Abstract
Background
M2 macrophage polarization in the tumor microenvironment drives lung cancer progression. ETS homologous factor (EHF) is overexpressed in lung cancer and linked to malignancy. However, the mechanism by which EHF regulates macrophage M2 polarization in the lung cancer microenvironment remains unclear.
Methods
EHF expression in lung cancer tissues was assessed via bioinformatics databases, qRT-PCR, and Western blot. Cell proliferation, glycolysis indices, apoptosis, and migration were evaluated via EdU, commercial kits, flow cytometry, and Transwell, respectively. Lung cancer cell exosomes were isolated, with their characteristics identified by transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA). Next, the binding between ring finger protein 41 (RNF41) and EHF was predicted via JASPER and verified by chromatin immunoprecipitation (ChIP) and dual-luciferase reporter assays.
Results
EHF was highly expressed in lung cancer. Downregulation of EHF suppressed the malignant phenotypes of lung cancer cells and reduced M2 polarization of macrophages. Exosomes from lung cancer cells could enrich EHF and deliver it to macrophages, promoting their M2 polarization, while knockdown of EHF in exosomes reversed this effect. Mechanistically, EHF bound to the RNF41 promoter and promoted its transcription, and overexpression of RNF41 could reverse the suppressive effects of EHF silencing on macrophage M2 polarization and lung cancer progression. In vivo experiments showed that inhibition of the EHF/RNF41 axis significantly suppressed tumor growth.
Conclusion
Exosomal EHF derived from lung cancer cells promoted M2 polarization of macrophages through transcriptional regulation of RNF41, thereby driving lung cancer progression.
Keywords: Lung cancer, ETS homologous factor, Ring finger protein 41, M2 macrophage polarization, Exosomes
Graphical abstract
By integrating clinical database analysis, cellular functional assays, molecular mechanism validation, and in vivo model verification, this study systematically reveals the critical role of lung cancer-derived exosomal EHF in regulating macrophage polarization and lung cancer progression. Clinical data demonstrate that EHF is highly expressed in lung cancer tissues and positively correlates with M2 macrophage infiltration. Lung cancer cells deliver EHF to macrophages via exosomes, where EHF acts as a transcription factor to directly bind and activate the RNF41 promoter, upregulating its expression to drive M2 macrophage polarization. This polarization promotes the secretion of pro-tumor cytokines such as TGF-β1, IL-10, and VEGFA, which enhance lung cancer cell proliferation, migration, invasion, and tumor angiogenesis. In vivo experiments further confirm that exosomes with EHF knockdown significantly suppress tumor growth and intratumoral M2 macrophage infiltration. These findings establish a positive feedback regulatory loop in which lung cancer cells use exosomal EHF to modulate macrophage RNF41 expression, promote M2 polarization, and accelerate malignant progression, providing a novel molecular mechanism and potential therapeutic targets for remodeling the lung cancer immune microenvironment.

1. Introduction
Lung cancer, one of the most prevalent and deadly malignancies globally, presents profound clinical challenges and significant societal burdens [1,2]. Beyond its grave threat to patients’ lives and health, its high mortality imposes heavy strains on families and communities, making it a critical public health concern [3]. Despite advances in treatments, including surgery, chemo/radiotherapy, targeted therapy, and immunotherapy, lung cancer patients still face poor overall prognosis [4,5]. Persistent issues such as tumor invasion, metastasis, treatment resistance, and recurrence continue to hinder clinical outcomes, exacerbating the burden on healthcare systems and diminishing quality of life [6,7]. Thus, unraveling the molecular mechanisms driving lung cancer progression and identifying novel diagnostic markers and therapeutic targets are critical to mitigating its harm and easing societal burdens.
Aberrant modulation of the tumor microenvironment (TME) acts as a critical facilitator of tumor progression [8]. Within this biological milieu, tumor-associated macrophages (TAMs), the predominant immune cell population, exert profound effects on tumor behavior due to their phenotypic and functional plasticity [9,10]. TAMs are broadly categorized into two polarized states: M1 and M2. M1 macrophages exert anti-tumor effects by releasing pro-inflammatory cytokines and reactive oxygen species, while M2 macrophages promote tumor progression by facilitating angiogenesis, matrix remodeling, immune suppression, and tumor cell proliferation and invasion, effectively acting as “collaborators” in driving lung cancer advancement [[11], [12], [13]]. Clinical studies have consistently linked high infiltration of M2-polarized TAMs to poor prognosis in lung cancer patients [14]. Thus, unraveling the molecular mechanisms governing M2 macrophage polarization holds promise for developing novel strategies to target the tumor microenvironment therapeutically.
Exosomes, as membrane-enclosed vesicles, are secreted into the extracellular milieu through the fusion of intracellular multivesicular bodies with the plasma membrane [15,16]. Such vesicles harbor a diverse repertoire of bioactive molecules, encompassing proteins, lipids, and nucleic acids (mRNA, miRNA, lncRNA, among others), and reach target cells via paracrine signaling or systemic circulation to mediate intercellular communication [17,18]. In the lung cancer microenvironment, exosomes secreted by tumor cells are well-established as key mediators of TAM polarization [19,20]. For instance, exosomal miRNAs promote M2 macrophage polarization by targeting tumor suppressor genes in macrophages, while exosomal proteins drive macrophage functional remodeling through the activation of specific signaling pathways [21]. However, the role of exosomal transcription factors in regulating macrophage polarization remains poorly studied, and their underlying molecular mechanisms require further elucidation.
ETS homologous factor (EHF), a core member of the ETS transcription factor family, modulates gene transcription and is broadly implicated in vital biological processes such as cell proliferation, differentiation, and invasion [22,23]. Recent studies demonstrate that EHF exhibits aberrant expression across diverse tumor types, contributing to tumor progression through diverse mechanisms: specifically, in non-small cell lung cancer (NSCLC), EHF enhances malignant phenotypes by regulating the AKT and MAPK/ERK signaling pathways [24]; in liver cancer, EHF drives metastasis through regulating the transcriptional level of KDM2B in M2-type macrophages, thereby mediating IL-6 secretion [25]; and in papillary thyroid cancer (PTC), EHF participates in forming the NEAT1_2/RRAD/EHF positive feedback loop, driving disease progression by promoting tumor cell aerobic glycolysis [26]. However, despite these advances in understanding EHF's roles in the aforementioned cancers, the key mechanism by which EHF regulates M2 macrophage polarization within the lung cancer TME remains to be further elucidated.
Ring finger protein 41 (RNF41) is an E3 ubiquitin ligase containing a RING finger domain, which participates in biological processes such as cellular signal transduction and immune regulation by mediating the ubiquitination modification of target proteins [27]. In bladder cancer, loss of RNF41 promotes bladder cancer metastasis [28]. Additionally, RNF41 silencing represses the growth, migration, and invasion of prostate cancer cells in vitro and in vivo [29]. Preliminary laboratory studies have identified that EHF, acting as a transcription factor, binds to the promoter region of RNF41; concurrently, RNF41 has been found to be associated with M2 polarization of macrophages. However, the interaction between EHF and RNF41, as well as their regulatory mechanisms in lung cancer, particularly their combined effects on macrophage phenotypes and tumor progression, remain poorly defined.
Therefore, it is hypothesized that exosomal EHF derived from lung cancer cells may promote the transcription of RNF41, thereby driving the polarization of TAMs toward the M2 phenotype, and ultimately mediating the malignant progression of lung cancer. The significance of this project lies in its in-depth exploration of the specific mechanisms by which exosomal EHF from lung cancer cells regulates TAM polarization to facilitate lung cancer progression. This not only holds promise for providing new insights and potential targets for the clinical treatment of lung cancer but also aims to further expand the research horizon in the field of epigenetic regulation of the tumor microenvironment.
2. Materials and methods
2.1. Clinical sample collection
A total of 69 paired lung cancer tissues and adjacent non-tumor tissues were collected from patients who underwent surgical resection at the People's Hospital of Beilun District, Beilun Branch Hospital of the First Affiliated Hospital of Medical School of Zhejiang University. All samples were immediately snap-frozen in liquid nitrogen after resection and stored at −80 °C until use for subsequent qRT-PCR and Western blot analyses. This study was approved by the Ethics Committee of the People's Hospital of Beilun District, Beilun Branch Hospital of the First Affiliated Hospital of Medical School of Zhejiang University, and written informed consent was obtained from all patients.
2.2. Cell culture and treatment
Lung carcinoma cell lines A549 (Catalog #: C0016002) and H520 (Catalog #: C0016010) were sourced from AddexBio (San Diego, California, USA). A549 cells were cultured in F–12K Nutrient Mixture (Kaighn's Modification) (Corning, Tewksbury, MA, USA) containing 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA). H520 cells were cultured in AddexBio-formulated RPMI-1640 Medium (Catalog #: C0004-01, AddexBio) containing 10% FBS (Gibco). Human monocyte cell line (THP-1) (Catalog #: YC-D011) were purchased from Guangzhou Ubigene Biosciences Co., Ltd. (Guangzhou, China) and cultured in RPMI-1640 (Gibco) containing 10% FBS (Gibco). Human umbilical vein endothelial cells (HUVECs; Catalog #: SNL-503, Suncell, Wuhan, China) and HEK-293T cells (Catalog #: CL-0005, Procell, Wuhan, China) were respectively cultured in endothelial cell growth medium (Sigma-Aldrich, St. Louis, MO, USA) and DMEM (Procell) containing 10% FBS (Gibco) and 1% Penicillin/Streptomycin (P/S; Procell). All cells were maintained at 37 °C in a humidified incubator with 5% CO2. THP-1 cells were treated with 100 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) for 24 h to differentiate into adherent THP-1-M0 macrophages.
2.3. Cell transfection
For gene silencing experiments, short hairpin RNA (shRNA) targeting EHF (designated as KD-EHF) and non-targeting control shRNA (designated as Ctrl) were purchased from GeneChem (Shanghai, China) and transfected into cells. For overexpression experiments, the RNF41 overexpression vector (designated as OE-RNF41) was constructed by cloning the RNF41 gene into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA), which was then transfected into cells to upregulate RNF41 expression. All transfections were conducted using Lipofectamine 3000 (Invitrogen) following the manufacturer's protocol.
2.4. Bioinformatics analysis
The GEPIA database (http://gepia.cancer-pku.cn/) was applied to evaluate EHF mRNA expression in lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), comparing tumor tissues with normal tissues. The PCAS database (https://jingle.shinyapps.io/PCAS/) was employed to examine EHF protein expression in the same cancer types. Moreover, the TIMER2.0 database (https://timer.cistrome.org/) was leveraged to investigate the correlations between EHF/RNF41 expression and macrophage infiltration (including M1 and M2 subsets) in LUAD and LUSC, with Spearman's correlation analysis (e.g., CIBERSORT, XCELL, QUANTISEQ) across multiple algorithms to quantify association strength (Rho) and statistical significance (P-value). Additionally, the JASPAR database (https://jaspar.genereg.net/) was utilized to predict potential binding sites of EHF (as a transcription factor) in the RNF41 promoter region.
2.5. Western blot
Tissue and cell samples were lysed in RIPA buffer with protease inhibitors, and supernatants were collected post-centrifugation. Protein samples were denatured with SDS loading buffer and boiled for 5 min, separated by SDS-PAGE, then transferred to PVDF membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% skim milk in TBST, incubated with primary antibodies against EHF (1:1000, Catalog #: 27195-1-AP, Proteintech, Wuhan, China), TSG101 (1:1000, Catalog #: 14497-1-AP, Proteintech), Calnexin (1:1000, Catalog #: 10427-2-AP, Proteintech), CD9 (1:2000, Catalog #: 60232-1-Ig, Proteintech), RNF41 (1:500, Catalog #: 17233-1-AP, Proteintech), CD206 (1:1000, Catalog #: 18704-1-AP, Proteintech), TGF-β1 (1:1000, Catalog #: 26155-1-AP, Proteintech), VEGFA (1:1000, Catalog #: ab46154, Abcam, Cambridge, UK), and β-actin (1:1000, Catalog #: 66009-1-Ig, Proteintech) overnight at 4 °C, followed by HRP-conjugated secondary antibodies (1:5000, Catalog #: ab6721/ab205719, Abcam) for 1 h at room temperature. Bands were visualized via ECL, with β-actin as an internal control.
2.6. qRT-PCR
Total RNA was extracted using TRIzol reagent (Invitrogen). cDNA was obtained using Transcriptor First Strand cDNA Synthesis Kit (Roche, Vilvoord, Brussel, Belgium). Using SYBR Green PCR Master Mix (Ambion, Carlsbad, CA, USA), qRT-PCR was performed. Primers used in this assay were synthesized by RiBoBio (Guangzhou, China), with their sequences presented in Table 1 β-actin was used as the internal reference gene.
Table 1.
Primers sequences used for qPCR.
| Name | Primers for PCR (5’-3’) | |
|---|---|---|
| EHF | Forward | AGTGGCTCAGCTATGGGGTA |
| Reverse | CTCTCCATCCTCGGGCATTC | |
| RNF41 | Forward | GCCAGTACAGGCACCTCATT |
| Reverse | CGTCACAACACTACGGTCCA | |
| β-actin | Forward | CTTCGCGGGCGACGAT |
| Reverse | CCACATAGGAATCCTTCTGACC |
2.7. Cell proliferation assay
Cell proliferation was detected using the BeyoClick™ EdU Cell Proliferation Kit with AF594 (Beyotime, Shanghai, China). Cells were seeded in 6-well plates, and 1 mL of 2 × EdU working solution was added. Incubation was continued for 2 h. The cells were fixed with 1 mL of paraformaldehyde fixative and then permeabilized with PBS containing 0.3% Triton X-100 sequentially. Subsequently, Click reaction solution was added, and the cells were incubated at room temperature for 30 min in the dark. Nuclei were stained with DAPI (Beyotime), and finally, the cells were observed under a microscope.
2.8. Measurement of glycolytic indices
Glucose consumption and lactate release were respectively measured using Glucose Assay Kit (Beyotime) and L-Lactate Assay Kit (Beyotime). Briefly, cells were lysed according to the manufacturer's instructions. Working solutions were prepared, standard curves were generated, and finally, calculations were performed as instructed by the kit manuals.
2.9. Flow cytometry
Cell apoptosis was assayed with the Annexin V-FITC/PI Apoptosis Detection Kit (Yeasen, Shanghai, China). Following digestion and rinsing, 1 × 105 cells were collected. Cells were resuspended in 100 μL of 1 × Binding Buffer, with 5 μL Annexin V-FITC and 10 μL PI staining solution added. The mixture was incubated in the dark for 15 min, followed by the addition of 400 μL of 1 × Binding Buffer. Cells were subsequently analyzed via flow cytometry.
Additionally, to assess the expression of macrophage polarization surface markers, macrophages were resuspended in staining buffer (PBS supplemented with 1% FBS and 0.1% NaN3) and incubated with FITC-conjugated anti-CD206 (Catalog #: ab270647, Abcam) at 4 °C for 30 min. Post-incubation, cells were washed and resuspended in 200 μL of PBS, and finally detected using a flow cytometer. Data were analyzed with FlowJo software.
2.10. Transwell assay
For migration assay, cells were first serum-starved overnight and resuspended in serum-free medium at a density of 5 × 104 cells/mL. Transwell inserts (8-μm pore size) (Corning) were placed in 24-well plates, with 200 μL of cell suspension added to the upper chambers. The lower chambers were filled with 600 μL of complete medium containing 10% FBS. After incubation at 37 °C with 5% CO2 for 24 h, non-migrated cells on the upper surface of the inserts were wiped off. Migrated cells on the lower surface were fixed with 4% paraformaldehyde (Beyotime) for 15 min, stained with 0.1% crystal violet (Beyotime) for 20 min, and rinsed with PBS. Finally, the stained cells were observed under a microscope.
2.11. Enzyme-linked immunosorbent assay (ELISA)
The secretion levels of M2 macrophage markers, including TGF-β1, IL-10, and VEGFA, were measured by ELISA. Specifically, the Human TGF-β1 ELISA Kit (Beyotime), Human IL-10 ELISA Kit (Beyotime), and Human VEGFA ELISA Kit (Abcam) were utilized following the manufacturers’ protocols. Briefly, cell culture supernatants were collected. Standards and samples were added to pre-coated plates, followed by incubation with biotinylated detection antibodies. After washing to remove unbound reagents, HRP-conjugated streptavidin was added and incubated. Substrate was added for color development. Then, the reaction was stopped. Absorbance was measured at 450 nm with a microplate reader, and cytokine concentrations were calculated using standard curves.
2.12. Isolation and extraction of exosomes
Cells were cultured overnight in normal medium, then the medium was replaced with RPMI 1640 containing 10% exosome-depleted FBS. After 48 h, the medium was collected and centrifuged to obtain the supernatant. The supernatant was filtered twice with a 0.22 μm filter, then ultracentrifuged at 100,000 g for 70 min. The pellet was collected and resuspended in 10 mL PBS and re-ultracentrifuged. Exosomes were resuspended in 100 μL PBS, aliquoted, and stored at −80 °C. All ultracentrifugation was performed at 4 °C, with care to avoid aspirating cells or debris when collecting supernatants.
2.13. Identification of exosomes
For identification of exosomes, transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) were performed. For TEM, isolated exosomes were resuspended in PBS, and 10 μL of the exosome dilution was adsorbed onto copper grids for 10 min. The grids were then transferred to 3% glutaraldehyde (Solarbio, Beijing, China) for fixation for 5 min, followed by washing in deionized water. Finally, they were stained with uranyl acetate (Sigma-Aldrich) for 1 min, air-dried naturally, and imaged using TEM. For NTA, the particle size and concentration of exosomes were analyzed: scattered light signals emitted by exosomes were collected via the NanoSight NS300 system, and the Brownian motion of exosomes was tracked and recorded to calculate their size and concentration. All samples were measured using NP100 membranes with parameters set at 44.5 mm and 64 V. Exosome solutions were diluted 100-fold, filtered through a 0.22 μm filter, and then used to determine the particle size distribution via the instrument.
2.14. Exosome labeling and uptake
Fluorescent microscopy was used to visualize the internalization of PKH67-labeled exosomes into THP-1-M0 macrophages after co-incubation. 10 μg exosomes total were mixed with Diluent C buffer containing 4 μL PKH67 dye (Sigma-Aldrich) and incubated for 5 min. Exosomes were then re-isolated by ultracentrifugation. PKH67-labeled exosomes were added to macrophages and incubated at room temperature for 2 h. Cells were washed with PBS, fixed with 4% paraformaldehyde (Beyotime) for 15 min, stained with DAPI (Beyotime) for nuclear labeling, rinsed 3 times with PBS, and photographed under a fluorescent inverted microscope.
2.15. Tube formation assay
To detect angiogenesis, supernatants from exosome-treated macrophages were co-cultured with human umbilical vein endothelial cells (HUVECs; Catalog #: SNL-503, Suncell, Wuhan, China). Briefly, Matrigel (Corning) was thawed on ice, added to 96-well plates (50 μL/well), and allowed to solidify at 37 °C for 30 min. HUVECs were seeded into Matrigel-coated wells at a density of 2 × 104 cells/well. The collected macrophage supernatants (100 μL/well) were then added, and cells were incubated at 37 °C with 5% CO2 for 6 h. Tubular structures were observed under an inverted microscope.
2.16. Chromatin immunoprecipitation (ChIP) assay
To assess EHF binding to the RNF41 promoter, chromatin immunoprecipitation (ChIP) was performed: THP-1-M0 cells (Ctrl and KD-EHF groups) were cross-linked with formaldehyde, lysed, and chromatin was sonicated to shear DNA. The fragmented chromatin was incubated with anti-EHF antibody (Catalog #: 27195-1-AP, Proteintech) or control anti-IgG (Catalog #: ab172730, Abcam) for immunoprecipitation. Following washes and cross-link reversal, precipitated DNA was extracted and analyzed by qRT-PCR to measure RNF41 promoter enrichment, with results expressed as relative enrichment versus the anti-IgG control.
2.17. Dual-luciferase reporter assay
Wild-type (WT) and mutant (MUT) RNF41 promoter constructs were cloned into the pGL3-Basic luciferase vector (Promega, Madison, WI, USA), then co-transfected into 293T cells with either OE-EHF or control plasmids, alongside the pRL-TK Renilla luciferase plasmid (Promega) as an internal control. Following 48-h incubation, cells were lysed, and luciferase activities were measured using Dual-Lucy Assay Kit (Solarbio). Relative activity was calculated by normalizing firefly luciferase signals to Renilla signals.
2.18. Xenograft model establishment
Xenograft models were established using ten 6-week-old BALB/c nude mice purchased from Beijing Sibefu Biotechnology Co., Ltd. (Beijing, China). The mice were divided into two groups: control and KD-EHF, with 5 × 106 A549 cells subcutaneously injected into each mouse. All animal experiments were approved by the Institutional Animal Care and Use Committee of the affiliated institution and conducted in strict accordance with the Guidelines for the Care and Use of Laboratory Animals to minimize animal suffering. Tumor width and length were monitored every 5 days, and tumor volume was calculated using the formula: length × width2 × 0.5. After 30 days, the mice were euthanized, and tumor samples were excised, weighed, and subjected to further molecular studies.
2.19. Statistical analysis
Statistical analyses were performed using GraphPad Prism software. Experimental results were expressed as mean ± standard deviation ( ±s). Differences between two groups were analyzed using Student's t-test. For multiple groups, differences were analyzed using one-way analysis of variance (ANOVA) when comparing across one independent variable, or two-way ANOVA when evaluating effects involving two independent variables. A P-value <0.05 was considered statistically significant.
3. Results
3.1. EHF was upregulated in lung cancer and correlate with M2 macrophage infiltration
To elucidate EHF expression patterns in lung cancer and their associations with macrophage infiltration, multi-source analyses were integrated. First, EHF was robustly upregulated in lung cancer: the GEPIA and PCAS database analyses (boxplots for LUAD/LUSC, violin plots for tumor vs. normal tissues) revealed significantly higher EHF transcript levels in tumors (Fig. 1A–C). Clinical sample validation via qRT-PCR and Western blot further confirmed elevated EHF mRNA and protein in lung tumors compared to adjacent normal tissues (P < 0.001) (Fig. 1D and E). In addition, TIMER2.0 database analysis explored correlations between EHF/RNF41 and macrophage subsets (Fig. S1): In LUSC, EHF expression negatively correlated with M1 macrophage infiltration (Rho = −0.13, P = 4.44e-03), while in LUAD, EHF positively associated with M2 macrophage subpopulations. For RNF41, consistent positive correlations with M2 macrophage infiltration were observed across LUAD and LUSC, with this trend reproducible across different analytical pipelines. Collectively, these findings demonstrated EHF overexpression in lung cancer and highlighted the intimate associations of EHF and RNF41 with M2-like macrophage infiltration, suggesting their potential role in fostering an immunosuppressive tumor microenvironment.
Fig. 1.
EHF is upregulated in lung cancer tissues at mRNA and protein levels. (A) Box plots from the GEPIA database: EHF mRNA expression in lung adenocarcinoma (LUAD; tumor, n = 483; normal, n = 347) and LUSC (tumor, n = 486; normal, n = 338), comparing tumor vs. normal tissues. (B–C) Violin plots from the PCAS database: EHF mRNA distribution in LUAD (B; normal, n = 85; tumor, n = 91) and LUSC (C; normal, n = 92; tumor, n = 100) tissues. (D) Scatter plots of EHF mRNA levels quantified by qRT-PCR in clinical lung tumor and adjacent normal tissues (n = 69; P < 0.001, Student's t-test). (E) Western blot and quantitative analysis of EHF protein in paired clinical lung tumor (T1-T8) and normal (N1–N8) tissues, with β-actin as a loading control (P < 0.001, Student's t-test). Statistical significance: ∗P < 0.05, ∗∗∗P < 0.001.
3.2. EHF promoted lung cancer progression and M2 macrophage polarization via paracrine crosstalk
Building on the observed EHF upregulation and correlations with macrophage infiltration, EHF's functional impact on lung cancer cells and tumor-immune crosstalk was explored. In A549 and H520 cells, EHF knockdown (KD-EHF) was confirmed by Western blot (Fig. 2A and B). Phenotypically, silencing EHF suppressed cell proliferation (Fig. 2C and D), impaired glycolytic activity (glucose consumption, Fig. 2E and F; lactate production, Fig. 2G and H), increased apoptosis (Fig. 2I and J), and reduced migratory capacity (Fig. 2K- L). Moreover, when THP-1-M0 macrophages were co-incubated with supernatants from KD-EHF lung cancer cells, flow cytometry showed decreased CD206+ M2 macrophage polarization (Fig. 2M − N), accompanied by reduced secretion of M2-associated cytokines (TGF-β1, IL-10, and VEGFA) in ELISA assays (Fig. 2O-P). Collectively, these findings demonstrated that EHF promoted lung cancer progression via enhancing cell proliferation/glycolysis/invasion and fostered an immunosuppressive microenvironment by facilitating M2 macrophage polarization.
Fig. 2.
EHF promotes lung cancer cell malignancy and M2 macrophage polarization. A549 and H520 cells were transfected with control (Ctrl) or EHF-knockdown (KD-EHF) plasmids. (A-B) Western blot and quantification of EHF protein levels in A549 and H520 cells. (C-D) EdU staining and quantification of EdU+ cells in A549 and H520 cells, assessing proliferation. (E-H) Glucose uptake and lactate production assays were conducted using commercial kits to evaluate glycolytic output. (I-J) Flow cytometric analysis of apoptosis. (K-L) Transwell assay was employed to examine cell migration. (M − P) THP-1 cells were differentiated into THP-1-M0 macrophages with 100 ng/mL PMA for 24 h. Culture supernatants from Ctrl- or KD-EHF–transfected A549 and H520 cells were collected and co-incubated with THP-1-M0 macrophages. (M − N) Flow cytometric analysis was performed to assess the proportion of CD206+ M2-polarized macrophages. (O–P) ELISA was conducted to quantify the secretion of M2-associated cytokines (TGF-β1, IL-10, and VEGFA) in the supernatants of THP-1-M0 macrophages. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
3.3. Exosomes mediated EHF delivery to THP-1-M0 macrophages
To characterize exosome-mediated EHF transfer to macrophages, exosomes from A549 and H520 cells were isolated. TEM visualized typical cup-shaped exosomes (Fig. 3A). NTA revealed exosome size distributions peaking at ∼150 nm (Fig. 3B). Western blot confirmed exosome markers (CD9, and TSG101) and absence of Calnexin (endoplasmic reticulum marker) (Fig. 3C), validating exosome purity. Fluorescence microscopy revealed that DiI-labeled exosomes (green) from A549 and H520 cells were internalized by THP-1-M0 macrophages (Fig. 3D), as evidenced by the colocalization of green fluorescent signals with the cytoplasmic region (nuclei stained blue by DAPI) in merged images. Additionally, Western blot demonstrated EHF protein in THP-1-M0 cells was significantly elevated after incubation with A549 or H520 exosomes but reduced following treatment with EHF-knockdown exosomes (Fig. 3E and F), indicating exosomes mediate EHF delivery to macrophages.
Fig. 3.
Exosomes derived from lung cancer cells are internalized by THP-1-M0 macrophages and mediate EHF delivery. Exosomes were isolated from A549 and H520 cells. (A) TEM images showed the typical cup-shaped morphology of exosomes isolated from A549 and H520 cell supernatants (scale bar: 100 nm). (B) NTA of exosomes from A549 and H520 cells. (C) Western blot analysis of exosome markers (CD9 and TSG101) and the endoplasmic reticulum marker Calnexin in exosome lysates and parental A549/H520 cell lysates. (D-E) THP-1-M0 macrophages (differentiated from THP-1 cells with 100 ng/mL PMA for 24 h) were co-incubated with DiI-labeled exosomes isolated from A549 and H520 cells. (D) Fluorescence microscopy images of THP-1-M0 macrophages after co-incubation with PKH67-labeled exosomes (scale bar: 20 μm). (E-F) Western blot and quantification of EHF protein levels in THP-1-M0 macrophages after incubation with exosomes from A549 or H520 cells. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
3.4. Exosomal EHF reprogrammed macrophages to promote lung cancer malignancy and angiogenesis via paracrine crosstalk
To investigate the functional impact of exosome-mediated EHF transfer, a paracrine co-culture system was established: Exosomes isolated from Ctrl or KD-EHF A549/H520 cells were co-incubated with THP-1-M0 macrophages, and the resulting conditioned medium (CM) was used to treat tumor cells or HUVECs (Fig. 4A). The CM from macrophages treated with Ctrl exosomes significantly increased the proportion of CD206+ M2 macrophages and upregulated the secretion of M2-associated cytokines (TGF-β1, IL-10, and VEGFA), while these effects were reversed by KD-EHF exosome treatment (Fig. 4B–E), suggesting that exosomal EHF could promote macrophage polarization toward the M2 phenotype and the release of pro-tumor cytokines. Additionally, the CM from Ctrl exosome-treated macrophages enhanced the proliferation and migration of A549 and H520 cells and reduced their apoptosis, whereas the KD-EHF exosome group exhibited opposite effects (Fig. 4F–K), indicating that M2 macrophages modulated by exosomal EHF promoted the malignant phenotypes of tumor cells via paracrine signaling. In terms of angiogenesis, the CM from Ctrl exosome-treated macrophages significantly promoted tube formation in HUVECs, and this angiogenic effect was attenuated in the KD-EHF exosome group (Fig. 4L-M). Collectively, exosomal EHF reprogrammed macrophages toward an M2-like phenotype, thereby driving the malignant progression and angiogenesis of lung cancer cells via paracrine signaling.
Fig. 4.
Exosomal EHF reprograms THP-1-M0 macrophages to promote lung cancer cell malignancy and angiogenesis via paracrine signaling. (A) Schematic of the paracrine co-culture system: Exosomes from control (Ctrl) or EHF-knockdown (KD-EHF) A549/H520 cells were co-incubated with THP-1-M0 macrophages. The medium from these macrophages was used to treat A549/H520 cells or HUVECs. (B-E) THP-1-M0 macrophages were treated with three conditions: blank control (no exosome), exosomes from control-transfected A549/H520 cells (ExoCtrl), or exosomes from EHF-knockdown A549/H520 cells (ExoKD−EHF). (B–C) Flow cytometry analysis of CD206+ M2 macrophage proportions in THP-1-M0 cells. (D-E) ELISA measurement of M2-associated cytokines (TGF-β1, IL-10, and VEGFA). (F-M) The medium from exosome treated macrophages was then used to incubate A549/H520 cells or HUVECs. (F-G) EdU staining and quantification of EdU+ proliferating A549 and H520 cells. (H–I) Flow cytometric analysis of apoptosis in A549 and H520 cells. (J-K) Transwell migration assays and quantification of migrated A549 and H520 cells. (L-M) Tube formation assays and quantification of tube numbers in HUVECs. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
3.5. Lung cancer-derived exosomal EHF directly transactivates RNF41 in macrophages
To investigate EHF's regulatory mechanism in macrophages, RNF41 as a potential target was first identified. JASPAR database analysis predicted an EHF-binding motif within the RNF41 promoter at positions −828/-821 (Fig. 5A). ChIP assay in THP-1-M0 macrophages showed anti-EHF antibodies significantly enriched this promoter region compared to anti-IgG, and EHF knockdown abolished this enrichment (Fig. 5B), confirming direct binding. Dual-luciferase reporter assay in 293T cells revealed EHF overexpression enhanced luciferase activity of the wild-type RNF41 promoter (WT) but not the mutant (MUT, with the EHF-binding site disrupted (Fig. 5C), validating EHF-dependent transcriptional activation. In THP-1-M0 cells, EHF knockdown efficiency was validated by Western blot (Fig. 5D). Its downregulation reduced RNF41 protein and mRNA levels (Fig. 5E and F), confirming EHF-dependent RNF41 expression. Moreover, exosomes from control A549/H520 cells upregulated RNF41 in THP-1-M0 macrophages, while EHF-knockdown exosomes abolished this effect (Fig. 5G and H), indicating lung cancer-derived exosomal EHF potentiated RNF41 expression in macrophages. Collectively, EHF directly transactivated RNF41 in macrophages, with exosomal EHF from lung cancer cells enhancing this regulation.
Fig. 5.
EHF transcriptionally activates RNF41 and mediates its intercellular transfer via exosomes. (A) JASPAR database prediction of the EHF-binding motif within the RNF41 promoter region, localized to positions −828/-821. (B) ChIP-qPCR analysis in THP-1-M0 macrophages. (C) Dual-luciferase reporter assays in 293T cells. (D) WB analysis of EHF protein levels in THP-1-M0 macrophages with EHF knockdown (KD-EHF) or control (Ctrl). (E-F) Western blot and qRT-PCR analysis of RNF41 protein and mRNA levels in THP-1-M0 macrophages with KD-EHF or Ctrl. (G-H) THP-1-M0 macrophages were treated with culture medium (Blank), control exosomes (Ctrl Exo, from A549/H520 cells), or EHF-knockdown exosomes (KD-EHF Exo, from A549/H520-KD-EHF cells). RNF41 protein levels were detected by Western blot. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
3.6. RNF41 mediated exosomal EHF-driven tumor microenvironment dysregulation
To define RNF41 as the downstream mediator of exosomal EHF, a rescue co-culture system was established (Fig. 6A). THP-1-M0 macrophages (control or RNF41-overexpressing) were co-incubated with exosomes from control A549/H520 cells (ExoCtrl) or exosomes from EHF-knockdown A549/H520 cells (ExoKD−EHF). The medium from these co-cultures was then used to treat A549/H520 cells or HUVECs. Functional assays showed that OE-RNF41 promoted M2 macrophage polarization (increased CD206+ cells, elevated TGF-β1/IL-10/VEGFA) (Fig. 6B–E), enhanced tumor cell proliferation (EdU+) (Fig. 6F and G) and migration (Fig. 6J and K), reduced apoptosis (Fig. 6H and I), and stimulated HUVEC tube formation (Fig. 6L-M). These effects were abolished by ExoKD−EHF. These findings demonstrated that RNF41 functioned as a downstream mediator of exosomal EHF, as its overexpression-induced promotion of M2 polarization, tumor malignancy, and angiogenesis was abolished by EHF-knockdown exosomes.
Fig. 6.
RNF41 mediates exosomal EHF-driven pro-tumorigenic effects in lung cancer. (A) Schematic of the rescue co-culture system: THP-1-M0 macrophages (control or RNF41-overexpressing) were incubated with exosomes from control (ExoCtrl) or EHF-knockdown (ExoKD−EHF) A549/H520 cells. The medium from these co-cultures was used to treat A549/H520 cells or HUVECs. (B–C) Flow cytometry was used to analyze the proportion of CD206+ M2-polarized macrophages in THP-1-M0 cells. (D-E) ELISA was employed to quantify the levels of M2-associated cytokines (TGF-β1, IL-10, and VEGFA) in the CM from macrophages. (F-G) EdU assays were carried out to measure the proliferation of A549 and H520 cells. (H–I) Annexin V/PI flow cytometry was used to assess the apoptosis of A549 and H520 cells treated with CM. (J-K) Transwell assays were performed to evaluate the migration of A549 and H520 cells. (L-M) Tube formation assays were conducted on HUVECs treated with CM. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
3.7. EHF knockdown inhibited tumor growth and downregulated M2-associated molecules in vivo
To investigate the in vivo role of EHF, animal experiments were conducted. Tumor volume kinetics showed slower growth in the KD-EHF group, with significant differences at multiple time points (e.g., day 20: P = 0.003; day 30: P < 0.001) (Fig. 7A). Final tumor weight (Fig. 7B, P < 0.001) and gross morphology (Fig. 7C) confirmed reduced tumor burden in KD-EHF mice. Western blot revealed EHF knockdown decreased EHF and RNF41, and concurrently downregulated M2-associated molecules (CD206, TGF-β1, and VEGFA) (Fig. 7D). These data indicated that EHF promoted tumor growth in vivo by fostering an M2-polarized microenvironment, aligning with its exosomal-mediated effects on macrophages.
Fig. 7.
EHF knockdown inhibits tumor growth and downregulates M2-associated molecules in vivo. Nude mice were subcutaneously implanted with Ctrl or KD-EHF A549 cells. (A) Tumor volume was measured every 5 days over 30 days. (B) Tumor weight. (C) Representative images of excised tumors. (D) Western blot analysis of RNF41, CD206, TGF-β1, and VEGFA expression levels in tumor tissues. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
4. Discussion
The intricate regulatory networks among cells within the TME are critical drivers of tumor progression [30]. This study, focusing on the functional mechanisms of EHF in lung cancer, uncovers a novel pathway through which EHF regulates macrophage polarization via the exosome-RNF41 axis, offering new insights into the malignant advancement of lung cancer.
The aberrant overexpression of EHF in lung cancer tissues and its association with M2-polarized macrophage infiltration provide a foundational basis for exploring the mechanisms addressed in this study. Prior research has demonstrated that EHF is overexpressed in diverse malignancies, including breast and liver cancer, and drives malignant traits [25,31]. In contrast, this study demonstrated that EHF was significantly upregulated in lung cancer (encompassing LUAD and LUSC subtypes), with a specific positive correlation with M2 macrophage infiltration and a negative correlation with M1 subtype infiltration. M2-polarized macrophages are known to promote immune suppression, angiogenesis, and tumor invasion by secreting cytokines such as TGF-β1 and IL-10 [[32], [33], [34]]. M2-polarized macrophages promote lung cancer progression through multiple key pathways: they secrete abundant pro-tumorigenic factors including TGF-β1, IL-10, and VEGFA, which directly enhance the proliferation, migration, and invasion of lung cancer cells in a paracrine manner while inhibiting apoptosis. Meanwhile, VEGFA derived from M2 macrophages accelerates tumor angiogenesis by promoting the tube formation ability of vascular endothelial cells, providing sufficient nutrients and metastatic routes for tumor growth. In addition, M2 macrophages exert strong immunosuppressive effects by inhibiting the activation and infiltration of anti-tumor immune cells such as T cells and NK cells, thereby enabling lung cancer cells to evade immune surveillance and proliferate continuously (Fig. 8). The close association between EHF and M2-polarized macrophage infiltration observed herein indicates that EHF functions extend beyond regulating intrinsic tumor cell phenotypes to indirectly drive lung cancer progression by remodeling the immune microenvironment. This aligns with findings by Zheng et al. in gastric cancer (GC), who reported that ELK4, another ETS family member, promotes GC progression by transcriptionally activating downstream molecules to induce macrophage M2 polarization [35]. Additionally, this study identified a consistent association between RNF41 and M2 infiltration, offering clues for subsequent investigations into their functional synergy.
Fig. 8.
Schematic diagram of the mechanism by which lung cancer cell-derived exosomal EHF promotes M2 macrophage polarization and accelerates lung cancer progression.
Cell-to-cell communication represents the core of tumor microenvironment regulation. Exosomes, as “natural carriers” of bioactive molecules, play an irreplaceable role in signal transmission between tumor cells and immune cells [36]. This study confirmed that exosomes secreted by lung cancer cells packaged EHF and were taken up by macrophages. Moreover, EHF carried by exosomes significantly promoted the polarization of THP-1-M0 macrophages toward the M2 phenotype, while enhancing their capacity to secrete pro-tumor cytokines (TGF-β1, IL-10, and VEGFA). Exosome-mediated transfer of EHF to macrophages represents a pivotal finding of this study. As “messengers” in intercellular communication, exosomes are well-established to shuttle molecules like miRNAs and proteins for tumor regulation; however, reports on exosomal transfer of transcription factors remain scarce [37,38]. For instance, Skog et al. revealed that glioblastoma exosomes carry mRNAs and proteins to drive angiogenesis [39], and Ma et al. demonstrated that mutant p53 can be transferred via small extracellular vesicles to induce fibroblast activation [40]. Herein, this study unambiguously shows that the transcription factor EHF can be taken up by macrophages through exosomes, adding novel evidence to exosome-mediated transcriptional regulation. Whereas earlier investigations have indicated that cytokines released by M2-polarized macrophages are capable of driving tumor invasion and angiogenesis [41], this study identified exosomal EHF as a key upstream initiator of this process. The conditioned medium from EHF-induced M2 macrophages not only enhanced tumor cell proliferation and migration but also significantly promoted tube formation in HUVECs, consistent with observations by Xiang et al. that exosomes induce macrophages to secrete pro-angiogenic factors [42].
Having clarified the role of exosomal EHF, this study further elucidated the molecular targets through which exosomal EHF regulates macrophage polarization. EHF directly binds to the RNF41 promoter region and upregulates RNF41 expression via transcriptional activation. Rescue experiments further demonstrated that RNF41 overexpression reverses the suppressive impact of EHF-knockdown exosomes on M2 polarization, and concurrently reinstates their ability to drive tumor cell proliferation, migration, and angiogenesis. Previous studies have delineated partial roles of RNF41 (also known as Nrdp1) in immune cell polarization: for instance, Shao et al. revealed in a murine model of intracerebral hemorrhage (ICH) that miRNA-494 enhances M1 macrophage polarization by regulating RNF41 [43]; Wu et al. also confirmed that RNF41 is involved in inflammation-associated macrophage polarization processes (e.g., immune responses post-intracerebral hemorrhage) via ubiquitination [44]. In oncology, however, research on RNF41 has largely centered on its role as an E3 ubiquitin ligase mediating ubiquitination [[45], [46], [47]]. By comparison, this study identified that RNF41 mediated M2 macrophage polarization and immune microenvironment remodeling in lung cancer. This finding not only broadens the biological functional repertoire of RNF41 but also provides a new molecular paradigm for understanding how transcription factors regulate immune cell phenotypes through ubiquitination pathways. In vivo findings further confirmed the physiological relevance of the aforementioned mechanism. EHF knockout markedly suppressed lung cancer xenograft growth and concurrently reduced intratumoral expression of RNF41 and M2-associated molecules, with results consistent with those observed in vitro. These observations indicate that the EHF-RNF41 pathway is also involved in regulating the tumor microenvironment in vivo, thereby offering in vivo evidence to support its clinical relevance.
Clinically, EHF or RNF41 may be potential therapeutic targets. Inhibiting EHF expression or blocking its exosomal transfer could reduce M2 polarization and reverse immunosuppression; RNF41-targeting small-molecule inhibitors might also synergize with existing immunotherapies by disrupting the EHF-RNF41 axis. Limitations of this study include incomplete elucidation of RNF41's specific downstream signaling pathways, which require further exploration via RNA sequencing or phosphoproteomics. Additionally, whether other exosomal components (e.g., miRNAs, lipids) beyond EHF synergize in regulating macrophages needs more comprehensive omics analyses. Future work combining single-cell sequencing to decipher the dynamic roles of the EHF-RNF41 axis in distinct TME cell subsets may yield a more detailed molecular atlas for precision therapy.
In summary, this study clarifies the molecular mechanism through which lung cancer cell-originated exosomal EHF promotes M2 macrophage polarization by transcriptionally activating RNF41 in macrophages, thereby driving lung cancer malignancy. This regulatory axis ultimately promotes lung cancer progression by enhancing pro-tumor cytokine secretion, facilitating tumor angiogenesis, and suppressing anti-tumor immunity, which constitute the core mechanisms by which macrophage polarization accelerates lung cancer development. This finding not only broadens EHF's functional role in TME regulation and highlights exosomes' critical function as transcription factor carriers, but also establishes the novel “exosomal EHF-RNF41-M2 polarization” regulatory axis. It offers new perspectives on the immune microenvironment mechanisms underpinning lung cancer progression and identifies promising molecular targets for lung cancer targeted therapy and immunotherapy. Future research should further investigate this pathway's relevance in clinical samples and assess the feasibility of targeted interventions, aiming to lay a foundation for improving lung cancer patient prognosis.
Ethics approval and consent to participate
This study was carried out in strict accordance with the relevant regulations and requirements of the Declaration of Helsinki. Written informed consents were obtained from all participants and this study was permitted by the Ethics Committee of the People's Hospital of Beilun District, Beilun Branch Hospital of the First Affiliated Hospital of Medical School of Zhejiang University.
Consent for publication
Not applicable.
Authors’ contributions
Zhongjie Chen designed and performed the research; Junjie Ying, Gang Huang, Wenjun Shang, Ke Shi, Ze Wang, Li Wang, Dongxiao Ding, Chong Zhang, Yizheng Tan analyzed the data; Zhongjie Chen wrote the manuscript. All authors read and approved the final manuscript.
Funding
This work was supported by Ningbo Municipal Health Science and Technology Program (Grant recipient: 2024Y39)
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements
None.
Footnotes
Peer review under responsibility of the Japanese Society for Regenerative Medicine.
Supplementary data to this article can be found online at https://doi.org/10.1016/j.reth.2026.101104.
Appendix A. Supplementary data
The following is/are the supplementary data to this article:
Fig. S1.
EHF and RNF41 expression correlate with M2 macrophage infiltration in lung cancer. (A) Scatter plot of EHF expression (log2 TPM) versus M1 macrophage infiltration (XCELL algorithm) in LUSC, showing a negative correlation (Rho = −0.13, P = 4.44e-03). (B-D) Scatter plots of EHF expression versus M2 macrophage infiltration in LUAD, analyzed by the CIBERSORT (B, Rho = 0.129, P = 4.9e-03), CIBERSORT-ABS (C, Rho = 0.153, P = 6.66e-04), and QUANTISEQ (D, Rho = 0.155, P = 5.43e-04) algorithms, all demonstrating positive correlations. (E-H) Scatter plots of RNF41 expression versus M2 macrophage infiltration: (E) LUAD (CIBERSORT, Rho = 0.231, P = 1.64e-07), (F) LUSC (CIBERSORT, Rho = 0.185, P = 4.06e-05), (G) LUAD (CIBERSORT-ABS, Rho = 0.211, P = 2.41e-06), and (H) LUSC (CIBERSORT-ABS, Rho = 0.209, P = 4.48e-06), with consistent positive associations across algorithms and cancer types. Data are presented as mean ± SD. P < 0.05 denotes statistical significance.
Data availability
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.
References
- 1.Leiter A., Veluswamy R.R., Wisnivesky J.P. The global burden of lung cancer: current status and future trends. Nat Rev Clin Oncol. 2023;20(9):624–639. doi: 10.1038/s41571-023-00798-3. [DOI] [PubMed] [Google Scholar]
- 2.Zhou J., Xu Y., Liu J., Feng L., Yu J., Chen D. Global burden of lung cancer in 2022 and projections to 2050: incidence and mortality estimates from GLOBOCAN. Cancer Epidemiol. 2024;93 doi: 10.1016/j.canep.2024.102693. [DOI] [PubMed] [Google Scholar]
- 3.Tu Z., Liao S. The long-term spatiotemporal trends in lung cancer burden and its risk factors at global, regional, and national levels, 1992-2021: the global burden of disease study 2021. Cancer Commun. 2024;44(12):1418–1421. doi: 10.1002/cac2.12622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Vinod S.K., Hau E. Radiotherapy treatment for lung cancer: current status and future directions. Respirology. 2020;25(S2):61–71. doi: 10.1111/resp.13870. [DOI] [PubMed] [Google Scholar]
- 5.Rongde X., Jingjing C., Daohua C., Xiaobo Z., Wei C., Yi D., Danxiong S., Bing Y., Jing L. CT-guided percutaneous microwave ablation combined with local radiotherapy or chemotherapy of malignant pulmonary tumors. Curr Rad. 2024;17(2):184–199. doi: 10.2174/0118744710261655231214105406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zulfiqar B., Farooq A., Kanwal S., Asghar K. Immunotherapy and targeted therapy for lung cancer: current status and future perspectives. Front Pharmacol. 2022;13 doi: 10.3389/fphar.2022.1035171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Araghi M., Mannani R., Heidarnejad maleki A., Hamidi A., Rostami S., Safa S.H., Faramarzi F., Khorasani S., Alimohammadi M., Tahmasebi S., et al. Recent advances in non-small cell lung cancer targeted therapy; an update review. Cancer Cell Int. 2023;23(1):162. doi: 10.1186/s12935-023-02990-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang Q., Shao X., Zhang Y. Role of tumor microenvironment in cancer progression and therapeutic strategy. Cancer Med. 2023;12(10):11149–11165. doi: 10.1002/cam4.5698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.He Z., Zhang S. Tumor-associated macrophages and their functional transformation in the hypoxic tumor microenvironment. Front Immunol. 2021;12 doi: 10.3389/fimmu.2021.741305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Christofides A., Strauss L., Yeo A., Cao C., Charest A., Boussiotis V.A. The complex role of tumor-infiltrating macrophages. Nat Immunol. 2022;23(8):1148–1156. doi: 10.1038/s41590-022-01267-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wang Q., Ma W. Revisiting TAM polarization: beyond M1- and M2-type TAM toward clinical precision in macrophage-targeted therapy. Exp Mol Pathol. 2025;143 doi: 10.1016/j.yexmp.2025.104982. [DOI] [PubMed] [Google Scholar]
- 12.Pan Y., Yu Y., Wang X., Zhang T. Tumor-associated macrophages in tumor immunity. Front Immunol. 2020;11 doi: 10.3389/fimmu.2020.583084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Peng M., Zhu Y., Hu Y., Wen J., Huang W. Advances in the regulation of macrophage polarization by the tumor microenvironment. Discov Oncol. 2025;16(1):1487. doi: 10.1007/s12672-025-03258-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Cao L., Che X., Qiu X., Li Z., Yang B., Wang S., Hou K., Fan Y., Qu X., Liu Y. M2 macrophage infiltration into tumor islets leads to poor prognosis in non-small-cell lung cancer. Cancer Manag Res. 2019;11:6125–6138. doi: 10.2147/CMAR.S199832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Gurung S., Perocheau D., Touramanidou L., Baruteau J. The exosome journey: from biogenesis to uptake and intracellular signalling. Cell Commun Signal. 2021;19(1):47. doi: 10.1186/s12964-021-00730-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Théry C., Zitvogel L., Amigorena S. Exosomes: composition, biogenesis and function. Nat Rev Immunol. 2002;2(8):569–579. doi: 10.1038/nri855. [DOI] [PubMed] [Google Scholar]
- 17.Chavda V.P., Pandya A., Kumar L., Raval N., Vora L.K., Pulakkat S., Patravale V., Salwa Duo Y., Tang B.Z. Exosome nanovesicles: a potential carrier for therapeutic delivery. Nano Today. 2023;49 [Google Scholar]
- 18.Jella K.K., Nasti T.H. Exosomes, their biogenesis and role in inter-cellular communication, tumor microenvironment and cancer immunotherapy. Vaccines. 2018;6(4) doi: 10.3390/vaccines6040069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li Y., You J., Zou Z., Sun G., Shi Y., Sun Y., Xu S., Zhang X. Decoding the tumor microenvironment: exosome-mediated macrophage polarization and therapeutic frontiers. Int J Biol Sci. 2025;21(9):4187–4214. doi: 10.7150/ijbs.114222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Qi R., Zhao Y., Guo Q., Mi X., Cheng M., Hou W., Zheng H., Hua B. Exosomes in the lung cancer microenvironment: biological functions and potential use as clinical biomarkers. Cancer Cell Int. 2021;21(1):333. doi: 10.1186/s12935-021-01990-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Yu M.Y., Jia H.J., Zhang J., Ran G.H., Liu Y., Yang X.H. Exosomal miRNAs-mediated macrophage polarization and its potential clinical application. Int Immunopharmacol. 2023;117 doi: 10.1016/j.intimp.2023.109905. [DOI] [PubMed] [Google Scholar]
- 22.Sakamoto K., Endo K., Sakamoto K., Kayamori K., Ehata S., Ichikawa J., Ando T., Nakamura R., Kimura Y., Yoshizawa K., et al. EHF suppresses cancer progression by inhibiting ETS1-mediated ZEB expression. Oncogenesis. 2021;10(3):26. doi: 10.1038/s41389-021-00313-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Gu M.L., Zhou X.X., Ren M.T., Shi K.D., Yu M.S., Jiao W.R., Wang Y.M., Zhong W.X., Ji F. Blockage of ETS homologous factor inhibits the proliferation and invasion of gastric cancer cells through the c-Met pathway. World J Gastroenterol. 2020;26(47):7497–7512. doi: 10.3748/wjg.v26.i47.7497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gao L., Yang T., Zhang S., Liang Y., Shi P., Ren H., Hou P., Chen M. EHF enhances malignancy by modulating AKT and MAPK/ERK signaling in non-small cell lung cancer cells. Oncol Rep. 2021;45(6) doi: 10.3892/or.2021.8053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wei S., Zhao S., Yang W., Zhou J., Xu G., Zhang C., Wang M., Xiao H., Feng Y., Shang L., et al. EHF promotes liver cancer progression by meditating IL-6 secretion through transcription regulation of KDM2B in TAMs. Cell Signal. 2025;129 doi: 10.1016/j.cellsig.2025.111670. [DOI] [PubMed] [Google Scholar]
- 26.Sun W., Wang Z., Qin Y., Ji X., Huang J., Zhang F., Wang Z., Dong W., He L., Zhang H. NEAT1_2/RRAD/EHF positive feedback loop facilitates aerobic glycolysis in papillary thyroid cancer cells. Endocrinology. 2023;164(7) doi: 10.1210/endocr/bqad085. [DOI] [PubMed] [Google Scholar]
- 27.Cai C., Tang Y.-D., Zhai J., Zheng C. The RING finger protein family in health and disease. Signal Transduct Tar. 2022;7(1):300. doi: 10.1038/s41392-022-01152-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Zheng F., Li S., Xiong S., Li Z., Yuan R., Wang Z., Wan H., Liu J., Dong Q., Liu X., et al. Loss of RNF41 promotes bladder cancer metastasis through increasing NUDC stability to enhance tubulin polymerization. Cell Death Dis. 2025;16(1):443. doi: 10.1038/s41419-025-07758-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Xiong S., Li S., Li Z., Song Y., Yang L., Yang H., Xiong J., Pan W., Guo J., Fu B., et al. A noncanonical E3 ubiquitin ligase RNF41-mediated MYO1C stability promotes prostate cancer metastasis by inducing actin remodeling. Oncogene. 2024;43(36):2696–2707. doi: 10.1038/s41388-024-03120-2. [DOI] [PubMed] [Google Scholar]
- 30.Desai S.A., Patel V.P. The tumor microenvironment: shaping cancer progression and treatment response. J Chemother. 2025;37(1):15–44. doi: 10.1080/1120009X.2023.2300224. [DOI] [PubMed] [Google Scholar]
- 31.Lim S., Lim J. Anticancer effect of E26 transformation-specific homologous factor through the induction of senescence and the inhibition of epithelial-mesenchymal transition in triple-negative breast cancer cells. Cancers. 2023;15(21) doi: 10.3390/cancers15215270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yang Y., Li S., To K.K.W., Zhu S., Wang F., Fu L. Tumor-associated macrophages remodel the suppressive tumor immune microenvironment and targeted therapy for immunotherapy. J Exp Clin Cancer Res. 2025;44(1):145. doi: 10.1186/s13046-025-03377-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Liu F., Li X., Zhang Y., Ge S., Shi Z., Liu Q., Jiang S. Targeting tumor-associated macrophages to overcome immune checkpoint inhibitor resistance in hepatocellular carcinoma. J Exp Clin Cancer Res. 2025;44(1):227. doi: 10.1186/s13046-025-03490-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Liu Z., Kuang W., Zhou Q., Zhang Y. TGF-β1 secreted by M2 phenotype macrophages enhances the stemness and migration of glioma cells via the SMAD2/3 signalling pathway. Int J Mol Med. 2018;42(6):3395–3403. doi: 10.3892/ijmm.2018.3923. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zheng L., Xu H., Di Y., Chen L., Liu J., Kang L., Gao L. ELK4 promotes the development of gastric cancer by inducing M2 polarization of macrophages through regulation of the KDM5A-PJA2-KSR1 axis. J Transl Med. 2021;19(1):342. doi: 10.1186/s12967-021-02915-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Li Q. Role of exosomes in cellular communication between tumor cells and the tumor microenvironment. Oncol Lett. 2022;24(1):240. doi: 10.3892/ol.2022.13360. (Review) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Li B., Cao Y. Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy. FASEB J. 2021;35(10) doi: 10.1096/fj.202100294RR. official publication of the Federation of American Societies for Experimental Biology. [DOI] [PubMed] [Google Scholar]
- 38.Kalluri R., LeBleu V.S. The biology, function, and biomedical applications of exosomes. Science. 2020;367(6478) doi: 10.1126/science.aau6977. eaau6977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Skog J., Würdinger T., van Rijn S., Meijer D.H., Gainche L., Sena-Esteves M., Curry W.T., Jr., Carter B.S., Krichevsky A.M., Breakefield X.O. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 2008;10(12):1470–1476. doi: 10.1038/ncb1800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Ma S., McGuire M.H., Mangala L.S., Lee S., Stur E., Hu W., Bayraktar E., Villar-Prados A., Ivan C., Wu S.Y., et al. Gain-of-function p53 protein transferred via small extracellular vesicles promotes conversion of fibroblasts to a cancer-associated phenotype. Cell Rep. 2021;34(6) doi: 10.1016/j.celrep.2021.108726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Vitale I., Manic G., Coussens L.M., Kroemer G., Galluzzi L. Macrophages and metabolism in the tumor microenvironment. Cell Metab. 2019;30(1):36–50. doi: 10.1016/j.cmet.2019.06.001. [DOI] [PubMed] [Google Scholar]
- 42.Xiang X., Pathak J.L., Wu W., Li J., Huang W., Wu Q., Xin M., Wu Y., Huang Y., Ge L., et al. Human serum-derived exosomes modulate macrophage inflammation to promote VCAM1-mediated angiogenesis and bone regeneration. J Cell Mol Med. 2023;27(8):1131–1143. doi: 10.1111/jcmm.17727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Shao G., Zhou C., Ma K., Zhao W., Xiong Q., Yang L., Huang Z., Yang Z. MiRNA-494 enhances M1 macrophage polarization via Nrdp1 in ICH mice model. J Inflamm. 2020;17:17. doi: 10.1186/s12950-020-00247-3. (London, England) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wu X., Chen Z., Chen Q., Lin C., Zheng X., Yuan B. Nrdp1-mediated macrophage phenotypic regulation promotes functional recovery in mice with mild neurological impairment after intracerebral hemorrhage. Neuroscience. 2024;545:16–30. doi: 10.1016/j.neuroscience.2024.02.028. [DOI] [PubMed] [Google Scholar]
- 45.Lian Y.F., Huang Y.L., Zhang Y.J., Chen D.M., Wang J.L., Wei H., Bi Y.H., Jiang Z.W., Li P., Chen M.S., et al. CACYBP enhances cytoplasmic retention of P27(Kip1) to promote hepatocellular carcinoma progression in the absence of RNF41 mediated degradation. Theranostics. 2019;9(26):8392–8408. doi: 10.7150/thno.36838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Wauman J., De Ceuninck L., Vanderroost N., Lievens S., Tavernier J. RNF41 (Nrdp1) controls type 1 cytokine receptor degradation and ectodomain shedding. J Cell Sci. 2011;124(6):921–932. doi: 10.1242/jcs.078055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Wu Y., Wang L., Bao H., Zou S., Fu C., Gong H., Gao Y., Tang Y., Yu R., Shi H. Nrdp1S, short variant of Nrdp1, inhibits human glioma progression by increasing Nrdp1-mediated ErbB3 ubiquitination and degradation. J Cell Mol Med. 2016;20(3):422–429. doi: 10.1111/jcmm.12735. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.












