (Wang, M. et al., 2023).

GP is a saponin extract from GP has be n proven to have many potential health benefits (Lee, S. A. et al., 2025). The study by indicates that GP may have antihypertensive effects, as well as anti-aging, anti-hyperlipidemia, anti-hyperglycemic and anti-inflammatory effects (Pei, A. et al., 2025; Xie, J. et al., 2024). For instance, GP attenuates isoproterenol-induced cardiac remodeling in rats by modulating inflammation and gut microbiota (Jiang, F. Y. et al., 2024). Its anti-hyperlipidemic and anti-hyperglycemic properties may also indirectly enhance stress resilience by improving metabolic homeostasis (Xu, B. et al., 2024). However, the specific mechanisms by which GP influences HS-induced immune organ inflammation and NF-κB signaling in poultry remain underexplored. Against this backdrop, the development of natural and safe anti-HS additives has become a research hotspot. Total gypenosides have been confirmed in recent studies to have multi-target regulatory effects: on the one hand, by inhibiting inflammatory signaling pathways such as NF-kB, down-regulating the expression of pro-inflammatory factors, and alleviating immune organ damage; on the other hand, by activating the Nrf2 antioxidant pathway, Boosting the activity of enzymes like SOD and GSH – PX, and blocking the oxidative-inflammatory cascade reaction (Cao, L. H. et al., 2022; Ping, K. et al., 2024). In addition, its properties of resisting hyperlipidemia and hyperglycemia may indirectly enhance the body's anti-stress ability by improving metabolic homeostasis (Xu, B. et al., 2024).

The immune system of poultry is composed of innate immunity and adaptive immunity. Among them, the thymus and spleen, as core immune organs, respectively, exert a dominant influence on the progression of T cells and the operation of antigen processing (Yang, W. et al., 2023). HS induces damage to the thymus and spleen via a two - fold mechanism (Mao, Y. et al., 2024).At the thymus level, high-temperature environments can inhibit the differentiation of lymphoid stem cells into T cells, resulting in a reduction in the thickness of the thymic cortex and disordered medullary structure, and subsequently lowering the CD4+/CD8+ T cell ratio (Hirakawa, R. et al., 2020). At the spleen level, HS can damage the white pulp structure of the spleen, suppress the expansion of B - cell populations and the release of antibodies in experimental settings, and simultaneously reduce the phagocytic activity of macrophages. A multitude of research studies have conclusively demonstrated that when exposed to HS conditions, the thymus index of broilers decreases by 30% to 50%, and the spleen index drops by 20% to 40%, accompanied by a significant reduction in antibody titers such as IgA, IgG, and IgM .This immunosuppressive effect will further intensify the susceptibility of poultry to pathogens, forming a vicious cycle of "HS - immunosuppression - disease susceptibility" (Oladokun, S.andAdewole, D. I., 2022).

In response to this challenge, natural immune modulators have become a research hotspot. For instance, total saponins of GP can alleviate the apoptotic induction of thymocytes caused by Hs by inhibiting the NF-kB inflammatory signaling cascade. At the same time, it activates the Nrf2 antioxidant pathway and protects the structural integrity of the lymphoid follicles in the spleen (Chen, H. et al., 2024). However, systematic studies investigating the effects of GP on HS-induced immune organ damage and NF-κB signaling pathway regulation in broilers remain scarce. Based on this gap, this study employed HS-challenged broilers as a model to systematically evaluate GP's regulatory effects on immune organ inflammation and NF-κB signaling, determine its effective dosage range, and elucidate its protective mechanisms. The findings support sustainable development in poultry farming and provide a theoretical foundation for mitigating HS-induced intestinal damage in broilers through gut microbiota modulation.

Materials and methods

Location and ethics statement

The broiler feeding trials were completed in the animal testing area of Anhui Science and Technology University. Sample analyses were carried out in the Anhui Province Key Laboratory of Animal Nutrition Regulation and Health. The ethical approval was obtained from the Institutional Animal Care and Use Committee of Anhui Science and Technology University, China (Approval No. 2022002).

Animal and experimental design

A total of two hundred clinically healthy, precisely 1 - day - old Arbor Acres broiler chicks, originating from a local farm (Feng yang, China), were reared in strict accordance with commercial brooding standards over the period from day 1 to day 27 of their growth. The feeding of the basal diet complies with the established standards (Table 1). They were randomly allocated to five experimental groups (with 4 replicate chicken houses per group and 10 broilers per pen) for a 14-day period. Group 1 was raised on a basal diet under a thermoneutral environment (TN; 24 ± 1°C). Others were exposed to 33 ± 1°C for 8 h/day (09:00-17:00 h) and fed basal diets with 0 (HS), 200 (HSLGP), 300 (HSMGP), or 450 mg/kg GP (HSHGP) (Jia, D. et al.) (Zhang, X. et al., 2026) Broilers aged 28-42 days were used due to their higher CHS sensitivity. Humidity and Temperature were controlled by a monitoring system (ROTEM AC-2000 PLUS). HS groups' heat came from industrial heaters. GP (>98% gypenosides) was from Muhe Biotech. Relative humidity was kept at 60% ± 5%. Broilers were placed in wire mesh cages (100 × 80 × 60 cm) with ad libitum feed/water. We recorded BW and feed intake to analyze ADFI, ADG, and F: G. Diets followed NRC poultry nutrient requirements.

Table 1.

Composition and nutrient levels of the basal diets (as-fed) %.

Ingredients	1-21d	21-42d
Corn	62.00	64.00
Bean pulp	29.10	27.80
Soybean oil	3.00	3.00
Fish powder	3.00	2.50
CaHPO4	1.60	1.40
NaCl	0.30	0.30
Premix1	1.00	1.00
ME/(MJ/kg)2	12.96	13.03
Crude protein	20.50	20.02
Lysine	1.05	1.02
Methionine+Cystine	0.80	0.78
Calcium	1.01	1.00
Total Phosphorus	0.71	0.67

Note:The premix provided the following nutrients per kilogram of diets: Mn (as manganese sulfate) 66 mg, Zn 44 mg, Cu (as copper sulfate) 9 mg, Fe (as ferrous sulfate) 50 mg, I (as potassium iodide) 0.4 mg, vitamin A 7 000 IU, vitamin D 3 875 IU, vitamin E 20 IU, vitamin K 31 mg, vitamin B 12 mg, vitamin B 24.5 mg, d-pantothenic acid 12 mg, nicotinic acid 50 mg, vitamin B 62.5 mg, vitamin B 120.6 mg. 2ME was a calculated value.

Sample collection

On days 7 and 14 of the HS period, eight broilers that had fasted overnight were randomly selected from each of the distinct experimental groups, weighed, and then blood samples were collected from their jugular veins into anticoagulant-free vacuum tubes, followed by 20 minutes of centrifugation (3000 rpm; 4 °C). The separated serum was stored at −20 °C for serum biochemical functional analysis. The broilers were then euthanized via jugular vein exsanguination. The thymus gland and spleen were carefully isolated through dissection procedures and subsequently weighed to determine the indices of the thymus and spleen. calculated as follows: thymus index = thymus weight / body weight × 100%; spleen index = spleen weight / body weight × 100%. Subsequently, tissue samples of the thymus and spleen were allocated, placed into cryovials, submerged into liquid nitrogen, the samples were instantaneously frozen and subsequently preserved at a temperature of −80 °C.

Determination of serum biochemical indicators

The parameters associated with serum biochemical functions were determined utilizing a fully - automated biochemical analyzer (Model BS - 200, produced by Mindray, Shenzhen, China), in conjunction with the corresponding reagent kits provided by the manufacturer. These parameters encompassed aspartate transaminase (AST), alanine transaminase (ALT), lactate dehydrogenase (LDH), total serum protein (TP), serum albumin (ALB), total cholesterol (TC), triglyceride (TG), high - density lipoprotein cholesterol (HDL), low - density lipoprotein cholesterol (LDL), calcium (Ca), and magnesium (Mg).

Microstructure of immune organs

Appropriate sizes of thymus and spleen tissues were taken from freshly slaughtered broilers and fixed in 4% paraformaldehyde. After being fixed, the samples were taken out, and three parts with the largest cross-section as the center were cut to complete the sampling. Series paraffin sections of 3-5 μm thickness were cut and kept thoroughly dried at 37 °C. Subsequently, the 3 μm tissue sections were subjected to dewaxing treatment using a series of alcohol solutions with varying concentrations, and then they were continuously stained with hematoxylin and eosin.

Analysis of antioxidant enzyme activities

The total antioxidant capacity (T-AOC; Catalog No. A015-2-1), total superoxide dismutase (T-SOD; Catalog No. A001-3-2), glutathione peroxidase (GSH-PX; Catalog No. A005-1-2) activities, as well as malondialdehyde (MDA; Catalog No. A003-1-2) concentration in thymus and spleen tissues, were determined using reagent kits obtained from Jian Cheng Bioengineering Institute (Nanjing, China).

Quantitative real-time PCR

Thymus and Spleen samples were homogenised in RNAiso Plus reagent and total RNA was extracted. RNA quality was assessed using NanoDrop One (Thermo Scientific, Wilmington, MA, USA). cDNA was synthesised from the extracted RNA using the Prime Script RT Master kit (Takara, Shiga, Japan, RR047A). PCR reaction solutions were prepared based on the reaction system of the TB Green TM Premix Ex Taq TM II kit (Tokyo, Japan). The target genes were then amplified using the Roche Light Cycler 480 System (Roche, Switzerland). The gene sequences of the antioxidant-related factors studied are presented in Table 2, where β-actin was served as a housekeeping gene. Data were processed using the 2^-ΔΔCt method to assess the expression levels of the goal genes.

Table 2.

Primer sequences of target genes for RT-qPCR.

Gene	Primer sequence (5′−3′)	Accession no.
Nrf2	F-CTGCTAGTGGATGGCGAGAC	NM_001030756.1
	R-CTCCGAGTTCTCCCCGAAAG
HO-1	F-AAACTTCGCAGCCACACAAC	NM_205344.2
	R-GACCAGCTTGAACTCGTGGA
IKBα	F-CTTCCAGAACAACCTCAGCCAGAC R-CGCAGCCAGCCTTCAGCAG	NM-001001472.2
P65	TCAACGCAGGACCTAAAGACAT R-GCAGATAGCCAAGTTCAGGATG	NM-OO1396396.1
β-actin	F-CCGCTCTATGAAGGCTACGC R-CTCTCGGCTGTGGTGGTGAA	NM_205518.2

Note:1F= forward; R= reverse; Nrf2 = Nuclear factor erythroid 2-related factor 2; HO-1 = heme oxygenase-1; IKBα=Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; NF-kB p65=RELA proto-oncogene, NF-kB subunit.

Western blotting

Total protein was isolated from thymus and spleen samples through lysis in a buffer solution comprising refrigerated RIPA lysis reagent and phenylmethanesulfonyl fluoride (PMSF) as a protease inhibitor (Beyotime, Shanghai, China). Protein quantification was executed by utilizing a BCA Protein Quantification Kit (Catalog No. P0010S, Beyotime, Shanghai, China), normalization of all samples to identical concentrations using lysis buffer. The quantified proteins were then combined with 5 × SDS-PAGE loading buffer (Catalog No. P0015L, Beyotime, Shanghai, China) at the specified ratio and heated at 95°C for 10 minutes to denature. Each sample (20 μg) underwent separation via electrophoresis on a 10% sodium dodecyl sulfate - polyacrylamide gel at a constant voltage of 80 V, followed by transfer to polyvinylidene fluoride (PVDF) membranes over a 90-minute period. These membranes were blocked with 5% skim milk powder for 1 hour and then incubated with the primary antibody at 4°C for 12-14 hours HO-1, Nrf2, IKBα, NF-kB (p65) and β-actin. After secondary antibody (rabbit IgG) incubation, protein bands were visualized using an enhanced chemiluminescence (ECL) kit (Beyotime, China) and detected with a chemiluminescence imaging system. Using ImageJ software to analyze the gray intensity of protein bands.

Statistical analysis

In this study, we selected the SPSS 27.0 statistical analysis system (developed by SPSS Inc., Chicago, USA) to conduct statistical analysis and data processing. All numerical values in the study are presented in the form of "meaning standard error". To explore the differences among data from different groups, we employed the one-way analysis of variance (ANOVA) method for testing. When they obtained P < 0.05, the difference was deemed to be statistically significant.

Results

The influence of GP on the growth performance of HS broilers

The growth performance of broilers raised for meat production is typically evaluated through multiple indices, including average daily feed intake (ADFI), average daily gain (ADG), and feed-to-gain ratio (F: G). As shown in Fig. 1, versus the CON cohort, the ADFI and ADG in the HS group significantly decreased to 35d and 42d (P < 0.05), and supplementing GP had a significant improvement effect. versus the CON cohort, the F: G in the 35d HSLGP group, HSMGP group, HSHGP group and 42d HSHGP cohort showed a marked reduction (P < 0.05).

Fig. 1.

The effect of GP on the growth performance of HS broilers

CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP . Average daily feed intake (ADFI); Average daily weight gain (ADG); Feed to weight ratio (F: G). Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

The influence of GP on the thymus and spleen indices of HS broilers

As shown in Table 3, at 35 days of age, the thymus index in the HS group decreased significantly versus the CON cohort, while that in the GP supplementation group increased significantly compared with the HS group (P < 0.05). The changes in the spleen indices did not reach statistical significance. At 42 days of age, versus the CON cohort, the thymus index and index in the HS cohort decreased significantly (P < 0.05), while compared with the HS cohort, the thymus index in the HS+450GP cohort showed a marked increase.

Table 3.

Effects of total saponins of GP on immune organ indices of HS broilers.

Age (days)	Project/Index	NS	HS	HS+200GP	HS+300GP	HS+450GP
35d	thymus	0.25±0.02ab	0.21±0.02c	0.27±0.02b	0.26±0.01ab	0.34±0.02a
	splenic organ	0.16±0.03	0.14±0.01	0.14±0.01	0.17±0.03	0.14±0.02
42d	thymus	0.25±0.02a	0.19±0.04b	0.22±0.05ab	0.22±0.04ab	0.26±0.05a
	splenic organ	0.13±0.01	0.13±0.01	0.12±0.01	0.13±0.02	0.13±0.03

Note: The same row of data shouldered with no letter or the same lowercase letter indicates a non-significant difference (P > 0.05), while different superscript lowercase letters indicate a significant difference between groups (P < 0.05), as in the following table.

Serum biochemical analysis of HS broilers

We evaluated many serum biochemical parameters that responded to thymus and spleen injuries, as shown in Table 4, Table 5. Versus the HS cohort, the levels of serum TC, LDL and LDH in HS broilers were higher at 35 days (P < 0.05), while the levels of TP, HDL, Ca and Mg were lower (P < 0.05). The level of serum TG was higher in 42 days (P < 0.05), and the levels of HDL and Ca were lower (P < 0.05). versus the HS cohort, GP significantly decreased the levels of TC (HSLGP) and LDH (HSHGP) at 35 days (P < 0.05), and the levels of TG (HSMGP) and Ca (HSHGP) significantly decreased at 42 days (P < 0.05). The level of HDL (HSHGP) also increased significantly (P < 0.05).

Table 4.

35d Effects of total saponins of GP on serum biochemistry in HS broilers.

Items	CON	HS	HSLGP	HSMGP	HSHGP
TP(g/L)	21.73±1.13a	17.63±0.68c	18.61±0.58bc	19.29±0.7abc	21.27±1.32ab
ALB(g/L)	9.53±0.52a	7.1 ± 1.1b	7.82±0.28a	8.07±0.28ab	9.27±0.4a
TC (mmol/L)	1.43±0.08b	1.79±0.09a	1.49±0.07ab	1.51±0.12ab	1.81±0.13a
TG (mmol/L)	0.24±0.01	0.27±0.03	0.24±0.01	0.25±0.04	0.26±0.02
HDL (mmol/L)	1.21±0.08ab	0.75±0.07c	0.99±0.05bc	1.08±0.06ab	1.28±0.13a
LDL (mmol/L)	0.34±0.03b	0.49±0.08a	0.32±0.02b	0.33±0.02b	0.36±0.03b
AST(U/L)	334.41±21.86	433.93±84.92	319.89±40.15	316.39±44.43	296.78±37.98
ALT(U/L)	13.06±0.53	14.24±0.31	14.12±0.14	13.45±0.18	13.47±0.38
LDH(U/L)	967.79±103.32b	1477.12±119.34a	1244.05±124.21ab	1058.89±128.22b	997.05±125.96b
Ca(mmol/L)	1.85±0.14a	1.16±0.08c	1.20±0.07c	1.42±0.09bc	1.64±0.13ab
Mg(mmol/L)	0.93±0.11a	0.67±0.03b	0.67±0.03b	0.75±0.05ab	0.62±0.04b

Table 5.

42d effects of total saponins of GP on serum biochemistry in HS broilers.

Items	CON	HS	HSLGP	HSMGP	HSHGP
TP(g/L)	21.67±0.55	21.66±1.02	20.18±0.55	22.17±0.68	23.06±0.89
ALB(g/L)	12.38±0.40	11.25±0.25	11.71±0.65	11.28±0.28	11.81±0.42
TC (mmol/L)	2.04±0.20	2.48±0.52	2.15±0.18	2.08±0.08	2.29±0.19
TG (mmol/L)	0.26±0.03c	0.56±0.03a	0.49±0.03a	0.33±0.09bc	0.42±0.03ab
HDL (mmol/L)	1.98±0.15a	1.39±0.09b	1.56±0.15b	1.58±0.06b	1.63±0.14ab
LDL (mmol/L)	0.69±0.11	0.54±0.15	0.58±0.16	0.54±0.05	0.49±0.05
AST(U/L)	358.19±35.60	429.98±36.38	406.12±68.47	451.52±66.66	308.85±31.37
ALT(U/L)	22.95±2.40	20.59±3.64	16.27±4.09	15.93±0.44	16.01±0.48
LDH(U/L)	1596.86±339.54	2019.62±528.16	1599.12±301.05	1795.38±243.08	1147.60±100.97
Ca(mmol/L)	2.48±0.23a	2.17±0.08b	2.04±0.08b	2.05±0.07b	2.13±0.10b
Mg/(mmol/L)	1.16±0.05	1.14±0.06	1.02±0.03	0.98±0.06	1.02±0.09

Note: TP = total protein; ALB = albumin; TC= Total Cholesterol; TG= Triglycerides;HDL= High-Density Lipoprotein; LDL= Low-Density Lipoprotein; AST = aspartate aminotransferase; ALT = alanine aminotransferase;LDH= Lactate Dehydrogenase; Ca= Calcium; Mg= Magnesium. CON: Thermoneutral temperature (24 ± 1 °C) + basal diets, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP. Results are expressed as mean ± SD. a-d with different superscript letters in the same column indicate remarkable differences (P < 0.05).

The influence of GP on the tissue structure and function of immune organs in HS broilers

Fig. 2, Fig. 3, Fig. 4, Fig. 5 show HE-stained sections of immune organ tissues from heat-stressed broilers at 35 and 42 days. In the CON group, the thymus had a normal microstructure with a thick cortex and a clear cortex-medulla boundary. Compared with CON, the HS group had a thinner thymus cortex, blurred cortex-medulla boundary, and loosely arranged lymphocytes. The GP supplementation groups showed increased thymus cortex thickness and closely arranged lymphocytes versus CON. The HSMGP and HSHGP groups had thicker cortices, clear medulla structures, and densely packed thymic lymphocytes. The CON group's spleen had a normal microstructure with distinct red and white medulla boundaries and clear splenic nodule structures. Versus the CON, the HS group's spleen was damaged, with unclear red-white medulla boundaries, blurred splenic nodule contours, smaller nodules, and loose cell arrangement. The splenic structure in the HSHGP group was more distinct, with an enlarged area of splenic nodules.

Fig. 2.

Effects of GP on the thymus tissue structure and function of HS broilers at 35 days

Note: CON: Thermoneutral temperature (24 ± 1 °C) + basal diet;HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP .Thymus and spleen (A, B, C, D, E, F represent magnification 20 ×, scale 100 μm; a, b, c, d, e, f represent magnification 20 ×, scale 50 μm). The following picture is the same.

Fig. 3.

Effects of GP on the thymus tissue structure and function of HSbroilers 42d.

Fig. 4.

Effects of GP on the spleen tissue structure and function of HS broilers at 35 days.

Fig. 5.

Effects of GP on the spleen tissue structure and function of HS broiler 42d.

The influence of GP on the histological parameters pertaining to immune organs within HS broilers

As depicted in Fig. 6, when versus the CON cohort at 35d, the thymic dermatomedullary ratio and the area of splenic nodules in the HS group exhibited a marked decline (P < 0.05), while compared with the HS group, the thymic dermatomedullary ratio and the area of splenic nodules in the HSHGP group exhibited a marked rise (P < 0.05). During 42 days of HS, Versus the CON cohort, the thymus pulped ratio and splenic node area in the HS group exhibited a marked decline (P < 0.05). Compared with the CON cohort, the HSLGP, HSMGP and HSHGP groups all exhibited significant increases (P < 0.05).

Fig. 6.

shows the effect of GP on the tissue parameters of immune organs in HS broilers

Note: CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1°C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP . Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

GP alleviates the damage to the oxidative role of immune organs within HS broilers

The antioxidant status indicators of broiler thymus and spleen are shown in Fig. 7, Fig. 8. Compared to the CON cohort, HS exposure elevated thymic and splenic MDA levels (P < 0.05) while suppressing antioxidant enzyme activities. Specifically, HS reduced T-AOC, GSH-PX, and T-SOD levels at both 35 and 42 days post-treatment (P < 0.05).GP supplementation effectively mitigated these oxidative stress markers. In the HSHGP group, thymic and splenic T-AOC and GSH-PX activities were restored to control levels by day 35 (P < 0.05), with T-SOD showing partial recovery (P < 0.05 vs HS). By day 42, T-AOC and GSH-PX activities in the HSHGP group exceeded CON levels (P < 0.05), while MDA content remained significantly lower than in HS broilers (P < 0.05).

Fig. 7.

Effects of total saponins of GP on the antioxidant function of the thymus in HS broilers

Note: CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1°C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP . T-AOC = total antioxidant capacity; T-SOD = total superoxide dismutase; MDA = malondialdehyde. GSH-PX = glutathione peroxidase; Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

Fig. 8.

Effect of total saponins of GP on the antioxidant function of the spleen in HS broilers.

The impact of GP on the transcriptional activity of inflammatory genes associated with NF - KB in the thymus of HS broilers

The results in Fig. 9 show that on the 35th day, relative to the CON cohort, the gene levels of HO-1, IKBα and Nrf2 in the HS cohort were markedly decreased (P < 0.05), The expression level of the p65 gene was significantly elevated (P < 0.05). Versus the HS cohort, supplementation of GP markedly increased (P < 0.05) the gene levels of HO-1 (HSLGP cohort, HSMGP cohort and HSHGP cohort), IKBα (HSHGP cohort), and Nrf2 (HSMGP cohort and HSHGP cohort). Supplementation of GP significantly reduced (P < 0.05) the gene level of p65 (in the HSMGP cohort and the HSHGP cohort). At the 42nd day, versus the CON cohort, the gene levels of HO-1, IKBα and Nrf2 in the HS cohort were markedly decreased (P < 0.05), and the gene level of p65 was markedly increased. Versus the HS cohort, supplementation of GP significantly enhanced (P < 0.05) the gene levels of HO-1, IKBα and Nrf2, showing a gradually increasing trend. The genetic level of p65 is gradually declining.

Fig. 9.

Effect of GP on the expression of NF-κB-related inflammatory genes in the thymus of HS broilers

Note: Effects of GP on the Expression of HO-1, IκBα, Nrf2, and p65 Genes in the Thymus of HS Broiler Chickens, HO-1 = heme oxygenase-1; IκBα=Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; Nrf2 = Nuclear factor erythroid 2-related factor 2; NF-κB p65=RELA proto-oncogene. CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP. Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

The effect of GP on the expression of NF-KB-related inflammatory genes in the spleen of HS broilers

As shown in Fig. 10, on the 35th day, versus the CON cohort, the gene levels of IKBα and Nrf2 in the HS cohort were markedly decreased (P < 0.05), and the gene level of p65 was significantly increased. Supplementation of GP markedly increased (P < 0.05) the gene levels of IKBα (in the HSMGP and HSHGP cohorts) and Nrf2 (in the HSLGP cohort, HSMGP cohort and HSHGP cohort). Supplementation of GP markedly reduced (P < 0.05) the gene level of p65 (HSLGP cohort, HSMGP cohort and HSHGP cohort). At the 42nd day, versus the CON cohort, the gene levels of HO-1, IKBα and Nrf2 in the HS cohort were markedly decreased (P < 0.05), and the gene level of p65 was markedly increased. Supplementation of GP significantly enhanced (P < 0.05) the gene levels of HO-1, IKBα and Nrf2, showing a gradually increasing trend. The genetic level of p65 is gradually declining.

Fig. 10.

The effect of GP on the expression of NF-κB-related inflammatory genes in the spleen of HS broilers

Note: Effects of GP on the Expression of HO-1, IκBα, Nrf2, and p65 Genes in the Spleen of HS Broiler Chickens, HO-1 = heme oxygenase-1; IκBα=Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; Nrf2 = Nuclear factor erythroid 2-related factor 2; NF-κB p65=RELA proto-oncogene. CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP. Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

Effects of GP on the expression of NF-kB signaling pathway-related proteins in the thymus of HS broilers

The results in Fig. 11 show that on the 35th day, versus the CON cohort, the protein levels of HO-1, IKBα and Nrf2 in the HS cohort decreased markedly (P < 0.05), and the protein level of P65 increased markedly (P < 0.05). Supplementation of GP markedly increased (P < 0.05) the protein levels of HO-1, IKBα and Nrf2, and decreased (P < 0.05) the protein level of P65. On the 42nd day, versus the CON cohort, the P65 protein level in the HS cohort increased markedly (P < 0.05). Supplementation of GP significantly reduced (P < 0.05) the protein level of P65 and increased the protein level of IKBα.

Fig. 11.

Effect of GP on the expression of NF-κB signaling pathway-related proteins in the thymus of HS broilers

Note: Effects of GP on the protein expressions of (A, E) HO-1, (B, F) IκBα, (C, G) Nrf2, (D, H) p65 in the thymus of HS broilers on days 35 (A, B, C, D) and days 42 (E, F, G, H). HO-1 = heme oxygenase-1; IκBα=Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; Nrf2 = Nuclear factor erythroid 2-related factor 2; NF-κB p65=RELA proto-oncogene. CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP. Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

Effects of GP on the expression of NF-kB signaling pathway-related proteins in the spleen of HS broilers

The results in Fig. 12 show that on the 35th day, versus the CON cohort, the protein levels of HO-1, IKBα and Nrf2 in the HS group decreased markedly (P < 0.05), and the protein level of P65 increased significantly (P < 0.05). Supplementation of GP significantly increased (P < 0.05) the protein levels of HO-1 and Nrf2 and decreased (P < 0.05) the protein level of P65. On the 42nd day, versus the CON cohort, the P65 protein level in the HS cohort increased markedly (P < 0.05). Supplementation of GP markedly reduced (P < 0.05) the protein level of P65 and increased the protein levels of HO-1, IKBα and Nrf2.

Fig. 12.

Effect of GP on the expression of NF-κB signaling pathway-related proteins in the spleen of HS broilers

Note: Effects of GP on the protein expressions of (A, E) HO-1, (B, F) IκBα, (C, G) Nrf2, (D, H) p65 in the spleen of HS broilers on days 35 (A, B, C, D) and days 42 (E, F, G, H). HO-1 = heme oxygenase-1; IκBα=Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; Nrf2 = Nuclear factor erythroid 2-related factor 2; NF-κB p65=RELA proto-oncogene. CON: Thermoneutral temperature (24 ± 1 °C) + basal diet; HS, 200 mg/kg GP + HS, 300 mg/kg GP + HS, 450 mg/kg GP + HS: High-temperature environment (33 ± 1 °C, 8 hours daily, from 09:00 to 17:00 h) + basal diet supplemented with 0, 200, 300, and 450 mg/kg GP. Values are SD ± mean. Different lowercase letters represent significant differences P < 0.05.

Discussion

HS in broilers refers to the non-specific physiological response of broilers to heat exposure when they are subjected to hyperthermal stress (Siddiqui, S. H. et al., 2022). Which accelerate the consumption of nutrients in broilers, reduce their feed intake and immune function, and ultimately result in a decline in production performance (Min, L. et al., 2015; Liu, L. et al., 2020). Empirical evidence indicates that HS not only stimulates the HPA, inhibiting the responsiveness of the hypothalamic feeding center in animals and reversing feed refusal behavior (Dahadha, R. et al., 2025), but also reduces the level of insulin - releasing peptide, leading to a decrease in appetite (Pearce, S. C. et al., 2014). Research has found that HS induces physiological metabolic disorders in broilers, causing significant drops in ADG and ADFI and consequently reducing production performance (Liu, L. L. et al., 2014). This HS experiment resulted in a marked decline in both ADG and ADFI of broilers, while triggering a pronounced elevation in the F/G However, feeding 450mg/kg of GP could significantly increase the ADG and ADFI of broilers compared to the HS group, and the F/G ratio was significantly reduced, this finding aligns with prior research (Hafez, M. H. et al., 2025). suggesting that GP exerts a beneficial effect on broiler growth and development under HS conditions, thereby preserving their productive performance.

Serum biochemical parameters serve as objective biomarkers for assessing nutritional status, metabolic homeostasis, and overall health conditions in poultry (James, G. et al., 2019). Total protein (TP), comprising albumin and globulin, indicates protein utilization and humoral immunity in feed (Ouyang, J. et al., 2023). Serum albumin (ALB), the most abundant plasma protein, maintains colloid osmotic pressure homeostasis (Biswas, A. et al., 2024). TP and ALB levels reflect body protein utilization or accumulation (Liu, Q. et al., 2022). Research shows HS significantly reduces blood albumin levels (Hartanto, S. et al., 2019). In this experiment, chronic HS lowered TP and ALB in broiler serum, consistent with prior findings (Ding, K. N. et al., 2023). This may be because HS reduces appetite and protein intake, limiting raw materials for TP and ALB synthesis. Additionally, HS alters metabolism, prioritizing energy for heat dissipation, inhibiting protein anabolism, and enhancing catabolism (Humam, A. M. et al., 2019; Lara, L. J.andRostagno, M. H., 2013). This experiment also found that HS increased serum ALT, ALP, and AST activities, decreased Ca and Mg concentrations, and reduced immune organ indices, suggesting HS may damage immune tissues (Liang, Q. H. et al., 2026). However, adding GP to feed can alleviate HS-induced inflammatory damage.

The research indicates that HS significantly attenuates the thickness of the thymic cortex, the ratio of thymus cortex to myeloid tissue, and the area of splenic nodules in broilers (Zhang, H. et al., 2025), while these histological indicators were restored to varying degrees after supplementation with different doses of GP. Especially in the HSHGP group, both 35 d and 42 d showed the characteristics of thickened thymus cortex, clear dermis and medullary structure, and closely arranged lymphocytes. It has been confirmed in multiple studies that HS causes atrophy of immune organs and loose lymphocyte arrangement (Van Goor, A. et al., 2017; Wang, D. et al., 2025). This study found that HS led to thinning of the thymus cortex, blurriness of the boundary between the cortex and medulla, and atrophy of splenic nodules in broilers, which aligns with the findings presented by previous studies on HS inducing oxidative damage to immune organs and apoptosis of lymphocytes (Ahmad, R. et al., 2022). As a central immune organ, the thymus has a reduced cortical thickness that reflects a decline in T cell generation capacity. A reduction in splenic nodules indicates a suppressed peripheral immune response (Quinteiro-Filho, W. M. et al., 2010). After supplementing GP, the thymus dermatomedullary ratio and the area of splenic nodules significantly increased, and HSHGP showed a better histological repair effect, indicating that GP has a dose-dependent protective effect on HS immune injury. Research findings demonstrate that following GP supplementation, the thymus and spleen indices of broilers exhibit a significant elevation (Liu, W.andHuang, X., 2025). This observation strongly suggests that GP potentially plays a role in facilitating the development and functional recovery of immune organs. In this current investigation, the HSHGP group exhibited a significant enlargement of splenic follicle area, suggesting that GP may facilitate the regeneration of B-cell-rich lymphoid follicles. Given that splenic follicles serve as central components of humoral immunity, their structural recovery implies not only attenuation of pathological damage but also a possible enhancement of immune function (Lu, Q. et al., 2023). Furthermore, the existing evidence substantiates that GP can modulate the proliferation and differentiation of immune cells by activating the NF - kB and MAPK signaling pathways (Wing‐Yan, W. et al., 2017; Hui, H. et al., 2020). Notably, empirical data reveals that the dose-dependent effect of GP exhibits a heightened degree of significance at the 42 - day - old stage, suggesting that long-term supplementation may be more beneficial for immune system repair.

Oxidative stress generates ROS, which can disturb the redox equilibrium and inflict harm on every category of biomolecules, encompassing DNA, proteins, and lipids (Yao, X. et al., 2023). A multitude of research findings have indicated that HS leads to a significant diminish in the activities of antioxidant enzymes such as SOD and CAT in the serum of poultry (Khan, A. Z. et al., 2018), The contents of CORT and MDA, in addition to the undertakings of CK and lactate dehydrogenase (LDH), significantly increased, thereby inducing oxidative stress (Elbaz, A. M. et al., 2023). In this study, it was found that due to a marked rise in MDA in the thymus and spleen and the significant decrease in antioxidant enzyme activity in HS broilers, these HS broilers may have oxidative stress at 33°C. It is worth noting that we found that with the persistence of HS, the enzymatic antioxidant activity within the thymus tissue of broilers at 42 days of age exhibited a diminished level in comparison to that observed in broilers at 35 days of age. Reported that under the impact of HS, the grades of lipid peroxides in the thymus and spleen tissues of poultry significantly increased, accompanied by a decline in the function of the antioxidant system and a large accumulation of ROS, ultimately inducing apoptosis or necrotic damage (Kuehu, D. L. et al., 2024; Mao, Y. et al., 2024). When the balance between oxidation and antioxidation within cells is disrupted, the body will experience oxidative stress, leading to lipid peroxidation and oxidative damage to DNA (Opresko, P. L. et al., 2025). Studies have shown that HS increases the activity of SOD in mitochondria of various muscle types and decreases the activity of GSH-PX (Chang, Q. et al., 2022). Nevertheless, our research revealed that the administration of GP effectively curbed the elevation of MDA concentrations within the thymus and spleen of broilers subjected to HS. This finding suggests that GP intervention mitigated the oxidative stress instigated by HS conditions. The saponin constituents present in GP play a pivotal role in modulating the body's immune response and hindering the development of inflammatory lesions. Based on this, it is reasonable to postulate that the observed mitigation of oxidative stress in the thymus and spleen of HS broilers by GP may be attributed to the inherent antioxidant characteristics of GP.

Under conditions of HS, an overabundance of ROS generation can also trigger inflammatory reactions. (Liu, W. C. et al., 2021), NF-κB plays a role in mediating the inflammatory reactions observed in animals subjected to HS exposure (Goel, A. et al., 2021; Lan, X. et al., 2016). Under normal physiological resting states, the majority of NF-κB (p65) molecules are not present in a free configuration; rather, they are bound to the IκBα protein within the cytoplasm. Exposure to stressors can induce the deterioration of IκBα, thereby facilitating the conversion of numerous NF-κB (p65) molecules into their freely activated state. The excessively liberated p65 subsequently translocases into the nucleus, where it orchestrates the regulation of the inflammatory cascade. (Chi, Q. et al., 2019). HS has been confirmed to regulate the NF-κB pathway, contributing to the augmented expression of p65 and inducing the production of inflammatory factors. NF-κB itself forms a negative feedback regulatory loop by inducing the transcription of IκBα. The upregulation of IκBα can limit the nuclear translocation of NF-κB, thereby inhibiting the activity of p65. In this study, GP significantly increased the level of IκBα, indicating that GP may exert anti-inflammatory effects by enhancing the negative feedback mediated by IκBα and reducing the nuclear accumulation of p65 (Liu, W. C. et al., 2022). Throughout the course of the current research, GP significantly augmented the level of IκBα, indicating that GP may exert anti-inflammatory effects by enhancing the negative feedback mediated by IκBα and reducing the nuclear accumulation of p65. Previous studies have reported that heat stress (HS) induces Th1/Th2 imbalance and activates the NF-κB signaling pathway in the spleen, as demonstrated by dysregulated mRNA expression of cytokines and IκBα/NF-κB(p65) (Meng, T. et al., 2022), which offers a crucial reference for the results obtained in this research. In this experiment, the additive of GP significantly enhanced the transcriptional level of IκBα, which might have strengthened the inhibitory effect of IκBα on p65, and thereby suppressed the upregulation of inflammatory genes. Meanwhile, The GP induced an up - regulation in the expression levels of both Nrf2 and its downstream target gene HO – 1, boosting the antioxidant capacity defense ability of the cells. The activation of the Nrf2/HO-1 axis can eliminate excessive ROS, indirectly reducing the triggering of NF-κB mediated by ROS, thereby forming a synergistic effect of anti-inflammation and anti-oxidation.

We further employed Western blotting techniques to investigate the mechanisms by which HS inflict damage upon the thymus and spleen, as well as to ascertain whether GP has the capacity to activate the NF-κB signaling pathway, thereby mitigating the inflammatory response induced by HS. In this experiment, the expressions of key proteins of the NF-κB signaling pathway in the thymus and spleen of HS broilers were detected at 35th and 42nd d, respectively. Versus the CON cohort, the proteins of HO-1, IκBα and Nrf2 in the HS cohort decreased markedly, while the protein of p65 increased significantly, indicating that HS leads to the degradation of IκBα, p65 nuclear import activation of inflammatory gene expression through excessive ROS production. After supplementing with GP, the protein levels of HO-1, IκBα, and Nrf2 all significantly increased, while the protein level of p65 significantly decreased, indicating that GP can restore the inhibition of IKBα and inhibit the triggering of NF-κB. This regulatory pattern is consistent with reports on other plant polysaccharides (Huang, Q. et al., 2025). HS causes ROS that has a cross - regulatory impact on NF-κB and Nrf2. ROS promote NF-κB to enter the nucleus and start the production of inflammatory genes, and at the same time, activate Nrf2 to induce antioxidant gene expression. The upregulation of Nrf2,HO-1 can reduces the intracellular ROS level and weaken the activation threshold of NF-κB (Wei, H. et al., 2023; Lee, M. T. et al., 2019). GP significantly alleviates the inflammatory response and oxidative damage caused by HS by simultaneously enhancing IκBα, Nrf2 and HO-1, forming a bidirectional regulatory network of "inhibiting NF-κB + promoting Nrf2" (Saw, C. L. et al., 2010; Javed, A. et al., 2024). These findings suggest that GP can restore the manifestation of IκBα and Nrf2/HO-1 in the thymus and spleen of HS broilers, inhibit the upregulation of p65, and thereby alleviate the NF-κB-mediated inflammatory response. Therefore, it is reasonable to believe that adding GP to the diet can reverse the inflammatory damage of the thymus and spleen in HS broilers through controlling the NF-κB pathway, thereby improving growth performance and alleviating HS responses.

Conclusions

This study reveals that HS impairs antioxidant enzyme activity, exacerbates inflammatory damage in the thymus and spleen of broilers, inhibits NF-κB signaling, and reduces growth performance. Supplementation with GP effectively alleviates HS-induced immune organ damage and growth inhibition, improves immune function, and promotes thymus development. GP achieves these effects by enhancing IκBα-mediated inhibition of NF-κB and activating the Nrf2/HO-1 antioxidant axis, ultimately mitigating inflammatory damage and oxidative stress in immune organs caused by HS (Fig. 13).

Fig. 13.

Mechanism by which GP alleviates heat stress and inflammatory injury in the thymus and spleen of broilers caused by HS

ROS = reactive oxygen species;Nrf2 = nuclear factor erythroid 2-related factor 2; HO-1 = heme oxygenase-1; IκBα = inhibitor of nuclear factor kappa B alpha; P65 = subunit Rela of nuclear factor kappa B.

Consent to participate

Informed consent was obtained from all individual participants included in the study.

Consent for publication

All participating authors have confirmed their consent to publish.

CRediT authorship contribution statement

Jinxue Ding: Writing – original draft, Visualization, Supervision, Resources, Methodology, Investigation, Formal analysis, Conceptualization. Jiajun Miao: Writing – review & editing, Validation, Project administration, Investigation, Formal analysis, Data curation. Xueqi Zhang: Validation, Software, Investigation. Yongjie Xiong: Formal analysis, Data curation, Conceptualization. Feiyang Ma: Supervision, Methodology. Shaojun He: Writing – review & editing, Project administration, Methodology, Funding acquisition, Conceptualization.

Disclosures

The authors declare that they have no competing financial interests or personal relationships that may have influenced the work reported in this study.