Effects of Artemisia argyi powder on growth performance, meat quality, meat flavor and intestinal health of ducks

Abstract

Artemisia argyi (AA), a traditional Chinese herbal medicine and food, is abundant in bioactive compounds and dietary fiber that could promote intestinal development, improve meat quality and regulate the intestinal microbiota. The purpose of this study was to investigate the effect of Artemisia argyi powder (AAP) on growth performance, meat quality of duck, in addition to elucidating the potential mechanism at play. A total of 420 one-day-old Cherry Valley male ducks with similar body weights were randomly allocated into a control group and four AAP supplementation groups, with AAP levels set at 0%, 2%, 4%, 6%, and 8%, respectively. Each group consisted of 7 subgroups with 12 ducks per replicate, and the experimental period lasted for 42 days. The findings demonstrated that dietary supplementation with AAP no more than 6% had no effect on the growth performance. Duck’s dietary supplementation with AAP exhibited reduced shear force (P = 0.007). Further analysis using Gas Chromatography-Ion Mobility Spectrometry (GC-IMS) revealed an increase in 6 characteristic volatile flavor compounds, including 1-octen-3-ol, Hexanol, Heptanal, 2-butanone, 2-pentanone, 2-heptanone. In addition, duck dietary supplementation with more than 6% AAP could improve the morphology of the small intestine of ducks, and this may be achieved by regulating the Wnt/β-catenin signaling pathway. Meanwhile, dietary AAP increased the relative cecal abundance of Bacteroides phylum (P < 0.05), Barnesiella genera (P < 0.01), and decreased relative abundances of Subdoligranulum (P < 0.01) and Blautia (P < 0.05). Furthermore, correlation analysis finding that the meat flavor compounds were positively correlated with the relative abundance of Barnesiella and Bilophila (P < 0.05), which mainly be involved in the formation of volatile flavor compounds in breast muscle. All of which indicated that AAP could improve meat quality, especially flavor, may be related to the regulation of intestinal morphology and microbiota. This findings suggest AAP is an effective strategy to improve the meat quality of ducks by regulating intestinal histomorphology and intestinal microbiota.

Introduction

In recent years, duck has become an important source of meat and eggs as its consumption continues to grow in the world. Duck meat is plentiful in proteins, polyunsaturated fatty acids, vitamins, and minerals that are easily digestible (Bai et al., 2020), which contribute to its distinct flavor that is appreciated by consumers. Volatile flavor substance is the main source of meat flavor and a key factor in consumer acceptance and preference for duck meat products (Zhang et al., 2022). However, because of a number of adverse environmental conditions, including large and high-density breeding, the intestinal flora of animals is also imbalanced, which frequently results in immunological stress or the occurrence of meat ducks. As a result, meat quality and production performance of meat ducks are decreased (Guo et al., 2022; Liu et al., 2024; Lin et al., 2017). Therefore, the pursuit of environmentally sustainable, intestinal healthy and meat quality-improving feed raw materials has emerged as a pivotal strategy for addressing the prevailing challenges.

Chinese herbal medicines are usually rich in bioactive substances, such as polysaccharides and flavonics, which can promote the growth and health of animals while increasing myoglobin content and the flavor of meat, thereby improving meat quality (Abdallah et al., 2018; Liu et al., 2021; Zhou et al., 2023). Artemisia argyi (AA), also known as wormwood and mugwort, is rich in essential oil, flavonoids, polysaccharides, terpenoids, and other active substances (Kuerban et al., 2024). And AA has been used as a feed ingredient in animal production. Many studies have shown that AA and the extract of AA promote intestinal morphology, tight junctions, and gut microbiota (Cui et al., 2024; Du et al., 2023), as well as meat quality (Alirezalu et al., 2022; Wang et al., 2024). Study has shown that the inclusion of Artemisia annua L. increased the redness, reduced drip loss of breast muscle in heat-stressed broilers (Wan et al., 2018). Dietary inclusion of Artemisia annua increased protein content and improved taste, color, texture, and overall acceptability (El-Rayes et al., 2025). Chicken dietary with mugwort essential oil enhanced both the antimicrobial activity and the maintenance of the initial quality (Keum et al., 2025). Marume et al. (2024) reported that broilers chickens fed with Artemisia afra essential oil increased intramuscular fat and the proportion of PUFAs, n-6 and n-3 fatty acids and the PUFA/SFA ratios.

The gut microbiota also regulates meat quality traits, which was called intestinal microbiota-muscle or gut- muscle axis (Lei et al., 2022). According to a study, lactic acid bacteria are important to the gut microbiota of ducks and to change the way they are composed and function, which in turn causes differences in the transcriptome of duck meat (Xu et al., 2023). Ruan et al. (2024) reported that Genera g_Lactobacillus and Christensenellaceae_R-7 improved muscle flavor by participating in the synthesis of volatile flavor compounds in the pectoral muscle. This provides a promising pathway for regulating gut morphology or microbiota and ultimately affecting meat quality.

Therefore, the purpose of this study was to look into how various amounts of Artemisia argyi powder (AAP) affected the intestinal morphology, microbiota changes and the quality of duck meat, and to find the relationships between the intestinal microbiota and flavor and improvement of the meat.

Materials and methods

Animal ethics

All experimental procedures were approved by the Institutional Animal Care and Use Committee of Yangtze University (202401017). The trial protocol followed the guidelines of the Institutional Animal Care and Use Committee of Yangtze University.

AAP preparation and compositional analysis

AAP was purchased from Qichun (Hubei). The nutrition level and the active ingredients including volatile oil, polysaccharides and flavonoids were listed as in Table 1. The AAP had moderate crude protein level and high levels of crude fiber and total dietary fiber (TDF), which were 19.24%, 27.31% and 55.32% respectively. AA is also rich in volatile oils, polysaccharide compounds and flavonoids, which were 3.25%, 2.57% and 4.39% respectively.

Table 1.

Determination of various components of AAP (dry matter basis, %).

Items	Content1	SEM
Nutrition ingredient
CP	19.24	2.33
CF	27.31	5.67
EE	2.35	0.56
GE (MJ/kg)	18.14	0.49
Ca	0.99	0.31
P	0.24	0.08
Fiber
ADL	12.64	0.63
ADF	30.58	0.42
NDF	54.08	1.14
IDF	51.69	2.93
SDF	5.62	1.23
TDF	55.32	5.33
Bioactive substances
VO	3.25	1.11
PC	2.57	1.43
FL	4.39	2.81

Abbreviations: CP, crude protein; CF, crude fiber; EE, crude ether extract; GE, gross energy; ADL, acid detergent lignin; ADF, acid detergent fiber; NDF, neutral detergent fiber; IDF, insoluble dietary fiber; SDF, soluble dietary fiber; TDF, total dietary fiber; VO, Volatile oils; PC, Polysaccharide compounds; FL, Flavonoids.

¹All data are actual measured values, and results are the average values of triplicate measurements.

Experimental design and sampling

Ducklings were purchased from Longfa Poultry Hatchery Co., Ltd (Nanning, China). A total of four hundred and twenty one-day-old male Cherry Valley ducks were weighed and divided into five groups, each consisting of seven replicate pens, with each pen containing twelve ducks based on their body weight (average weight 47.7 ± 0.1 g). All ducks were fed the same nutrient composition but different levels of AAP (i.e., 0, 2%, 4%, 6% and 8%). The feed components and nutritional levels of diets basis to meet the nutritional needs of primary ducks in China (NY/T2122-2012) were presented in Table 2. The experiment lasted for a duration of 42 days. Over the course of the trial period, ducks were provided with adequate feed and water.

Table 2.

Ingredients and nutrient levels of diets for each group (as-fed basis, %).

Items	Content
	1-21d					22-42d
	CON	2%	4%	6%	8%	CON	2%	4%	6%	8%
Ingredients
Corn	61.65	58.87	57.37	56.5	55.31	73.63	72.00	70.82	69	67.83
Soybean meal	27.71	29.75	28.82	26.11	24.10	18.8	17.00	16.00	15.76	13.70
Corn gluten meal	4.55	3.00	3.40	5.00	6.13	2.50	3.20	4.00	3.95	5.10
Fat powder	0.10	0.96	1.41	1.65	2.00	0.29	0.70	1.10	1.65	2.00
MC	1.70	1.15	0.69	0.38	0.00	1.60	1.20	0.80	0.35	0.00
AAP	0.00	2.00	4.00	6.00	8.00	0.00	2.00	4.00	6.00	8.00
DCP	1.50	1.49	1.50	1.50	1.55	1.25	1.30	1.28	1.27	1.30
Limestone	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00	1.00
Salt	0.30	0.30	0.30	0.30	0.30	0.30	0.30	0.30	0.30	0.30
Lys	0.28	0.25	0.27	0.33	0.37	0.03	0.10	0.09	0.10	0.15
Met	0.21	0.23	0.24	0.23	0.24	0.10	0.10	0.11	0.12	0.12
Premix1	1.00	1.00	1.00	1.00	1.00	0.50	0.50	0.50	0.50	0.50
Total	100	100	100	100	100	100	100	100	100	100
Calculated nutrient levels
ME, MJ/kg	12.14	12.14	12.14	12.14	12.14	12.35	12.35	12.35	12.35	12.35
CP	20.00	20.00	20.00	20.00	20.00	16.00	16.00	16.00	16.00	16.00
CF	4.32	4.32	4.32	4.32	4.32	3.86	3.90	3.86	3.86	3.86
Calcium	0.91	0.91	0.91	0.91	0.91	0.81	0.80	0.81	0.81	0.81
Total phosphorus	0.69	0.69	0.69	0.69	0.69	0.60	0.60	0.60	0.60	0.60
AP	0.42	0.42	0.42	0.42	0.42	0.35	0.40	0.35	0.35	0.35
Lysine	1.10	1.10	1.10	1.10	1.10	0.65	0.70	0.65	0.65	0.65
Met	0.52	0.52	0.52	0.52	0.52	0.36	0.40	0.36	0.36	0.36
Met + Cys	0.80	0.80	0.80	0.80	0.80	0.60	0.60	0.60	0.60	0.60
Analyzed nutrient levels2
CP	19.62	19.58	19.61	19.59	19.55	15.66	16.00	15.69	15.65	15.66
CF	4.28	4.34	4.31	4.30	4.35	3.78	3.80	3.84	3.80	3.85
Calcium	0.92	0.92	0.94	0.91	0.94	0.83	0.80	0.85	0.84	0.83
Total phosphorus	0.71	0.70	0.73	0.72	0.74	0.60	0.60	0.61	0.60	0.62

Abbreviations: MC, Microcrystalline cellulose; AAP, Artemisia argyi powder; DCP, Dicalcium phosphate; ME, Metabolizable energy; CP, Crude protein; CF, Crude fiber; AP, Available phosphorus.

¹The premix provides per kg of concentrate: Cu 8 mg, Fe 80 mg, Zn 90 mg, Mn 70 mg, Se 0.3 mg, I 0.4 mg, vitamin A 9,000 IU, vitamin D3 1,500 IU, vitamin E 7.5 IU, vitamin B1 0.6 mg, vitamin B2 4.8 mg, vitamin B6 1.5 mg, vitamin B12 0.009 mg, vitamin B5 7.5 mg, vitamin B9 0.15 mg, vitamin B3 20 mg.

²Results are the average values of triplicate measurements.

Seven ducks were randomly selected from each group. The middle of duodenum, jejunum and ileal intestinal segments of ducks were carefully collected and placed in 4% paraformaldehyde for intestinal morphology. Take about 10 cm of the middle part of the jejunum, rinse it with physiological saline, and then scrape off the mucosa with a sterile glass slide. The jejunum mucosa were quickly frozen in liquid nitrogen and then stored at − 80 °C until further analysis. The right breast of the duck was designated for testing pH, color, drip loss, cooking loss, and shear force. The duck breast from the left side was utilized for GC-IMS analysis.

Growth performance

The total feed intake in every column and final weight (FW) of each duck was recorded. The average daily feed intake (ADFI), average daily gain (ADG), and the feed-to-gain ratio (F/G) were calculated.

The calculation formula for growth performance was as follows:

$$\text{ADFI}\left(\mathrm{g}/\mathrm{d}\right)=\text{feed}\text{intake}/\text{test}\text{days}$$

$$\text{ADG}\left(\mathrm{g}/\mathrm{d}\right)=\left(\text{FW}-\text{initial}\text{weight}\right)/\text{test}\text{days}$$

$$\mathrm{F}/G=\text{ADFI}/\text{ADG}$$

Meat quality assay

The pH values of right breast muscle were determined by pH meter (Testo 205, Testo, Germany). The values of the lightness (L*), redness (a*), and yellowness (b*) were determined by colorimeter (KONICA MINOLTA, Shanghai, China) across the upper, middle, and lower portions on the same side. The color and pH of duck meat were measured at 45 minutes and 24 hours post-slaughter, with the measurement methods referring to the objective methods for evaluating eating quality attributes of meat (NY/T 2793-2015). Refer to the objective methods for evaluating eating quality attributes of meat, use the hanging bag method to measure the drip loss of duck meat 24 hours after slaughter, and measure the cooking loss and shear force 24 h after slaughter. The drip loss was measured using the hanging bag method according to the previous study (Yu et al., 2025). The cooking loss was determined by calculating the ratio of the difference in duck breast weight before and after cooking. The shear force was measured based on Jing et al. (Jing et al., 2024) by a tenderness meter (Bulader, Beijing, China).

Analysis of volatile compounds (VOCs)

The sample preparation process for determining VOCs involved the duck meat, according to the previous methodology (Man et al., 2023). The content of volatile compounds in duck meat was determined using FlavourSpec® Flavor Analyzer (G.A.S). Weigh the processed sample into a headspace vial, and after incubation, inject it into the instrument. After the sample undergoes preliminary separation by gas chromatography, it is further separated in ion mobility spectrometry. Use the instrument's built-in software combined with the NIST database and IMS database for qualitative identification of compounds. The absolute content of compounds is calculated using the external standard method through a standard curve. Finally, use the Gallery Plot plugin to generate the fingerprint map.

Intestinal morphometry

The tissues from the small intestine was dehydrated with ethanol, cleared in xylene, and embedded in paraffin. Then, the paraffin blocks were stained with hematoxylin and eosin stain solution after being cut into 4 μm thick paraffin pieces by a cutter. Slice specimens were observed under a light microscope (Nikon Eclipse E100). Representative fields of views were taken and used by ImageJ software (US National Institutes of Health, Bethesda, Maryland) to evaluate the villi height (VH), crypt depth (CD), and calculate villi height to crypt depth ratio (V/C) in tissue sections.

Total RNA extraction and real-time quantitative PCR

RNA of the jejunum mucosa were extracted by HiPure Universal RNA Mini Kit (Magen Biotechnology, Guangzhou, China). Real-time quantitative PCR was performed according to established protocols (Zhai et al., 2025) using the primers listed in Table 3. The mRNA expression was calculated by the method 2^−ΔΔCT and standardized by β-actin.

Table 3.

Primer sequences for real-time quantitative RT-qPCR.

Gene1	Gene Bank ID	Primer sequence, sense/antisense	product size (bp)
Occludin	XM_013109403.1	GCTGGGCTACAACTACGGGT	240
		ACGATGGAGGCGATGAGC
Z0-1	XM_013104936.1	TCAGCGAGATGAACGAGCC	189
		TCTGAAGGCTCTGACCTCTGG
Claudin-1	XM_013108556.1	GGCATCATATTCAGCACCTTC	134
		GCCTTACGCACTACATCTTGG
MUC2	XM_038180256.1	CCGTGGCAGTAGTACAGGATGG	149
		GGTTGAAGTTGAAGAATGTGTTGAAGG
LGR5	XM_038164888.1	ACAGTGGGAAAGTGGAATTGGTTG	94
		AAGTGCGGCTAAGGTGAGGAG
TCF4	XM_038171399.1	TCAAGCGTCATCATCTCCCAATTATG	87
		GCGTCGTCCAGCCTCTCC
Wnt5a	XM_027467590.2	CGAGGCTGGGAGGAGAACTG	89
		AACAGGTCTTCAGGCTACAGGAG
SOX9	NM_001310779.1	GGACACGGAGAACACCAGACC	132
		TCGTAGCCCTTGAGCACTTGG
β-catenin	XM_027450107.2	TGCCGTTATGGTTCATCAGTTATCC	183
		AAGATCGCCAACAAGCCTTCAC
β-actin	NM_00131042.1	TACGCCAACACGGTGCTG	215
		GATTCATCATACTCCTGCTTG

Abbreviations: ZO-1, zonula occludens-1; MUC2, mucin 2; LGR5, leucine rich repeat containing G protein-coupled receptor 5; TCF4, transcription factor 4; Wnt5a, Wnt family member 5A; SOX9, SRY-box transcription factor 9.

Cecal microbiological analysis

Genomic DNA of microorganisms was extracted from cecal contents using the E. Z. A. N. DNA kit (Omega Bio-tek, Norcross, GA, U.S.). High-throughput sequencing data analysis of the library was entrusted to Shanghai Meiji Biomedical Technology Co., Ltd (Shanghai, China). The data processing was carried out according to the established scheme (Zhai et al., 2025).

Statistical analysis

The CONTRAST procedure in SAS 9.3 was utilized to evaluate the linear and quadratic effects. The Duncan method was used for multiple comparisons of the mean between groups. And GraphPad prism 8.0.2 was used for graphing. Pearson's correlation was applied to analyze the co-occurrence relationship between gut microbiota and VOC, and features were considered significant at P < 0.05. All results were presented as the mean with SEM. The significance levels were established at P < 0.05 (*), P < 0.01 (**), and P < 0.001(***), respectively.

Results

Growth performance

As demonstrated in Table 4, the dietary AAP level significantly influenced ADFI, ADG, FW, and F/G (P < 0.001). ADFI exhibited a declining trend as the dietary AAP level increased. Specifically, ducks receiving 6% and 8% AAP exhibited lower ADFI compared to those in the 0%, 2%, and 4% groups (P < 0.001). Furthermore, ducks fed with 8% AAP showed reduced ADG and FW, alongside an increased F/G ratio, relative to other groups (P < 0.001).

Table 4.

Effects of AAP on the growth performance in ducks.

Items	CON	2% AAP	4%AAP	6%AAP	8%AAP	SEM	P-value
							T	L	Q
ADFI/g	137.51a	137.31a	139.04a	118.99b	108.98b	14.72	<0.001	<0.001	0.009
ADG/g	54.15a	52.97a	53.12a	53.99a	30.79b	10.78	<0.001	<0.001	<0.001
FW/g	2321.80a	2272.31a	2279.03a	2315.16a	1340.94b	452.69	<0.001	<0.001	<0.001
F/G	2.68b	2.76b	2.76b	2.39b	3.62a	0.49	<0.001	<0.001	<0.001

Abbreviations: CON, Control group; AAP, Artemisia argyi powder; ADFI, Average daily feed intake; ADG, Average daily gain; F/G, Feed to gain; FW, Final weight; SEM, Standard error of the mean.

^a,bValues within a row with different superscripts differ significantly at P < 0.05.

T, P value of one-way ANOVA; L, P value of linear analysis; Q, P value of quadratic analysis.

Meat quality

Table 5 indicates that the incorporation of AAP in the diet did not result in any significant changes to the pH value, meat color, drip loss, or cooking loss of duck meat (P > 0.05). With the increase in additive amount, the application of AAP in the diet considerably decreased the shear force of the meat ducks (P = 0.007) and the trend was linear with the decrease (P < 0.001).

Table 5.

Effects of different levels of AAP on muscle meat quality of ducks.

Items	CON	2%	4%	6%	8%	SEM	P -value
							T	L	Q
pH (45 min)	6.50	6.67	6.61	6.62	6.75	0.11	0.612	0.215	0.984
L* (45 min)	44.73	40.10	45.20	42.07	42.72	1.34	0.083	0.632	0.646
a* (45 min)	9.42	9.59	9.37	9.09	8.06	0.66	0.513	0.142	0.334
b* (45 min)	4.17	2.49	3.22	3.07	3.31	0.66	0.518	0.588	0.246
pH (24 h)	6.13	6.36	6.31	6.27	6.51	0.16	0.063	0.209	0.107
L* (24 h)	42.99	40.14	44.14	43.49	43 .52	1.50	0.388	0.367	0.844
a* (24 h)	11.49	11.93	10.54	11.08	9.57	1.21	0.687	0.236	0.666
b* (24 h)	4.87	4.46	5.86	5.33	5.25	0.86	0.826	0.555	0.701
Drip loss (%)	1.88	1.61	1.76	1.68	1.69	0.01	0.950	0.720	0.709
Cooking loss (%)	32.24	29.69	31.27	32.71	27.39	0.02	0.465	0.488	0.338
Shear force (N)	30.79a	28.98a	27.50ab	23.23b	22.29b	4.68	0.007	<0.001	0.379

Abbreviations: SEM, Standard error of the mean.

^a-bMean values in a row without common superscript are significantly different (P < 0.05) (n = 7).

T, P value of one-way ANOVA; L, P value of linear analysis; Q, P value of quadratic analysis.

Analysis of volatile compounds (VOCs)

The x, y, and z axes of the 3D topography represent the separation drift time of the ions, the retention time of the detected substance, and the signal intensity of the compound, respectively (Fig. 1A). When conducting the experiment, it was observed that the control group exhibited a relatively limited variety of these volatile compounds. In contrast, the APP groups showed a more diverse range of such substances. The types and contents of volatile flavor substances in the five treatment groups were determined to compare the differences in flavor substances among the treatment groups. Supplemental Table 1 and Fig. 1B showed the type composition of the volatile flavor compounds contained in each sample. The volatolomics identified a total of 36 VOCs, including 11 aldehydes, 10 alcohols, 7 ketones, 2 acids, 1 ester, 1 thiophene and 1 furan in breast muscle. The content of aldehydes, alcohols, ketones, acids, thiophene and furan were increased linearly (P < 0.05).

Fig. 1.

The 3D topographic plot (A) and fingerprint spectra (B) of volatile compounds in duck meat in different groups.

Note: A1∼A5, CON group; B1∼B5, 2% AAP group; C1∼C5, 4% AAP group; D1∼D5, 6% AAP group; E1∼E5, 8% AAP group.

AAP improves the morphological development of small intestines in ducks

The data presented in Table 6 and Fig. 2 indicate that ducks receiving a diet supplemented with AAP exhibited an increase in duodenal VH and V/C ratio, alongside a reduction in CD (P < 0.05). Specifically, ducks fed with a 6% AAP diet demonstrated significantly greater duodenal VH compared to the control group (P = 0.024). An upward trend in the V/C ratio in both the duodenum and jejunum was observed with increasing levels of dietary AAP (P < 0.01).Our study showed that dietary containing 8% AAP in ducks resulted in a considerable increase in the relative expression of ZO-1 gene in duck jejunum compared with the control group (P < 0.05, Fig. 3B). Furthermore, the 8% AAP diet led to higher Claudin-1 expression in the jejunum of ducks when compared to the CON, 2%, and 4% AAP groups (P < 0.05, Fig. 3A). However, the levels of dietary AAP did not have a significant impact on the expression of Occludin and MUC2 (P > 0.05, Fig. 3C, D). In addition, the relative expressions of LGR5 (P < 0.01, Fig. 3E), SOX9 (P < 0.01, Fig. 3G), and β-catenin (P < 0.01, Fig. 3F) in the jejunum of the experimental duck groups were up-regulated, particularly in the 8% group.

Table 6.

Effects of AAP in different levels on the intestinal morphology of ducks.

Items1	CON	2%	4%	6%	8%	SEM	P-value
							T	L	Q
Duodenum
VH/μm	734.50b	771.51b	869.76ab	1002.63a	892.89ab	147.26	0.024	0.009	0.258
CD/μm	255.75a	211.72ab	205.56b	212.16ab	171.25b	38.73	0.016	0.002	0.742
V/C	2.99d	3.76cd	4.29bc	4.79ab	5.28a	0.96	<0.001	<0.001	0.589
Jejunum
VH/μm	769	824	886.6	931	770.4	162.26	0.536	0.684	0.159
CD/μm	229.78a	208.21a	201.95a	203.04a	139.88b	44.05	0.042	0.006	0.284
V/C	3.62b	4.21b	4.47ab	4.58ab	5.58a	0.93	0.041	0.003	0.641
Ileum
VH/μm	785.67	768.23	673.26	799.96	631.87	122.95	0.199	0.151	0.719
CD/μm	195.14a	189.61a	132.99bc	175.16ab	123.69c	41.52	0.02	0.009	0.914
V/C	4.24	4.33	5.21	4.85	5.22	0.81	0.251	0.059	0.645

Abbreviations: VH, villus height; CD, crypt depth; V/C, villus-to-crypt ratio; SEM, Standard error of the mean.

^a-cMean values in a row without common superscript are significantly different (P < 0.05) (n = 7).

T, P value of one-way ANOVA; L, P value of linear analysis; Q, P value of quadratic analysis.

Fig. 2.

Effects of different APP levels on the morphology of duodenum, jejunum, and ileum (40 ×).

Note: Red arrows indicate villus height, blue arrows indicate the crypt depth (n = 7).

Fig. 3.

Relative expression of genes related to the jejunal intestinal barrier and Wnt/β-catenin signal pathway. * P < 0.05, **P < 0.01 (n = 7).

AAP changed the cecal microbiota in ducks

The results of the Partial Least Squares Discriminant Analysis (PLS-DA, Fig. 4A) indicated a distinct separation between the 8% group and other groups, highlighting a significant impact of a diet containing 8% AAP on the cecum microbiota. At the phylum level, community barplot analyses showed that, in each group, Firmicutes accounted for the largest proportion, followed by Bacteroidetes and Desulfobacterota (Fig. 4B). The amount of Firmicutes was decreased by dietary supplementation with APP, however, the amount of Bacteroidetes was opposite (Fig. 4C and D, P < 0.05). Ducks fed a diet containing AAP showed an increased relative abundance of Bacteroides (Fig. 4F, P < 0.05). Our study found that with the increasing of dietary APP level, the relative abundance of Barnesiella was increased (Fig. 4G, P < 0.05). Supplementing ducks'diets with AAP led to a reduction in the relative abundances of Subdoligranulum and Blautia (Fig. 4H and I, P < 0.05).

Fig. 4.

Effect of AAP on duck cecal microbe. (A) Partial least squares discrimination analysis (PLS-DA) on phylum level of cecal microbiology in different groups of ducks. (B) Relative abundance (%) of the top 10 bacteria present on phylum level of cecal contents. (C) Relative abundance (%) of the top 30 bacteria present on genus level of cecal contents. (D) Bacteria exhibit variations among the top 10 phyla. (E-H) Bacteria with differences among the groups in the top 30 at the genus level. * P < 0.05, **P < 0.01, ***P < 0.001 (n = 7).

Analysis of the relationship between intestinal microbiota and VOCs of duck meat

Fig. 5 illustrates the findings of the correlation analysis between intestinal microbes and volatile organic compounds in duck meat. The Subdoligranulum abundance was negatively associated with the levels of 1-Butanol, 3-Methyl-3-buten-1-ol, Propanoic acid, Hexanol, 2-Pentyl furan, Pentan-1-ol, 2-Octanol, and 3-Hexanone (P < 0.01). While Barnesiella and Bilophila abundances were positively correlated with 3-Methyl-3-buten-1-ol, Propanoic acid, Hexanol, 2-Pentyl furan and Pentan-1-ol contents (P < 0.05).

Fig. 5.

Correlation analysis between differential microbiota and VOCs. The correlations are indicated by * (P < 0.05), ** (P < 0.01), *** (P < 0.001), where in the blue squares indicate positive correlations and red squares indicate negative correlations.

Discussion

Growth performance

Study has shown that many Chinese herbs and processed Chinese herbal products play a positive role in the growth of animals, including AA (Song et al., 2023). Dietary supplementation with AA or processed AA products in the diet could reduce the ADFI of chickens, geese and mice (Cui et al., 2024; Ma et al., 2022; Yang et al., 2021). The findings of this study aligned with previous results, indicating that feeding ducks a diet containing more than 6% AAP led to a reduction in ADFI. Conversely, supplementation with 8% AAP adversely affected ADG, FW, and F/G in meat ducks. This negative impact may be attributed to the increase in insoluble dietary fiber associated with higher AAP levels, which accelerates intestinal transit and impairs nutrient digestion and absorption. Additionally, excessive AAP may impart a bitter taste to the feed, reducing palatability and consequently feed consumption. Therefore, adding less than 6% of AAP to meat ducks does not negatively impact the growth performance.

Meat quality

Measuring meat quality indicators, including pH, color, drip loss, cooking loss and shear force is of great significance for assessing muscle quality and studying high-quality meat (Liu et al., 2021). The pH value reflects the level of lactate accumulation at the end of anaerobic digestion of muscle glycogen after slaughter (Zhang et al., 2020). It is related to water holding capacity (WHC) of meat, and high pH value can reduce the dripping loss and cooking loss of meat (Barbut, 1993). The biological nature of meat color is driven by the myoglobin redox cycle, mitochondrial residual oxygen consumption capacity and fat oxidation products, among which the high a* value depends on the proportion of oxymyoglobin and the inhibition of lipid peroxidation by the antioxidant system, and the increase of b* value is often accompanied by fat oxidation yellowing (Suman and Joseph, 2013). As an important index to evaluate muscle freshness, the water holding capacity is mainly measured by measuring the cooking loss rate and drip loss rate (Mir et al., 2017).Shear force is an index to quantify the mechanical strength of muscle fibers, reflecting the difficulty of sarcomere breakage, and its biological characteristics are influenced by factors such as the diameter of muscle fibers, the content of connective tissue, and the activity of protein-degrading enzymes (Mir et al., 2017). Antioxidants such as flavonoids and polyphenols in AAP can scavenge free radicals and reduce the oxidation of myofibrous, thereby improving the hydration and tenderness of meat (Wang et al., 2024). Our results showed that the use of AAP in the duck diet could improve meat tenderness.

The volatile flavor

The biological mechanism of volatile flavor compounds in meat is the core index that determines the sensory characteristics of meat, and its biological mechanism stems from the synergistic effect of metabolic pathways such as lipid oxidation, Maillard reaction and protein degradation, which not only reflects the endogenous enzyme activity, antioxidant capacity and microbial metabolism dynamics of muscle, but also shapes the unique flavor profile through aroma threshold and synergistic effect (Park and Choi, 2025; Zhang et al., 2024).Alcohols are mainly are mainly produced by glucose metabolism, lipid oxidation, amino acid decarboxylation and dehydrogenation (Zhang et al., 2021). 1-octen-3-ol was found to contribute to the mushrooms and green flavor with a low threshold (Mariutti and Bragagnolo, 2017), in addition, it is capable of being formed by linoleic acid (Zhang et al., 2019) and arachidonic acid (Wang et al., 2021) through lipid oxidation processes. Our study showed that with the increasing of APP level in the duck diet, 1-octen-3-ol is extremely increased of the duck meat. Due to their low odor threshold, aldehydes are crucial to the distinctive flavor of meat products (Liu et al., 2021). Hexanal was identified as a common contributor to duck meat flavor (Cui et al., 2023). Hexanal has a leaf, delicate and apple smell; heptanal possesses a nutty and fruity green flavor (Wang et al., 2021). In our study, the content of hexanal was the highest in all the aldehydes in duck meat, and the content in the 8% group was about twice that of the control group. Duan et al.'s (2023) study found that hexanal was abundant in sheldrake duck meat, indicating that it is a typical volatile flavor substance of sheldrake duck meat. The characteristic flavor of these ketones is usually described as giving a creamy flavor and a cheese flavor. The primary compounds identified in duck meat were 2-butanone and 2-heptanone, which aligns with the findings of Xie et al. (Xie et al., 2022). Acids have a higher threshold and therefore generally contribute less to odor (Hu et al., 2020). Ester compounds have a low odor threshold, allowing them to impart unique odors to fruits and flowers (Liu et al., 2019). According to these data, use of AAP in meat duck feed can increase the content of flavor compounds, thereby promoting the improvement of duck meat flavor to a certain extent. And this may be attributed to the volatile compounds, including aldehydes, ketones, and alcohols in artemisia leaves (Liu et al., 2021).

The intestine morphology and barrier

Studies have shown that the use of AAP in diet could improve the morphology of jejunal tissue in Roman laying hens, geese and post-weaning rabbits (Cui et al., 2024; Chen et al., 2022; Liu et al., 2019). In addition, a moderate amount of high-fiber diet is beneficial for the development of T cells in the epithelial area of the small intestine (Royer et al., 2023). It was found that the relative expression levels of ZO-1 and Claudin1 in the small intestine of rabbits fed with AAP diet were significantly up-regulated after weaning (Liu et al., 2019).

The Wnt/β-catenin signaling pathway determines the differentiation fate of cells during development and is involved in the control of the survival, proliferation, and activity of gastrointestinal epithelial cells (Dorfman et al., 2015; Zhang et al., 2023). Studies had confirmed that the Wnt/β-catenin signaling pathway was involved in the regulation of intestinal barrier function (Dong et al., 2022). As an important regulatory protein in the Wnt signaling pathway, β-catenin can regulate cell proliferation and differentiation. Wnt family member 5A (Wnt5a), an essential member of the Wnt family, is necessary for intestinal development during embryogenesis. Wnt5a-deficient mice have reduced intestinal cell proliferation, and shortened replication of the small intestine results in cross-lumening (Cervantes et al., 2009). The study found that mouse colon epithelial stem cells were more active when the LGR5 and β-catenin genes were upregulated (Gu et al., 2024). TCF4 is involved in the regulation of intestinal epithelial (crypt) cell proliferation (Lickert et al., 2000). Activation of SOX9 can enhance the regenerative ability of mouse intestinal stem cells (Guo et al., 2023). Flavonoids have been shown to inhibit the decomposition of β-catenin and enhance its concentration in the nucleus, thereby activating the Wnt/β-catenin signaling pathway (Zhao et al., 2022).

The cecum microbiota

The phylum Bacteroidetes within the intestine plays a crucial role in animal body fat metabolism (Kallus and Brandt, 2012). Furthermore, Walters et al. (Walters et al., 2014) have shown that there is a direct correlation between the amount of fat in tissues and the ratio of Firmicutes to Bacteroidetes in the gut. The intestinal microbiota plays a crucial role in maintaining animal health and gut homeostasis through nutrient metabolism, immune modulation, protection (Álvarez et al., 2021) and meat quality (Xu et al., 2023). Dietary fiber level significantly impacts intestinal health by promoting digestion, intestinal peristalsis, and regulating microflora (Han et al., 2023). Research has demonstrated that gut microbes can generate short-chain fatty acids, vitamins, active peptides, and other beneficial substances by breaking down dietary fiber and other polysaccharides that are challenging for the body to utilize (Pérez-Jiménez, 2024). The normal intestinal flora fights pathogenic microorganisms through competition and inhibition, thereby maintaining the microecological balance in the intestine and preventing the invasion of pathogens (Horrocks et al., 2023). At the genus level, the relative abundance of Subdoligranulum in the duck cecum was lower in the 8% group compared to the other groups. Subdoligranulum is a butyric acid-producing bacterium, but it is also a risk factor for gastrointestinal diseases and immunity (Upadhyay and Littman, 2022). Barnesiella participates in the metabolism of dietary fiber in the intestines, producing short-chain fatty acids, which contributes to intestinal and body health (Koh et al., 2016). In our study, the relative abundance of Barnesiella in the 8% group increased. Additionally, this trend of change was in line with the level of propanoic acid. Study showed that Barnesiella participates in the metabolism of dietary fiber in the intestines, producing short-chain fatty acids, which contributes to intestinal and body health (Koh et al., 2016).

Our study indicates that the meat flavor is related to gut microbiota, which has been proved by researchers (Ruan et al., 2024). The study indicated that the relative abundance of UCG-010_unclassified within the gut microbiota was closely associated with the production of nonanal, (E, E)-2,4-nonadienal, total aldehydes, and inosine monophosphate in pork. According to Liu et al. (2023), this association helped to increase the pork flavor. In this experiment, the differences in gut microbiota composition may be significant factors influencing the variation in duck meat flavor, and this needs to be further explored.

Conclusion

In conclusion, duck dietary with 6% Artemisia argyi powder could improve intestinal morphology and microbiota without affecting growth performance. Dietary application with 8% Artemisia argyi decreased breast muscle shear force, increased flavor compounds, such as 1-octen-3-ol, Hexanol, Heptanal, 2-butanone, 2-pentanone, 2-heptanone. At the same time, the intestinal morphology and the expression of genes related to intestinal barrier were up regulated. Furthermore, dietary with 8% AAP reshaped the cecum microbiota and the Genera Barnesiella and Bilophila may influence the formation of volatile flavor compounds in duck breast muscle. This study, by using different doses of AAP in duck feed to explore the effects of AAP on the growth, intestines, and meat quality of meat ducks, also provides a certain reference for further exploration of the application of herbal feed additives in meat duck farming. In addition, in the future we may also consider using fermentation technology to further utilize the fibers in argyi that are difficult to digest and absorb, while improving the palatability of AAP. This would make it more efficient in improving the current situation in animal husbandry.

Data availability

The raw data of this project have been deposited in the National Center for Biotechnology Information (NCBI) database (accession number: PRJNA1367222).

Fundings

This work was supported by the National Natural Science Foundation of China (32002219) and Zhejiang Science and Technology Major Program on Agricultural New Variety Breeding (2021C02068-10).

CRediT authorship contribution statement

Cheng Liu: Writing – original draft, Investigation, Formal analysis, Data curation, Conceptualization. Ran Zhang: Software, Methodology, Investigation, Formal analysis, Data curation. Chunlong Jin: Supervision, Resources, Investigation. Enhai Liu: Resources, Investigation, Formal analysis. Peishi Feng: Validation, Funding acquisition. Jiakang Ding: Investigation, Data curation. Ye Yang: Methodology. Shuangshuang Zhai: Writing – review & editing, Validation, Supervision, Funding acquisition, Conceptualization.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.