Skip to main content
NCBI home page
BMC Microbiology logoLink to BMC Microbiology
. 2026 Feb 27;26:305. doi: 10.1186/s12866-026-04835-w

Analysis of mobile genetic elements carrying mcr genes in clinical Leclercia spp. isolates

Dayong Chen 1,2,#, Ting Xie 2,#, Minghui Liu 2, Dongsheng Zhou 2, Hongning Wang 1,3, Lijun Zeng 4,✉, Zhe Yin 2,✉
PMCID: PMC13049778  PMID: 41761076

Abstract

Background

Leclercia adecarboxylata is an emerging clinical pathogen within the Enterobacteriaceae family and causes infections in immunocompromised and immunocompetent patients. It frequently exhibits resistance to a broad spectrum of β-lactams as well as to colistin, which is a last-resort antibiotic against multidrug-resistant Gram-negative bacteria. The global spread of mcr genes poses a serious public health concern. This study aimed to examine the prevalence and genetic contexts of mcr genes in clinical Leclercia spp. isolates from China.

Results

This study identified three mobile colistin resistance genes, namely, mcr-9.1, mcr-9.2, and a novel variant mcr-11.1, among 11 clinical Leclercia isolates. Some of these isolates were assigned to two novel species: Leclercia sp. LecN1 and Leclercia sp. LecN2. mcr-11.1 showed the highest sequence similarity to mcr-9.1 and was located within two novel chromosomal integrative mobile elements (IMEs): Tn6572 and Tn6573. mcr-9.1 was carried by a chromosomally located Tn7-family/Tn6230-subfamily transposon (Tn6574) and by three IncHI2 plasmids: p707804-mcr, p1106151-mcr, and pJ807-mcr. Meanwhile, mcr-9.2 was identified in plasmid pP10164-2. These mcr genes showed diverse local genetic contexts, including mcr-11.1–wbuC–qseCB in Tn6573-family IMEs as well as IS903B–mcr-9.1–wbuC–qseCB–exeA–int–IS26 and its variants within the Tn6230-related regions of Tn6574 and IncHI2 plasmids. Tn1696-related regions carried multiple mobile genetic elements (MGEs), further facilitating the dissemination of various antibiotic resistance genes (ARGs).

Conclusions

In clinical Leclercia spp. isolates, this study identified a novel colistin resistance gene (mcr-11.1), three novel chromosomal MGEs (including Tn6572–Tn6574), as well as evidence for two new putative species. Along with four identified plasmids, these chromosomal MGEs demonstrated diverse mcr genetic contexts and suggested great potentials for the dissemination of ARGs. This study highlighted a concerning mechanism for mcr gene transfer, providing an urgent indication for ongoing resistance surveillance.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-026-04835-w.

Keywords: Colistin, Mcr-11.1, ARG, Plasmid, Leclercia

Background

Leclercia spp. within the Enterobacteriaceae family are divided into four species: Leclercia adecarboxylata, Leclercia barmai, Leclercia pneumoniae, and Leclercia tamurae. In particular, L. adecarboxylata has recently emerged as a clinically significant gram-negative pathogen [1–4] that causes infections in immunocompromised and immunocompetent patients [2, 5–8]. Furthermore, it demonstrates resistance to third-generation cephalosporins and carbapenems through the acquisition of antibiotic resistance genes (ARGs), such as blaNDM [9], blaVIM [10], blaOXA [11], and blaIMP [12]. Notably, colistin resistance genes (mcrs) in these pathogens have drawn considerable attention [13–15].

Polymyxins, which are cationic cyclic polypeptides, were first isolated in 1947 from Bacillus polymyxa [16]. Among them, colistin (originally termed polymyxin E) served as a “last-resort” antibiotic for multidrug-resistant Gram-negative pathogens [17]. However, colistin-resistant strains had recently emerged globally [18, 19], critically driven by mcr-carrying mobile genetic elements (MGEs) [20]. Since the first mcr gene (mcr-1) was reported [6] in 2016, mcr genes (including mcr-1 to mcr-10 and numerous variants) had been isolated from humans, animals, food, and environmental sources worldwide [21, 22].

Notably, the dissemination and proliferation of mcr genes constitute an escalating global challenge in antimicrobial resistance. Despite the extensive identification and characterization of mcr genes, their prevalence and spread warrant continued surveillance and investigation. In this study, we performed genome sequencing on 11 Leclercia strains isolated from clinical specimens in China (2013–2018). Furthermore, we investigated the mcr subtype genes and mcr-carrying MGEs, revealing the prevalence of mcr genes in this genus and delineating the MGE-mediated transmission within Leclercia spp.

Materials and methods

Bacterial strains

The bacterial strains used in this study (16005813, P12375, P10164, 707804, G426, L21, J656, 1106151, J807, 119287, and 29361) were obtained from collaborating hospitals in Ningbo, Beijing, Nanjing, Chongqing, Guangzhou, and Changsha. These isolates had been collected and anonymized between 2013 and 2018 (Supplementary Table 1). Complete 16 S rRNA sequences of the 11 isolated strains were obtained via polymerase chain reaction with primers 27 F/1492R and determined via Sanger sequencing, following a previously described method [23]. The sequences were compared with those of other species using the Basic Local Alignment Search Tool. The standard strain utilized in the experiments was Escherichia coli ATCC 25,922, which had been preserved in the laboratory and used as the control for antimicrobial susceptibility testing (AST). E. coli TOP10 and E. coli EC600 were used as recipient strains for transformation and conjugal transfer, respectively.

Sequencing and sequence assembly

Bacterial genomic DNA was extracted using the QIAGEN DNeasy UltraClean Microbial Kit (CAT# 12224-250, Qiagen, Germany). Based on previous studies [24, 25], sequencing was performed on an Illumina HiSeq 2500 platform using a mate-pair library averaging 400-bp inserts, an Illumina MiSeq sequencer using a mate-pair library averaging 5-kb inserts, and a PacBio RSII sequencer using a sheared library averaging 15-kb inserts. Illumina paired-end reads were applied to correct PacBio long reads using proovread [26]. Assembly was performed using SMARTdenovo (https://github.com/ruanjue/smartdenovo) and corrected using paired-end data. Plasmid-derived clean reads were filtered with Trimmomatic 0.36 and assembled using Newbler 2.6.

Sequence annotation and MGE analysis

RAST 2.0 [27], UniProtKB/Swiss-Prot [28], RefSeq [29], ResFinder [30], CARD [31], DANMEL [32], BacMet [33], ISfinder [34], INTEGRALL [35], ICEfinder, and the Tn Number Registry (https://transposon.lstmed.ac.uk/tn-registry) [36] were used for gene annotation and identification of MGEs and other features. Muscle 3.8.3 [37] and BLASTP/BLASTN were used for multiple and pairwise sequence comparisons, respectively. Inkscape 0.48.1 was used to generate graphical representations, including structural comparisons of ARGs, ISs, Ins, Tns, and multiple regions within plasmids. Sequence files in sqn and gbk formats were prepared using Sequin and submitted to GenBank via BankIt (plasmids) and the genome submission system (chromosomes) to obtain accession numbers.

Phylogenetic analysis

As previously described [38], phylogenetic trees were reconstructed based on whole-genome SNP alignments using the maximum-likelihood algorithm. Briefly, the genomic sequences from the obtained strains were aligned using MUMmer 3.0 [39], and recombination-associated SNP were filtered using ClonalFrameML [40]. The maximum-likelihood tree for strains was based on recombination-free SNPs. For phylogenetic reconstruction of mcr genes, nucleotide sequences were retrieved from ResFinder 4.1 and GenBank (accession numbers listed behind the species names). Multiple sequence alignment for mcr genes was performed using ClustalW (https://www.genome.jp/tools-bin/clustalw) and visualized using GeneDoc 3.2. Furthermore, maximum-likelihood trees were constructed using MEGA 7.0.26 in bootstrap of 1,000 replicates and further annotated using iTOL v6.7.1 (https://itol.embl.de/). The average nucleotide identity (ANI) values between all pairs of strains were calculated using FastANI (v1.34, default parameters) and subsequently visualized as a heatmap using Hiplot (https://hiplot.com.cn). Conserved domains and motifs were analyzed using CD Search (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and the MEME Suite (https://meme-suite.org), respectively, with visualization performed in TBtools.

Conjugal transfer

Conjugal transfer was performed as previously described [41], with slight modifications. In brief, the tetracycline-resistant wild-type strain 1,106,151 (donor, MIC ≥ 32 µg/mL) and rifampicin-resistant E. coli EC600 (recipient) were cultured overnight. Donor and recipient cultures (3 mL each) were mixed, pelleted via centrifugation (3000 g) at 4 °C for 5 min, and then resuspended in 80-µL Brain Heart Infusion (BHI) Broth (CAT# 237500, BD, USA). The suspension was applied onto a hydrophilic nylon membrane with a 0.45-µm pore size (1 cm²) (CAT# HAWP04700, Millipore, Germany) and then placed on BHI agar and incubated for mating at 22 °C for 24 h. Subsequently, the bacteria were removed from the filter membrane and cultured on a BHI agar plate containing 20-µg/mL tetracycline and 50-µg/mL rifampicin to screen E. coli transconjugants (p1106151-mcr-EC600), which harbored mcr-9.1.

Reconstruction of mcr-carrying E. coli TOP10

Based on a previous study [41], mcr coding regions alongside upstream promoter and downstream terminator regions from strains 707,804, P10164, and J656 were synthesized and cloned into pUC18 vectors, respectively. Then, the reconstructed pUC18-mcr-9.1, pUC18-mcr-9.2, and pUC18-mcr-11.1 vectors were separately introduced into E. coli TOP10 by electroporation, respectively. The transformants were cultured on brain heart infusion (BHI) agar plates supplemented with 100 µg/mL ampicillin for screening. Finally, the reconstructed pUC18-mcr-9.1-TOP10, pUC18-mcr-9.2-TOP10, and pUC18-mcr-11.1-TOP10 along with strains 1,106,151, p1106151-mcr-EC600, L21, 707,804, G426, J656, EC600, and TOP10 were utilized for colistin MIC determination.

Profiling of antimicrobial susceptibility

AST for isolated strains was performed using Vitek 2 Compact (bioMérieux, France) with the antibiotic susceptibility cards according to the manufacturer’s protocols [42]. Furthermore, colistin MIC was determined by broth microdilution as recommended by the Clinical and Laboratory Standards Institute (CLSI) [43]. Susceptibility categories were assigned in compliance with the guidelines of European Committee on Antimicrobial Susceptibility Testing (EUCAST) 2024 (http://www.eucast.org/).

Nucleotide sequence accession numbers

Complete genome sequences of strains 16,005,813, P12375, P10164, 707,804, G426, L21, J656 1,106,151, J807, 119,287, and 29,361 were submitted to GenBank under accession numbers CP036199, CP046251, JAEFHR000000000, CP049980, CP043398, CP043397, CP042930, CP046557, CP046446, CP046445, and CP049786, respectively. The accession numbers of the plasmids analyzed in this study are presented in Supplementary Table 2.

Results

Identification of 11 isolates

A total of 11 Leclercia spp. isolates were identified and isolated from diverse clinical samples (secretions, sterile body fluids, urine, and tissues) collected from patients aged 1–67 years old who were diagnosed with pulmonary infections, fever of unknown origin, diabetes, gastric cancer, and trauma. For these isolates, 16 S rRNA sequence analysis revealed that seven isolates (16005813, P12375, P10164, 707804, G426, L21, and J656) exhibited ≥ 95% nucleotide identity with L. adecarboxylata reference strain (USDA-ARS-USMARC-60222), whereas four others (119287, 29361, 1106151, and J807) demonstrated high identity with other Leclercia spp. As of July 17, 2025, 32 complete genomes from Leclercia spp. were collected from GenBank, with the genome of Enterobacter cloacae ATCC 13,407 included as an outgroup. According to the maximum-likelihood tree topology (Fig. 1a) and clustering pattern of comparatively high ANI values among Leclercia strains (Fig. 1b), five clusters of proximal clades were identified and designated as Groups I–V.

Fig. 1.

Fig. 1

Open in a new tab

Whole-genome ANI and phylogenetic analysis of 11 Leclercia isolates. a Maximum-likelihood phylogenetic tree based on recombination-filtered SNPs from whole-genome sequences. Strains isolated in this study are colored in red and marked with #; asterisks (*) denote Leclercia reference strains. Evolutionary groups I–V are color-coded. The respective accession numbers are added behind the strain names. The tree is drawn to scale, with the scale bar indicating the number of nucleotide substitutions per site. Bootstrap support values (from 1000 replicates) greater than 70% are shown on the branches. b Pairwise ANI heatmap. Colors indicate ANI values from 85% (blue) to 100% (red). High-similarity regions correspond to groups I–V

Groups I and II shared intra-group ANI values ≥ 98.45% and ≥ 93.59%, respectively. Group III, which contained strains J807 and 1,106,151, showed inter-strain ANI values ≥ 96.28%, exceeding the species delineation threshold (ANI 95%). In Group IV, strain 29,361 clustered with L. tamurae reference strain H6S3 (ANI 96.82%), whereas 119,287 alongside five others formed another cluster with inter-strain ANI values ≥ 98.31%. Group V comprised seven strains (16005813, P12375, P10164, 707804, G426, L21, and J656) that clustered with L. adecarboxylata reference strain 60,222 (USDA-ARS-USMARC-60222), with pairwise ANI values ≥ 98.07%. Consequently, strains J807 and 1,106,151 represented a novel Leclercia species; strain 119,287, a second novel species, strain 29,361, L. tamurae; and the remaining seven strains, L. adecarboxylata.

Identification of mcr genes from Leclercia isolates

In this study, mcr-9.1 was identified in strains 707,804, L21, 1,106,151, and J807, whereas mcr-9.2 was detected in strain P10164. Notably, a novel mcr gene named mcr-11.1 was identified in strains J656 and G426, which demonstrated a significant homology with mcr-9.1, sharing 100% coverage and 91% identity in nucleotide sequence as well as 100% coverage and 93% identity in amino acid sequence. Multiple sequence alignment of MCR-1.1 to MCR-11.1 showed that MCR-11.1 shared conserved amino acid residues with other mcr subtypes or variants (Supplementary Fig. 1). MCR-11.1 shared motifs 1–10 with MCR-3.1, -4.1, -7.1, -9.1, -9.2, and − 10.1, demonstrating their strong structural similarity (Supplementary Fig. 2). Although certain motifs were absent (Motifs 6, 8, 9, 10) or duplicated (Motif 5) in some MCR proteins, Motifs 1, 2, 3, 4, 5, and 7 were retained across all variants. Domain analysis further confirmed the conservation, with MCR-11.1 containing both Sulfatase and EptA_B_N domains. The presence of the EptA_B_N domain indicated potential phosphoethanolamine transferase activity in MCR-11.1. Furthermore, the phylogenetic topology (Fig. 2) indicated that mcr-11.1 formed a separate branch adjacent to the mcr-9 cluster and demonstrated recent divergence with the mcr-9 subtypes and variants, potentially originating from a common ancestor. Within the mcr family, ancestral clustering patterns resolved three primary evolutionary clades: (i) mcr-1, mcr-2, mcr-5, and mcr-6, (ii) mcr-4 and mcr-8, and (iii) mcr-3, mcr-7, mcr-9, mcr-10, and mcr-11.

Fig. 2.

Fig. 2

Open in a new tab

Phylogenetic analysis of mcr subtypes or variants. The evolutionary relationship is inferred using the Maximum Likelihood method based on nucleotide sequences. The tree is drawn to scale, with the scale bar indicating the number of nucleotide substitutions per site. Bootstrap support values (from 1000 replicates) greater than 70% are shown on the branches. The different clades are color-coded and labeled (mcr-1 to 11). The respective accession numbers are added behind the gene names

Mcr-carrying MGEs from Leclercia isolates

The annotation and analysis of MGEs in the 11 Leclercia strains are presented in Supplementary File and Table 1. For chromosomal MGEs, two novel mcr-11.1-carrying IMEs, namely, Tn6572 (NZ_CP043398) and Tn6573 (NZ_CP042930), were chromosomally integrated into strains G426 and J656, respectively. A novel transposon carrying mcr-9.1 was also identified in strain L21, named Tn6574 (CP043397). For plasmids from these Leclercia isolates, mcr-9.1 was detected in plasmids p707804-mcr, p1106151-mcr, and p807-mcr, whereas mcr-9.2 was identified in pP10164-2. The collection of 16 IncHI2 plasmids included 10 from this study, 4 reported previously (namely pP10164-2 [43], pT5282-mphA [44], p505108-MDR [45], and p112298-catA [46]), and published plasmids pIMPIncHI2_334kb and R478 (Supplementary Table 2). Accordingly, two IMEs (Tn6572 and Tn6573), seven transposons (Supplementary Table 3), and the 16 IncHI2 plasmids from multiple bacterial genera were further included for genomic comparison.

Structural comparison of chromosomal IMEs Tn6572 and Tn6573

Tn6572 (27.6 kb) and Tn6573 (32.7 kb) were inserted at the same site within a gap between the genes encoding imidazolonepropionase and acyl-CoA thioesterase. They contained the same attL/R, int, vapC/B, as well as the mcr-11.1–wbuC-qseC–qseB structure and an arn operon (arnBCADTEF) (Fig. 3). In addition, Tn6573 carried an extra region of approximately 7 kb (containing a 1905-bp integrase gene adjacent to the 5′-end int), which was lacking in Tn6572. Tn6572 featured a 1,245-bp ISEc52 insertion that truncated downstream orf1737, and a ISsen4 insertion at its 3′-end within the element. Tn6572 and Tn6573 shared an identical linear structure (mcr-11.1–wbuC–qseC–qseB). The wbuC–qseC–qseB was a common structure found in the genetic contexts of mcr genes [47], in which the qseBC system regulated mcr expression [48]. Based on their similarities and the more complete structure of Tn6573, we defined them as novel family members of integrative mobilizable elements, designated Tn6573-family IMEs.

Fig. 3.

Fig. 3

Open in a new tab

Structural comparison of Tn6573-family IMEs Tn6572 and Tn6573. Genetic structures of Tn6572 and Tn6573 are analyzed, with genes denoted by arrows. A triangle (Δ) indicates truncated genes. Insertion sequence (IS) elements are highlighted in color based on their family classification. Green shading denotes regions of homology (> 95% nucleotide identity). Relevant regions are labeled adjacent to each corresponding segment

Structure analysis of Tn6230-like transposons

Tn6230-like transposons from this study (Tn6574) and GenBank (Tn6592, Tn6594, Tn6730, Tn6725, and Tn6593) shared identical direct repeats (DRs: GCTGC) and terminal inverted repeats (IRL: TGTCCGAAGACAATAAAGTTGT; IRR: TGTACACAGACATTAAAGTTGT) with the prototype Tn6230 (Supplementary Table 4). Their genetic structures were also highly conserved (Fig. 4), retaining the core tnsABCD transposition modules and characteristic metal resistance regions that defined the Tn7-family/Tn6230 subfamily [49]. Except Tn6230, large accessory regions (LARs; 9.9–91.7 kb) within these Tn6230-subfamily transposons were characterized by a local mcr genetic environment and multiple insertion sequences (ISs).

Fig. 4.

Fig. 4

Open in a new tab

Comparative analysis of Tn6230-related regions from Tn7-family/ Tn6230-subfamily transposons. Genetic structures of Tn6230-related regions from seven Tn7-family/Tn6230-subfamily transposons (Tn6230 as reference) are analyzed, with genes denoted by arrows. A triangle (Δ) indicates truncated genes. Insertion sequence (IS) elements are highlighted in color based on their family classification. Green shading denotes regions of homology (> 95% nucleotide identity). Relevant regions are labeled adjacent to each corresponding segment

LARTn6574 mainly featured ISKpn26, ΔISPpu12, ISLad6, and the novel Tn3-family/Tn21-subfamily transposon Tn6570. Tn6570 carried a core tnpA/R–res transposition module and a mer locus, with its IRL/IRR interrupted by IS4321R insertion (Supplementary Fig. 3).

LARTn6730 featured IS26, ISEsa2, ISKpn26, two ISLad6 variants, two novel elements ISSen9 and ISSen10, an 8.7-kb genomic region homologous to the genetic region from Marine bacillus (CP014754), and toxin–antitoxin modules (hipA/B and relE/B) (Supplementary Fig. 3).

LARTn6594 mainly contained ΔISPpu12, ΔISPa38b, Tn6595, Tn512b, ΔTn6570, various ISs, and a 25.4-kb region (Supplementary Fig. 3). ∆Tn6570 retained the mer region and urf2Y from its prototype Tn6570. The Tn5053-family transposon Tn512b possessed a conserved backbone (tniA–tniB–tniQ–res–tniR) alongside an additional mer region.

LARTn6593 mainly contained a residual Tn5058b-related element, ΔISPa38, Tn5393a, ISKpn26, Tn6535, and backbone-derived genes hipA/B and ΔuvrD2 from IncHI2 plasmids (Supplementary Fig. 4).

Meanwhile, LAR-1Tn6725 contained IS1R and a mcr-9 genetic context (Supplementary Fig. 5). LAR-2Tn6725 consisted of IS26, IS1071, ΔISPps1, ΔISPpu12, ISPa38b, ΔISPa38b, and a 13-kb region (Supplementary Fig. 6).

LARTn6592 showed the simple structure, featuring ISLad6 and two copies of IS1R. (Supplementary Fig. 5).

Structural analysis of backbones and accessory regions in 16 IncHI2 plasmids

A total of 16 fully sequenced, circular IncHI2 plasmids (p12949-HI2, p30860-HI2, p13E573-HI2, p29361-IMP, p707804-mcr, p1106151-mcr, pJ807-mcr, pD610-HI2, pN1863-HI2, p525011-HI2, pP10164-2, pT5282-mphA, p505108-MDR, p112298-catA, pIMPIncHI2_334kb, and R478) shared a conserved backbone containing the IncHI2-specific replicons repHI2A and repHI2C, conjugation-associated loci tra1 and tra2, and diverse accessory modules inserted at different sites. Compared with R478 (Supplementary Fig. 7), the backbones of the remaining plasmids exhibited high nucleotide sequence identity (≥ 95%), except for some modules derived from other IncHI2 plasmids. The accessory modules were mainly confined to 18 genomic insertion hotspots (Supplementary Fig. 8). The IS903B/Tn7063 insertion was commonly observed in the parB2-htdA region across most plasmids, whereas ISLad7/ISLad7-related modules were inserted in the arsC–to–orf318 region. The insertions of accessory modules within the uvrD2–orf432, orf1389–orf609, orf159–orf819, relB/E, and orf2385 regions mostly caused structural disruption and led to massive gene acquisition and loss, particularly the orf159–orf819/uvrD2–orf432 and the orf1389–orf609 regions by the insertions of Tn6230- and Tn1696-related regions, respectively.

Tn6230-related regions from IncHI2 plasmids

Tn6230 (37 kb) was first described in 2014 and has been identified in chromosomes and plasmids across numerous bacterial species [49]. Tn6230 in plasmids R478 (as reference) contained intact core modules (tnsABCD) and a complete sil–cop region. Among the 16 IncHI2 plasmids analyzed, 13 carried Tn6230-related regions (Fig. 5) and 10 harbored mcr-9.1 or mcr-9.2 (Supplementary Table 2). while the prototype Tn6230 was intact, related regions in other plasmids frequently showed truncations (Fig. 5), including 172-bp tnsA remnants, ∆cop–rcn–orf168 segments, and the remnants of the sil–cop region. Most identified mcr regions were located within these Tn6230-related regions, and additional resistance modules were co-located including:

Fig. 5.

Fig. 5

Open in a new tab

Comparative analysis of Tn6230-related regions from IncHI2 plasmids. Genetic structures of Tn6230-related regions from 13 IncHI2 plasmids (R478 as reference) are analyzed, with genes denoted by arrows. A triangle (Δ) indicates truncated genes or others. Genes, mobile genetic elements, and other features are colored based on function classification. Direct and inverted homologous regions (> 95% nucleotide identity) are highlighted in green and pink, respectively. Relevant regions are labeled adjacent to each corresponding segment

  1. IS26-bounded units
    1. An IS26–catA2–IS26 unit from Region I of pIMPIncHI2_334kb and pJ807-mcr
    2. An IS26–tetA(D)–IS26 unit from Region I of p1106151-mcr
    3. An IS26–blaSHV-12–IS26 unit found in Region II of pIMPIncHI2_334kb, pJ807-mcr and p1106151-mcr
  2. ISCR1-associated units
    1. A ΔISCR1–qnrB4–ampC unit and an ISCR1–dfrA18 unit in Region II of pIMPIncHI2_334kb and pJ807-mcr
    2. An ΔISCR1–dfrA18 unit in p505108-MDR
  3. Tn-related modules
    1. A ΔTn2 carrying blaTEM-1 from p30860-HI2
    2. A ΔTn5393c carrying strA/B in pIMPIncHI2_334kb, pJ807-mcr and p505108-MDR
    3. An In705–ΔTn2670–Tn6322 carrying aadA1a and catA1 in pP10164-2
  4. a novel IS-mediated transposition unit Tn7064
    1. Tn7064 in p1106151-mcr harbored arr7 and aacC3
    2. Tn7064 was inserted into ereA2 and flanked by 5-bp DR sequences.

Tn1696-related regions from 14 IncHI2 plasmids

Five novel transposons (Tn6362b and Tn6802–Tn6805), two published transposons (Tn6362a and Tn6321), and four associated regions (MDRp707804−mcr, mer–IS26, MDRpIMPIncHI2_334kb, and catA1–aphA1) were identified from 14 IncHI2 plasmids. These elements or regions were Tn1696-like derivatives characterized by an IRL–tnpA–tnpR–res–mer–IRR structure disrupted by In4 integration at the res site (Fig. 6). Tn6804, Tn6321, Tn6805, Tn6803, and Tn6802 differed from the prototype Tn1696 in three major aspects:

Fig. 6.

Fig. 6

Open in a new tab

Comparative analysis of Tn1696-related regions from IncHI2 plasmids. Genetic structures of Tn6230-related regions from 13 IncHI2 plasmids (R478 as reference) are analyzed, with genes denoted by arrows. A triangle (Δ) indicates truncated genes or others. Genes, mobile genetic elements, and other features are colored based on function classification. Direct and inverted homologous regions (> 95% nucleotide identity) are highlighted in green and pink, respectively. Relevant regions are labeled adjacent to each corresponding segment

  1. Each carried a distinct class 1 integron (In252, In844, In37p29361-IMP, In714Tn6803, or In714Tn6802) in place of the prototype's In4.

  2. Tn6802 and Tn6803 each contained an additional Tn1548-related region with lengths of 36.1 and 50.7 kb, respectively.

  3. An IS4321R insertion fragmented the IRL in Tn6321, Tn6805, Tn6803, and Tn6802.

The catA1–aphA7 region in R478 (Fig. 6) featured a ΔTn1696 and a 14.3-kb region. The region comprised an IS26-composite transposon (Tn6780, formerly Tn6322, carrying catA1), an IS26–aphA7–IS26 resistance module, an In4 remnant, and two additional IS26 copies. In p707804-mcr, the mer–IS26 region contained an IRL–tnpA–tnpR–res–mer–IRR structure disrupted by IS26 insertions, while the MDR region comprised Tn1696 remnants, IS elements, integrons, and other truncated modules.

The integrons In844 (in Tn6321) and In714 (in Tn6803/Tn6802) each carried single resistance cassettes (aadA16–aacA3–gcu55 and gcu50–dfrA1b–gcu37–aadA5, respectively), contrasting with the In252 (in Tn6804) which harbored a VR1 (containing aadB–catB8–blaOXA-10–aadA1a) and two VR2 copies (containing ISCR1–dhfr units) (Fig. 6).

In37p707804−mcr and In37p29361−IMP carried blaNDM−1 and blaIMP−4, respectively, and exhibited two structural differences (Supplementary Fig. 9):

  1. ISCR1–qnrB4–ampC in In37p29361-IMP and ISCR1–ΔISAba125–blaNDM-1–ΔTn6399–ΔISVsa5–blaOXA-1–catB3–arr3 in In37p707804-mcr.

  2. An additional 27.8-kb region carrying IS26–mph(A)–IS6100, ΔTn21, aacC2–tmrB region, and In809 in In37p29361-IMP, and a region carrying VR3 and a truncated tniTn402 module in In37p707804-mcr.

The 5′-ends of Tn1548-related regions in Tn6802 and Tn6803 were highly conserved and contained ISCR1–armA unit, ISEc29–mph(E)–IS26 unit, IS26–pdk–catA2 module, resG, ISCR2–sul2 module, and ∆IS5075 (Supplementary Fig. 10). The 3′-end of Tn6802 comprised ISCfr1, ∆Tn2, Tn5393A, and ∆Tn1721, while aacC2–tmrB region, ISCfr1, ∆Tn2, and a Tn1722 remnant were observed in the 3′-end of Tn6803.

Local mcr genetic environments

This study comparatively analyzed the local genetic contexts of mcr genes from two IMEs (Tn6572 and Tn6573), six Tn6230-subfamily transposons (Tn6574, Tn6592, Tn6594, Tn6730, Tn6593, and Tn6725), and ten mcr-carrying plasmids (Supplementary Table 2), revealing the variation patterns of these mcr-bearing regions (Fig. 7). A putative prototype structure (IS903B–mcr-9.1–wbuC–qseC–qseB–exeA–int–IS26) was identified and found to be completely preserved in Tn6574, Tn6730, and Tn6593. Further analysis demonstrated that the activity of IS elements potentially served as the primary driver of structural diversification. The insertion of IS4321 within the exeA gene in Tn6594 caused local rearrangement. The insertion of IS1R upstream of mcr-9.1 in Tn6592 led to gene truncation. In three IncHI2 plasmids (p707804-mcr, pT5282-mphA, and pN1863-HI2), the replacement of the prototype’s terminal IS26 by IS1R was accompanied by the loss of the exeA–int segment. Furthermore, a truncated structure, IS903B–mcr-9.1–wbuC–IS26, was commonly observed across six IncHI2 plasmids (p1106151-mcr, p525011-HI2, pD610-HI2, pJ807-mcr, p505108-MDR, and pIMPIncHI2_334kb). A similar truncation was present in Tn6725, where the 3′-terminal IS26 was replaced by ISEsp1. Other variants included the mcr-9.2 flanked by IS903B and IS1R in plasmid pP10164-2, and the local genetic context (mcr-11.1–wbuC–qseB–qseC) without typical flanking IS elements in Tn6572 and Tn6573. These results systematically elucidated the IS-mediated diversification of mcr genetic contexts.

Fig. 7.

Fig. 7

Open in a new tab

Comparative analysis of local mcr genetic environment. The local mcr genetic environments of two Tn6573-family integrative mobile elements (IMEs), six Tn7 family/Tn6230-subfamily transposons, and ten IncHI2 plasmids are illustrated, with genes denoted by arrows. A triangle (Δ) indicates truncated genes or others. Genes, mobile genetic elements, and other features are colored based on function classification. Homologous regions sharing > 95% nucleotide identity are indicated in green, while those with 90–95% identity are highlighted in pink. Relevant regions are labeled adjacent to each corresponding segment

Conjugation, gene cloning, and antimicrobial susceptibility

The antimicrobial susceptibility of isolated strains, except for colistin, was presented in Supplementary Fig. 11. It indicated that MEM, AK, F, and SXT were generally effective antibiotics for most Leclercia isolates, whereas AMP, SAM, PIP, CFZ, CXM, CAZ, CRO, and ATM were largely inactive against them. In particular, strains L21 and J656 demonstrated susceptibility to most tested antibiotics, whereas P10164 showed resistance.

To evaluate the susceptibility of colistin, the transconjugant p1106151-mcr-EC600 (carrying mcr-9.1) was obtained and validated based on antibiotic resistance profiles, which reflected those of wild-type strains against penicillin, cephalosporins, aztreonam, and gentamicin, among others. Contrarily, the recipient strain EC600 (negative control) remained susceptible to most tested antibiotics (Supplementary Table 5). Furthermore, the colistin susceptibility across transconjugants, recombinant strains, negative controls (EC600 and TOP10), and wild-type strains (1106151, L21, 707804, P10164, G426, and J656) was evaluated. All strains showed susceptibility to colistin (MIC ≤ 0.5 µg/mL), with values well below the EUCAST-defined resistance breakpoint of 4 µg/mL (http://www.eucast.org/).

Discussion

In this study, 11 clinical Leclercia strains from 2013 to 2018 in China were isolated and analyzed. Based on existing species classification, seven strains (16005813, P12375, P10164, 707804, G426, L21, and J656) and strain 29,361 in this study were classified as L. adecarboxylata and L. tamurae, respectively. Notably, two new putative Leclercia species were identified: Leclercia sp. LecN1 and LecN2. The LecN1 clade included strains from published studies (W6, w17 [50]; M17 [51]; LSNIH1 [52]), strains with genomes available in GenBank (2022CK-00320, Colony189, YZ30), and novel isolates (1106151, J807) from this work. Similarly, the LecN2 clade comprised strains from published studies (UBA6636 [53], UBA5999, R25 [54], UBA1837 [53]), the GenBank (G3L), and this study (119287). Based on phylogenetic relationships with strain J807 (ANI values ≥ 96.30%), early identified LSNIH1 [52] was proposed as the reference strain of the novel species, Leclercia sp. LecN1. Strain 119,287, sequenced and analyzed in this study, was proposed as the reference strain of another novel species, Leclercia sp. LecN2.

The novel mcr subtype (mcr-11.1), carried by two new chromosomal IMEs (Tn6572 and Tn6573), shared significant homology with mcr-9.1. Meanwhile, mcr-9.1 was located on a novel chromosomal transposon, Tn6574. These novel chromosomal MGEs might serve as structurally stable reservoirs and vehicles for mcr-9.1/11.1. Tn6573-family IMEs, Tn6572 and Tn6573, exhibited structural difference due to ISSen4 insertion and ISEc52-mediated 7-kb replacement in Tn6572. Tn6574 was a Tn7-family/Tn6230-subfamily transposon identified in strain L21. It was characterized by an mcr region and a conserved backbone (comprising attL/attR, tnsA, tnsB, tnsC, tnsD, and TnsB-binding sites), which were also found in Tn6592, Tn6594, Tn6730, Tn6593, and Tn6725. These transposons carried both mcr-9.1 and metal-resistance determinants.

Global surveillance of polymyxin resistance (1980–2018) and subsequent research indicated that IncHI2 plasmid was a predominant genetic platform for the mcr genes [44, 55–57]. All IncHI2 plasmids, except for R478, shared conserved backbone regions with R478, which comprised a total of 18 insertion hotspots. The Tn6230-related region was a critical accessory module harboring a local mcr genetic environment in plasmids and chromosomal transposons. The accessory Tn1696-related regions largely retained the tnpAR–res–mer–IRR backbones, where the integration of In252, In844, In714, and In37 has recruited multiple ARGs, particularly the blaIMP−4 and blaNDM−1 within In37p29361−IMP and In37p707804−mcr, respectively. In parallel, Tn1548-related regions introduced additional ARGs, such as armA, mph(E), catA2, and sul2.

Most of the 11 isolates were found to be susceptible to AK, SXT, F, and MEM. Notably, all strains carrying mcr-9.1, mcr-9.2, or mcr-11.1 remained susceptible to colistin (MIC ≤ 0.5 µg/mL). These strains comprised the transconjugants (p1106151-mcr-EC600) as well as the wild-type isolates (1106151, L21, 707804, P10164, G426, and J656). According to previous studies, mcr-9.1 expression was inducible under specific conditions, mediated through the activation of the QseBC two-component system by stimuli such as subinhibitory colistin [21, 48]. Otherwise, the gene remained transcriptionally silent. It indicated that qseBC and wbuC within the local mcr genetic environment were potential regulators involving in mcr gene expression. However, how specific stimuli induce the expression of mcr genes remains poorly understood. Moreover, mcr-11.1 appears to be restricted to Leclercia spp. isolates. Whether this reflects limited dissemination following horizontal gene transfer or stabilization within a specific genomic context in this genus remains to be determined. This uncertainty is compounded by the limited sample size and is further limited by the exclusively Chinese origin of the clinical strains, which may hinder a comprehensive assessment of mcr-11.1’s dissemination.

Conclusion

In this study, 11 Leclercia strains were isolated from clinical specimens collected from China and identified two putative novel species, for which we proposed the names Leclercia sp. LecN1 and Leclercia sp. LecN2. Furthermore, the newly identified mcr-11.1 and novel chromosomal MGEs (Tn6572, Tn6573, and Tn6574), along with four plasmids, have been reported. These MGEs contained diverse mcr genetic contexts, including mcr-11.1–wbuC–qseC–qseB in Tn6573-family IMEs and IS903B–mcr-9.1–wbuC–qseC–qseB–exeA–int–IS26 (and its variants) in the Tn6230-related regions of Tn6574 and IncHI2 plasmids. Tn1696-related regions integrated diverse MGEs, potentially facilitating the dissemination of numerous ARGs. This study provides insights into the resistance surveillance and potential dissemination of mcr genes.

Supplementary Information

Supplementary Material 1. (24.2MB, docx)
Supplementary Material 2. (2.5MB, zip)

Acknowledgements

All experiments and data analyses were done in Dr. Dongsheng Zhou’s laboratory.

Abbreviations

ANI

Average nucleotide identity

ARG

Antibiotic resistance genes

AST

Antimicrobial susceptibility testing

BHI

Brain Heart Infusion

MIC

Minimum inhibitory concentration

CLSI

Clinical and Laboratory Standards Institute

DR

Direct repeats

EUCAST

European Committee on Antimicrobial Susceptibility Testing

IME

Integrative mobile element

IS

Insertion sequence

LAR

Large accessory region

MGE

Mobile genetic element

MEM

Meropenem

AK

Amikacin

F

Nitrofurantoin

SXT

Trimethoprim-sulfamethoxazole

AMP

Ampicillin

SAM

Ampicillin-sulbactam

PIP

Piperacillin

CFZ

Cefazolin

CXM

Cefuroxime

CAZ

Ceftazidime

CRO

Ceftriaxone

ATM

Aztreonam

Authors’ contributions

DC and TX: Formal analysis, Visualization, Validation, Writing, and review & editing. ML: Investigation and Validation. DZ: review & editing. HW: Supervision.LZ: Formal analysis and Validation. ZY: Validation, Conceptualization, Project administration, Supervision, Funding acquisition, and review & editing.

Funding

This work was supported by National Key Research and Development Program of China (Grant no: 2023YFC2605600).

Data availability

The complete genome sequences generated and analyzed in this study are available in the GenBank database under accession numbers CP036199, CP046251, JAEFHR000000000, CP049980, CP043398, CP043397, CP042930, CP046557, CP046446, CP046445, and CP049786. The accession numbers for plasmids are listed in Supplementary Table 2.

Declarations

Ethics approval and consent to participate

This study utilized bacterial isolates (16005813, P12375, P10164, 707804, G426, L21, J656, 1106151, J807, 119287, and 29361) from anonymized clinical specimens collected during routine diagnostic procedures at public hospitals in China between 2013 and 2018. No human subjects, tissues, or identifiable personal data were involved. Secondary analysis of these anonymized specimens was exempt from ethical approval. All procedures with pathogenic microorganisms were approved by the Biosafety Committee of the Academy of Military Medical Sciences.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Dayong Chen and Ting Xie contributed equally to this work.

Contributor Information

Lijun Zeng, Email: 616do@sina.com.

Zhe Yin, Email: jerry9yin@163.com.

References

  • 1.Adapa S, et al. Peritonitis from leclercia adecarboxylata: an emerging pathogen. Clin Case Rep. 2019;7(4):829–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Broderick A, et al. Leclercia adecarboxylata folliculitis in a healthy swimmer-An emerging aquatic pathogen? JAAD Case Rep. 2019;5(8):706–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Barrios-Villa E, et al. Genomic insights of leclercia adecarboxylata strains linked to an outbreak in public hospitals in Mexico. Genes Genomics. 2023;45(5):569–79. [DOI] [PubMed] [Google Scholar]
  • 4.Sano E, et al. Genomic analysis of fluoroquinolone-resistant leclercia adecarboxylata carrying the ISKpn19- orf- qnrS1-∆IS3-blaLAP-2 module in a synanthropic pigeon, Brazil. J Global Antimicrob Resist. 2023;33:256–9. [DOI] [PubMed] [Google Scholar]
  • 5.Matsuura H, Sugiyama S. Sepsis and leclercia adecarboxylata. Qjm-an Int J Med. 2018;111(10):733–4. [DOI] [PubMed] [Google Scholar]
  • 6.Liu Y-Y, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in china: a Microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161–8. [DOI] [PubMed] [Google Scholar]
  • 7.Spiegelhauer MR, et al. Leclercia adecarboxylata: a case report and literature review of 74 cases demonstrating its pathogenicity in immunocompromised patients. Infect Dis. 2019;51(3):179–88. [DOI] [PubMed] [Google Scholar]
  • 8.Mayfield CK, et al. Post-operative orthopedic infection with monomicrobial leclercia adecarboxylata: A case report and review of the literature. JBJS Case Connect. 2019;9(3):e0297–0297. [DOI] [PubMed] [Google Scholar]
  • 9.Riazzo C, et al. First report of NDM-1-producing clinical isolate of leclercia adecarboxylata in Spain. Diagn Microbiol Infect Dis. 2017;88(3):268–70. [DOI] [PubMed] [Google Scholar]
  • 10.Papousek I et al. Complete nucleotide sequences of two VIM-1-Encoding plasmids from Klebsiella pneumoniae and leclercia adecarboxylata isolates of Czech origin. Antimicrob Agents Chemother. 2017;61(5):e02648-16. 10.1128/aac.02648-16. [DOI] [PMC free article] [PubMed]
  • 11.Arabaci C, et al. Investigation of carbapenemase and mcr-1 genes in carbapenem-resistant Klebsiella pneumoniae isolates. J Infect Developing Ctries. 2019;13(6):504–9. [DOI] [PubMed] [Google Scholar]
  • 12.Yin Z et al. First report of coexistence of three different MDR plasmids, and that of occurrence of IMP-Encoding plasmid in leclercia adecarboxylata. Front Microbiol. 2019;10:2468. 10.3389/fmicb.2019.02468. [DOI] [PMC free article] [PubMed]
  • 13.Sun Q et al. Leclercia adecarboxylata from human gut flora carries mcr-4.3 and blaIMP-4-Bearing plasmids. Front Microbiol. 2019;10:2805. 10.3389/fmicb.2019.02805. [DOI] [PMC free article] [PubMed]
  • 14.Lin Q et al. Screening of global microbiomes implies ecological boundaries impacting the distribution and dissemination of clinically relevant antimicrobial resistance genes. Commun Biology. 2022;5:1217. 10.1038/s42003-022-04187-x. [DOI] [PMC free article] [PubMed]
  • 15.Kim JS, et al. Emergence of the mobile colistin resistance gene mcr-1 in a leclercia adecarboxylata strain isolated from wastewater in Seoul. J Global Antimicrob Resist. 2024;39:37–40. [DOI] [PubMed] [Google Scholar]
  • 16.Ainsworth GC, Brown AM, Brownlee G. AEROSPORIN, AN ANTIBIOTIC PRODUCED BY BACILLUS-AEROSPORUS GREER. Nature. 1947;160(4060):263–263. [DOI] [PubMed] [Google Scholar]
  • 17.O’Riordan J, et al. Successful treatment of carbapenemase producing Enterobacteriaceae peritonitis: ‘Old therapy for a new bug’. Perit Dial Int. 2020;40(1):100–2. [DOI] [PubMed] [Google Scholar]
  • 18.Falcone M et al. Time to appropriate antibiotic therapy is a predictor of outcome in patients with bloodstream infection caused by KPC-producing Klebsiella pneumoniae. Crit Care. 2020;24:29. 10.1186/s13054-020-2742-9. [DOI] [PMC free article] [PubMed]
  • 19.Pang F et al. Factors associated to prevalence and treatment of carbapenem-resistant Enterobacteriaceae infections: a seven years retrospective study in three tertiary care hospitals. Ann Clin Microbiol Antimicrob. 2018;17:13. 10.1186/s12941-018-0267-8. [DOI] [PMC free article] [PubMed]
  • 20.Mlynarcik P, Kolar M. Molecular mechanisms of polymyxin resistance and detection of Mcr genes. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2019;163(1):28–38. [DOI] [PubMed] [Google Scholar]
  • 21.Carroll LM et al. Identification of novel mobilized colistin resistance gene mcr-9 in a Multidrug-Resistant, colistin-Susceptible Salmonella enterica serotype typhimurium isolate. Mbio. 2019;10(3):e00853-19. 10.1128/mbio.00853-19. [DOI] [PMC free article] [PubMed]
  • 22.Liu J-H, et al. Plasmid-mediated colistin-resistance genes: Mcr. Trends Microbiol. 2024;32(4):365–78. [DOI] [PubMed] [Google Scholar]
  • 23.de Lillo A, et al. Novel subgingival bacterial phylotypes detected using multiple universal polymerase chain reaction primer sets. Oral Microbiol Immunol. 2006;21(1):61–8. [DOI] [PubMed] [Google Scholar]
  • 24.Li C, et al. Genomic epidemiology of Carbapenemase-producing Klebsiella pneumoniae in China. Genomics Proteom Bioinf. 2022;20(6):1154–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Guo H, et al. Replicon-Based typing about IncG plasmids and molecular characterization of five IncG plasmids carrying carbapenem resistance gene blaKPC-2. Infect Drug Resist. 2024;17:2987–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hackl T, et al. Proovread: large-scale high-accuracy PacBio correction through iterative short read consensus. Bioinformatics. 2014;30(21):3004–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Brettin T et al. RASTtk: A modular and extensible implementation of the RAST algorithm for Building custom annotation pipelines and annotating batches of genomes. Sci Rep. 2015;5:8365. 10.1038/srep08365. [DOI] [PMC free article] [PubMed]
  • 28.Boutet E, et al. UniProtKB/Swiss-Prot. Methods in molecular biology. (Clifton N J). 2007;406:89–112. [DOI] [PubMed] [Google Scholar]
  • 29.O’Leary NA, et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44(D1):D733–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bortolaia V, et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J Antimicrob Chemother. 2020;75(12):3491–500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Alcock BP, et al. CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res. 2020;48(D1):D517–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang P, et al. DANMEL: A manually curated reference database for analyzing mobile genetic elements associated with bacterial drug resistance. Mlife. 2022;1(4):460–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Pal C, et al. BacMet: antibacterial biocide and metal resistance genes database. Nucleic Acids Res. 2014;42(D1):D737–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Siguier P, et al. ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006;34:D32–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Moura A, et al. INTEGRALL: a database and search engine for integrons, integrases and gene cassettes. Bioinformatics. 2009;25(8):1096–8. [DOI] [PubMed] [Google Scholar]
  • 36.Roberts AP, et al. Revised nomenclature for transposable genetic elements. Plasmid. 2008;60(3):167–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Fu J, et al. Precision methylome and in vivo methylation kinetics characterization of Klebsiella pneumoniae. Genomics Proteom Bioinf. 2022;20(2):418–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Delcher AL, Salzberg SL, Phillippy AM. Using MUMmer to identify similar regions in large sequence sets. Curr Protoc Bioinformatics. 2003;Chapter 10:Unit 10.3-Unit 10.3 [DOI] [PubMed]
  • 40.Didelot X, Wilson DJ. ClonalFrameML: efficient inference of recombination in whole bacterial genomes. PLoS Comput Biol. 2015;11(2):e1004041. 10.1371/journal.pcbi.1004041. [DOI] [PMC free article] [PubMed]
  • 41.Liang Q et al. Sequencing and genomic diversity analysis of IncHI5 plasmids. Front Microbiol. 2019;9:3318. 10.3389/fmicb.2018.03318. [DOI] [PMC free article] [PubMed]
  • 42.Nakasone I, et al. Laboratory-based evaluation of the colorimetric VITEK-2 compact system for species identification and of the advanced expert system for detection of antimicrobial resistances: VITEK-2 compact system identification and antimicrobial susceptibility testing. Diagn Microbiol Infect Dis. 2007;58(2):191–8. [DOI] [PubMed] [Google Scholar]
  • 43.SunF et al. Genetic characterization of two fully sequenced multi-drug resistant plasmids pP10164-2 and pP10164-3 from Leclercia adecarboxylata. Sci Rep. 2016;6:33982. 10.1038/srep33982. [DOI] [PMC free article] [PubMed]
  • 44.Liang Q, et al. Sequencing and comparative genomics analysis of the IncHI2 plasmids pT5282-mphA and p112298-catA and the IncHI5 plasmid pYNKP001-dfrA. Int J Antimicrob Agents. 2017;49(6):709–18. [DOI] [PubMed] [Google Scholar]
  • 45.Yuan Q et al. First report of coexistence of blaKPC-2-, blaNDM-1- and mcr-9-carrying plasmids in a clinical carbapenem-resistant Enterobacter hormaechei isolate. Front Microbiol. 2023;14:1153366. 10.3389/fmicb.2023.1153366. [DOI] [PMC free article] [PubMed]
  • 46.Liang QH, et al. Sequencing and comparative genomics analysis of the IncHI2 plasmids pT5282-mphA and p112298-catA and the IncHI5 plasmid pYNKP001-dfrA. Int J Antimicrob Agents. 2017;49(6):709–18. [DOI] [PubMed] [Google Scholar]
  • 47.Ding M et al. Co-infections of two carbapenemase-producing Enterobacter hormaechei clinical strains isolated from the same diabetes individual in China. J Med Microbiol. 2021;70(3):001316. 10.1099/jmm.0.001316. [DOI] [PubMed]
  • 48.Kieffer N et al. mcr-9, an inducible gene encoding an acquired phosphoethanolamine transferase in Escherichia coli, and its origin. Antimicrob Agents Chemother. 2019;63(9):e00965-19. 10.1128/aac.00965-19. [DOI] [PMC free article] [PubMed]
  • 49.Peters JE, et al. Heteromeric transposase elements: generators of genomic Islands across diverse bacteria. Mol Microbiol. 2014;93(6):1084–92. [DOI] [PubMed] [Google Scholar]
  • 50.Xu YY, et al. Complete genome sequences of leclercia sp. W6 and W17 isolated from a gastric cancer patient. Curr Microbiol. 2020;77(10):2775–82. [DOI] [PubMed] [Google Scholar]
  • 51.Tor XY, et al. Isolation of bacteria with plant growth-promoting activities from a foliar biofertilizer. Malaysian J Microbiol. 2022;18(3):315–21. [Google Scholar]
  • 52.Weingarten RA et al. Genomic analysis of hospital plumbing reveals diverse reservoir of bacterial plasmids conferring carbapenem resistance. Mbio. 2018;9(1):e02011-17. 10.1128/mbio.02011-17. [DOI] [PMC free article] [PubMed]
  • 53.Parks DH, et al. Recovery of nearly 8,000 metagenome-assembled genomes substantially expands the tree of life (2, Pg 1533, 2017). Nat Microbiol. 2018;3(2):p253–253. [DOI] [PubMed] [Google Scholar]
  • 54.Ying YY et al. Florfenicol Resistance in Enterobacteriaceae and Whole-Genome Sequence Analysis of Florfenicol-Resistant Leclercia adecarboxylata Strain R25. Int J Genomics. 2019;2019:9828504. 10.1155/2019/9828504. [DOI] [PMC free article] [PubMed]
  • 55.Elbediwi M et al. Global burden of colistin-Resistant bacteria: mobilized colistin resistance genes study (1980–2018). Microorganisms. 2019;7(10):461. [DOI] [PMC free article] [PubMed]
  • 56.Faccone D, et al. Plasmid carrying mcr-9 from an extensively drug-resistant NDM-1-producing Klebsiella Quasipneumoniae subsp. Quasipneumoniae clinical isolate. Infect Genet Evol. 2020;81:104273. 10.1016/j.meegid.2020.104273. [DOI] [PubMed]
  • 57.Borjesson S, et al. A link between the newly described colistin resistance gene mcr-9 and clinical Enterobacteriaceae isolates carrying blaSHV-12 from horses in Sweden. J Global Antimicrob Resist. 2020;20:285–9. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (24.2MB, docx)
Supplementary Material 2. (2.5MB, zip)

Data Availability Statement

The complete genome sequences generated and analyzed in this study are available in the GenBank database under accession numbers CP036199, CP046251, JAEFHR000000000, CP049980, CP043398, CP043397, CP042930, CP046557, CP046446, CP046445, and CP049786. The accession numbers for plasmids are listed in Supplementary Table 2.

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES