ABSTRACT
Methotrexate (MTX) is a medication that is frequently prescribed for the treatment of both malignant disorders and inflammatory pathologies. However, its use is limited by dose‐dependent pulmonary toxicity. The present study investigated the protective effects of silymarin (SLM) against MTX‐induced lung injury by evaluating apoptosis, oxidative stress, autophagy, inflammation and histopathological changes in rats. Twenty‐eight Wistar albino rats were assigned to the Control, SLM (50 mg/kg, p. o.), MTX (20 mg/kg, i. p.), and MTX + SLM groups. MTX treatment led to a significant elevation in malondialdehyde levels along with marked reductions in glutathione content and antioxidant enzyme activities, concomitant with decreased Nrf2 and HO‐1 expression, indicating pronounced oxidative stress (p < 0.05). Additionally, MTX has been shown to raise Bax and Caspase‐3 and diminish Bcl‐2 while simultaneously inducing NF‐κB, TNF‐α, TLR‐4, and HMGB1. This confirms the presence of increased inflammation and mitochondrial‐dependent apoptosis (p < 0.05). Furthermore, MTX elevated the expression of LC3A, LC3B, and Beclin‐1, suggesting an increase in autophagy (p < 0.05). SLM supplementation greatly improved antioxidant status, increased Nrf2/HO‐1, decreased inflammatory signaling, modulated Caspase‐3/Bax/Bcl‐2 expression, and suppressed MTX‐induced autophagy (p < 0.05). These biochemical findings were subsequently corroborated by histopathological analysis. In summary, the present study demonstrates that SLM offers a promising protective effect against MTX‐induced pulmonary damage, operating through mechanisms involving antioxidant, anti‐autophagic, anti‐inflammatory and anti‐apoptotic actions. These results underscore the potential of SLM as a complementary therapeutic agent in mitigating lung toxicity induced by chemotherapy agents.
Keywords: inflammation, lung injury, methotrexate, oxidative stress, silymarin
Methotrexate (MTX) induces oxidative stress–related lung injury through excessive reactive oxygen species (ROS) production, leading to inflammation, apoptosis, and impaired autophagy. MTX increases lipid peroxidation and disrupts antioxidant defenses (MDA, GSH, SOD, GPx, CAT), while activating inflammatory and apoptotic pathways including TNF‐α, NF‐κB, TLR‐4, HMGB1, IL‐6, JAK2/STAT3, Bax, and caspase‐3, along with alterations in autophagy markers (LC3A, LC3B, Beclin‐1). Silymarin (SLM) alleviates MTX‐induced pulmonary toxicity by activating the Nrf2/HO‐1 pathway, restoring redox homeostasis, suppressing inflammatory and apoptotic signaling, and regulating autophagy, resulting in improved histopathological lung injury scores.

1. Introduction
Methotrexate (MTX) is a key agent that suppresses cell proliferation by interfering with folate metabolism. It has both antineoplastic and immunosuppressive properties. It is widely used in the management of malignant conditions and long‐term inflammatory diseases, such as psoriasis and rheumatoid arthritis [1]. On the other hand, severe side effects such as gastrointestinal issues, hepatic dysregulation, pneumonia, hematological problems, infections, nephrotoxicity, dermatitis, and other illnesses might be brought on by prolonged usage or large dosages of MTX [2]. MTX‐related lung toxicity is among the most serious and unpredictable of these side effects, manifesting as interstitial pneumonia, alveolar damage, or progressive fibrosis [3]. Evidence shows that MTX significantly increases oxidative stress, which plays a central role in triggering lipid peroxidation, inflammatory activation, and subsequent lung tissue damage [4]. The lung damage caused by MTX through oxidative stress and inflammation indicates a clear need for therapeutic agents that can modulate these pathological processes.
Silymarin (SLM) has emerged as a phytochemical compound of growing interest in the management of lung injury, largely attributed to its strong antioxidant and anti‐inflammatory activities [5]. SLM treatment promotes upregulation of major antioxidant enzymes, such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx). In parallel, it suppresses lipid peroxidation by reducing intracellular reactive oxygen species (ROS) levels [6]. Additionally, SLM suppresses nuclear factor kappa B (NF‐κB), which lowers levels of tumor necrosis factor alpha (TNF‐α), interleukin (IL)−1β and IL‐6 activation [7]. The multifaceted biological effects observed suggest that SLM may represent an effective therapeutic approach for lung injury induced by toxic agents such as MTX.
In consideration of the aforementioned data, the objective of this study is to evaluate the therapeutic potential of SLM in the treatment of MTX‐induced lung injury. Investigating SLM's regulatory effects on oxidative stress markers, antioxidant defense enzymes, inflammatory cytokine response, and lung tissue integrity will contribute to a better understanding of protective mechanisms against MTX‐induced pulmonary toxicity.
2. Materials and Methods
2.1. Chemicals
Koçak Farma (İstanbul, Türkiye) provided MTX (50 mg/5 mL injectable solution). All of the analytical‐grade compounds used in this investigation, including SLM, bought from Sigma‐Aldrich compounds (St. Louis, MO, USA).
2.2. Animals
The present study was conducted on a sample of 28 female Wistar albino rats aged between 8 and 9 weeks and weighing between 180 and 200 g. The rats were obtained from the Experimental Research Center of Bingöl University. The animals were maintained in standard polypropylene cages under regulated laboratory conditions, including a controlled 12 h dark/light photoperiod, room temperature of 24°C ± 1°C, and humidity of 50% ± 5%. During the experimental period, rats were fed a standard commercial pellet diet and provided with unlimited access to drinking water. All animal‐related experimental protocols were evaluated and approved by the Bingöl University Animal Experiments Ethics Committee (Protocol Number: 2025, E‐85680299). The rats were randomly divided into four groups of seven female rats each:
Control: A single i. p. administration of physiological saline was performed on Day 1.
SLM: For 7 days, the animals received oral SLM (50 mg/kg b.w./day).
MTX: A single i. p. injection of MTX (20 mg/kg) was performed on Day 1.
MTX + SLM: Rats were administered a single i. p. dose of MTX (20 mg/kg) on Day 1, followed by oral administration of SLM at 50 mg/kg for 7 consecutive days.
Lung tissues were taken 24 h after last SLM injection (day eight), and rats were put to death by beheading while under light sevoflurane anesthesia. After being removed, the tissues were cleaned of any remaining blood, cleansed with physiological saline, patted dry with filter paper, and then kept at −86°C until additional biochemical and molecular tests were carried out.
2.3. Preparation of Homogenates
Liquid nitrogen‐powdered lung tissues were homogenized and diluted with 1.15% KCl for examination of MDA, GPx and GSH. The homogenates were centrifuged for 15 min at 3.500 rpm to test MDA levels, and for 20 min at 11.000 rpm to assess GPx activity and GSH levels. The supernatant was utilized for the analysis. Lung tissue was homogenized, diluted with Tris‐HCl Buffer (pH: 7.4), and centrifuged at 7.000 rpm for 1 h to determine SOD activity. The supernatant was then utilized for analysis. The lung tissue was homogenized, spun at 3500 rpm for 10 min, and diluted with Triton‐x‐100 to measure CAT activity. Analyses were performed using the supernatant fraction.
2.4. Analysis of Oxidative Stress Markers
By measuring MDA levels, the procedure created by Placer et al. [8] was used to compute the lipid peroxidation level. Sun et al.‘s approach [9] was used to assess SOD activity. Aebi's technique was used to measure CAT activity [10]. Matkovics’ approach [11] was used to measure GPx activity. The Sedlak and Lindsay method [12] was used for GSH measurement, and protein quantification was performed according to Lowry et al. [13].
2.5. ELISA‐Based Analysis of Nrf2‐HO‐1 Levels in Lung Tissue
To determine nuclear factor erythroid 2–related factor 2 (Nrf2) and heme oxygenase‐1 (HO‐1) levels, lung tissue samples were homogenized in 0.1 M phosphate buffer (pH: 7.4) using a TissueLyser device (TissueLyser II, Qiagen). Analysis was done using the homogenates’ supernatants. A commercial ELISA kit (Elabscience, Cat No: E‐EL‐R1052) was used to assess Nrf2 levels, while a Sunred ELISA kit (Cat No: 201‐11‐0677) was used to measure HO‐1 levels. Every process was completed in accordance with the manufacturer's guidelines. Optical density at 450 nm was measured with ELISA reader (Bio‐Tek, Winooski, VT, USA).
2.6. Quantitative Real‐Time PCR Analysis
The mRNA expression levels of Bcl‐2, Bax, caspase‐3, TNF‐α, and NF‐κB were analyzed using gene‐specific primers listed in Table 1. Additionally, the expression of TLR‐4, HMGB1, IL‐6, JAK2, STAT3, LC3A, LC3B, and Beclin‐1 was evaluated using the same set of primers. Total RNA was extracted from tissue samples using QIAzol Lysis Reagent (Qiagen, Germany; Cat. No. 79306). RNA concentrations were normalized across samples, and RNA purity and quantity were assessed with a NanoDrop spectrophotometer (BioTek Instruments, EPOCH, USA). Complementary DNA (cDNA) was synthesized using the iScript cDNA Synthesis Kit (Bio‐Rad, USA) according to the manufacturer's instructions. The qRT‐PCR was carried out on a Rotor‐Gene Q system (Qiagen, Germany) using iTaq Universal SYBR Green Supermix (Bio‐Rad, USA). GAPDH served as the internal reference gene, and all reactions were performed in triplicate. Relative mRNA expression was determined using the 2⁻ΔΔCt method as described by Livak and Schmittgen [14].
Table 1.
Primer sequences.
| Gene | Sequences (5′–3′) | Length (bp) | Accession no. |
|---|---|---|---|
| TNF‐α | F: TCGAGTGACAAGCCCGTAG | 139 | NM_012675.3 |
| R: ATCTGCTGGTACCACCAGTT | |||
| NF‐κB | F: AGTCCCGCCCCTTCTAAAAC | 106 | NM_001276711.1 |
| R: CAATGGCCTCTGTGTAGCCC | |||
| TLR‐4 | F: GCTCTGCCAAGTCTCAGATA | 160 | NM_019178.2 |
| R: GCTCTTCTAGACCCATGAAG | |||
| HMGB1 | F: TCCTTCGGCCTTCTTCTTGT | 152 | NM_012963.2 |
| R: CGGCCTTCTTTTCATAGGGC | |||
| Bcl‐2 | F: ACTTTGCAGAGATGTCCAG | 214 | NM_016993.2 |
| R: CAGGTACTCAGTCATCCAC | |||
| Bax | F: TCATCCAGGATCGAGCAG | 154 | NM_017059.2 |
| R: ATCATCCTCTGCAGCTCCA | |||
| Caspase‐3 | F: CTGGAATGTCAGCTCGCAA | 270 | NM_012922.2 |
| R: CAGTAGTCGCCTCTGAAGA | |||
| LC3A | F: GACCATGTTAACATGAGCGA | 139 | NM_199500.2 |
| R: CCTGTTCATAGATGTCAGCG | |||
| LC3B | F: GAGCTTCGAACAAAGAGTGG | 152 | NM_022867.2 |
| R: CGCTCATATTCACGTGATCA | |||
| Beclin‐1 | F: TCTCGTCAAGGCGTCACTTC | 198 | NM_053739.2 |
| R: CCATTCTTTAGGCCCCGACG | |||
| IL‐6 | F: AGCGATGATGCACTGTCAGA | 127 | NM_012589.2 |
| R: GAACTCCAGAAGACCAGAGC | |||
| JAK2 | F: TAGGTACGGAGTATCTCGTG | 215 | NM_031514.1 |
| R: TGGAGTTATAGACAGCCAGG | |||
| STAT3 | F: TACCTGGAGCAGCTTCATCA | 153 | NM_012747.2 |
| R: GATCTCGCCCAAGAGGTTAT | |||
| GAPDH | F: AGTATGTCGTGGAGTCTAC | 179 | NM_017008.4 |
| R: AGGATGCATTGCTGACAAT |
2.7. Histopathological Evaluation
Rats were decapitated at the conclusion of the experiment, and lung tissues were removed and preserved in 10% neutral buffered formalin for histological analysis. After being fixed for around 72 h, tissue samples were embedded in paraffin blocks (Leica EG 1150 H, Wetzlar, Germany) and processed via graded alcohol and xylene series using a standard tissue processor (Leica TP 1020, Wetzlar, Germany).
Sections of 3–5 µm thickness were prepared from paraffin‐embedded tissue blocks using a Leica RM2125 rotary microtome (Wetzlar, Germany). Using a Leica Autostainer XL (Wetzlar, Germany), tissue sections were processed for H&E staining following Luna's standard method [15]. A light microscope (Olympus BX43, Tokyo, Japan) was used to view stained slides, and typical microscopic pictures were captured.
Lung tissue histopathology was assessed using a semi‐quantitative scoring system. The assessment criteria included alveolar septal thickening, inflammatory cell infiltration, alveolar edema, hemorrhage, and disruption of alveolar structural integrity. Histopathological alterations were scored using a simplified semi‐quantitative scale ranging from 0 to 4, based on the experimental acute lung injury criteria defined by the American Thoracic Society (Table 2) [16].
Table 2.
Lung injury score table.
| Score | Histopathological findings |
|---|---|
| 0 | Normal lung histology |
| 1 | Mild inflammation |
| 2 | Moderate inflammation and mild alveolar septal thickening/edema |
| 3 | Severe inflammation, marked alveolar septal thickening, and alveolar edema |
| 4 | Widespread tissue damage, alveolar destruction, edema, congestion |
2.8. Statistical Analysis
Data normality was evaluated using the Shapiro–Wilk test, and homogeneity of variances was assessed with Levene's test. For normally distributed data with equal variances, one‐way ANOVA followed by Tukey's HSD post‐hoc test was applied to determine pairwise group differences. When variances were unequal but data were normally distributed, Welch's ANOVA with Games‐Howell post‐hoc comparisons was used. Data that did not follow a normal distribution were analyzed using the Kruskal–Wallis test, followed by Dunn's post‐hoc test for multiple comparisons. Results are expressed as mean ± SEM for data following a normal distribution and as median±range for data that do not. All statistical analyses were performed using IBM SPSS v22.0 [17], and p < 0.05 was considered statistically important.
3. Results
3.1. Evaluation of Oxidant/Antioxidant Status
Table 3 shows the oxidant (MDA) and antioxidant (SOD, CAT, GPx, and GSH) parameters tested in target tissue. The biochemical results showed that MTX treatment significantly decreased GSH levels in lung tissue (p < 0.05) and suppressed the activities of the enzyme antioxidants GPx, CAT and SOD.
Table 3.
Oxidative stress markers in lung tissue.
| Parameters | Groups () | p value | |||
|---|---|---|---|---|---|
| Control | SLM | MTX | MTX + SLM | ||
| MDA (nmol/g tissue) | 36.65 ± 0.68 c | 34.4 ± 0.78 c | 59.67 ± 0.85 a | 42.46 ± 0.83 b | < 0.001 |
| GSH (nmol/g tissue) | 4.97 ± 0.18 a | 5.36 ± 0.16 a | 2.78 ± 0.15 c | 3.86 ± 0.09 b | < 0.001 |
| SOD (U/g protein) | 17.98 ± 1.03 a | 18.96 ± 1.17 a | 9.57 ± 0.94 b | 15.48 ± 1.09 a | < 0.001 |
| GPx (U/g protein) | 19.02 ± 0.71 ab | 20.12 ± 0.36 a | 10.85 ± 0.53 c | 17.16 ± 0.28 b | < 0.001 |
| CAT (catal/g protein) | 21.87 ± 0.84 a | 22.53 ± 0.36 a | 10.38 ± 0.34 c | 17.93 ± 0.52 b | < 0.001 |
Note: a–cThe presence of superscript letters of differing numerical value in the same row is indicative of a statistical difference (p < 0.05).
Abbreviations: CAT, catalase; GPx, glutathione peroxidase; GSH, glutathione; MDA, malondialdehyde; MTX, methotrexate; SLM, Silymarin; SOD, superoxide dismutase.
The data shown in Figure 1 showed that the rats treated with MTX had considerably lower levels of Nrf2 and HO‐1 in their lung tissue compared to the control group (p < 0.05). SLM treatment was shown to raise Nrf2 and HO‐1 levels in comparison to the MTX group (p < 0.05).
Figure 1.

Effects of methotrexate and silymarin administrations on Nrf‐2 (A) and HO‐1 (B) levels in lung tissues of rats. All data were expressed as mean ± SEM. Different letters in the columns (a, b, c) indicate statistically significant differences between groups (p < 0.05). HO‐1, heme oxygenase 1; Nrf2, nuclear factor erythroid 2‐related factor 2.
3.2. Analysis of Inflammatory Markers
The mRNA transcript levels of the inflammatory markers TNF‐α, NF‐κB, TLR‐4, and HMGB‐1 are presented in Figure 2. MTX administration caused a marked upregulation of TNF‐α, NF‐κB, TLR‐4, and HMGB1 expression in lung tissue compared to the control group (p < 0.05), demonstrating the strong pro‐inflammatory effect of MTX. In both SLM‐treated groups, a significant reduction in the transcription levels of these inflammatory parameters was observed when compared with the MTX group (p < 0.05), indicating the anti‐inflammatory efficacy of SLM.
Figure 2.

Effects of methotrexate and silymarin administrations on TNF‐α (A), NF‐κB (B), TLR‐4 (C) and HMGB1 (D) mRNA transcript levels in lung tissues of rats. Values are given as mean ± SEM. Different letters in the columns (a, b, c) indicate statistically significant differences between groups (p < 0.05). HMGB1, High mobility group box 1; NF‐κB, nuclear factor kappa B; TLR‐4, Toll‐like receptor 4; TNF‐α, tumor necrosis factor alpha.
3.3. Evaluation of Apoptosis Status
Figure 3 displays the findings of the RT‐PCR study for Bax, Bcl‐2, and Caspase‐3. The treatment of MTX was reported to cause apoptosis in lung tissue by downregulating the anti‐apoptotic gene Bcl‐2 and upregulating the pro‐apoptotic markers Bax and Caspase‐3 (p < 0.05). On the other hand, compared to the MTX group, SLM co‐administration markedly boosted Bcl‐2 expression and decreased Bax and Caspase‐3 transcription levels (p < 0.05), demonstrating SLM's beneficial anti‐apoptotic activity.
Figure 3.

Effects of methotrexate and silymarin administrations on apoptotic gene expression in lung tissues of rats. (A) Relative mRNA expression level of Bax (Bax/GAPDH). (B) Relative mRNA expression level of Bcl‐2 (Bcl‐2/GAPDH). (C) Relative mRNA expression level of Caspase‐3 (Caspase‐3/GAPDH). Values are expressed as mean ± SEM. Different letters above the columns indicate statistically significant differences between groups (p < 0.05). Bax, Bcl‐2‐associated X protein; Bcl‐2, B‐cell lymphoma 2.
3.4. Investigation of IL‐6‐Mediated JAK2/STAT3 Signaling
Figure 4 displays the JAK2, IL‐6 and STAT3 Real Time‐PCR assay findings. The treatment of MTX significantly raised the levels of JAK2, STAT3, and IL‐6 expression in lung tissue, suggesting that the IL‐6/JAK/STAT signaling pathway was activated. The SLM‐only group and the control group the data set did not exhibit a high degree of variability. (p > 0.05). SLM successfully inhibited MTX‐induced activation of the IL‐6/JAK‐STAT pathway (p < 0.05), as evidenced by the dose‐dependent reduction of IL‐6, JAK2, and STAT3 expression when co‐administered with MTX.
Figure 4.

Effects of methotrexate and silymarin administrations on gene expression levels in lung tissues of rats. (A) Relative mRNA expression level of IL‐6 (IL‐6/GAPDH). (B) Relative mRNA expression level of Nrf2 (Nrf2/GAPDH). (C) Relative mRNA expression level of TNF‐α (TNF‐α/GAPDH). Values are expressed as mean ± SEM. Different letters above the columns indicate statistically significant differences between groups (p < 0.05).
3.5. Evaluation of Autophagy Status
According to the RT‐PCR results presented in Figure 5, MTX injection led to a increase in the expression levels of LC3A, LC3B, and Beclin‐1 compared with both the control and SLM groups (p < 0.05), indicating a pronounced activation of autophagy in lung tissue. Co‐administration of SLM partially suppressed MTX‐induced autophagy, as demonstrated by reduced transcript levels of LC3A, LC3B, and Beclin‐1 in the MTX + SLM group compared with the MTX group (p < 0.05). However, the expression levels in the MTX + SLM group remained significantly than those in the control and SLM groups, showing that SLM ameliorated but did not fully normalize MTX‐induced autophagic activation. No significant differences were observed between the control and SLM groups (p > 0.05).
Figure 5.

Effects of methotrexate and silymarin administrations on autophagy‐related gene expression levels in lung tissues of rats. (A) Relative mRNA expression level of LC3A (LC3A/GAPDH). (B) Relative mRNA expression level of LC3B (LC3B/GAPDH). (C) Relative mRNA expression level of Beclin‐1 (Beclin‐1/GAPDH). Values are expressed as mean ± SEM. Different letters above the columns indicate statistically significant differences between groups (p < 0.05).
3.6. Histopathological Findings
In lung sections from the control group (A), bronchial structures exhibited normal histomorphology with patent bronchial lumens. Areas corresponding to bronchoalveolar lavage fluid (BALF) retained their normal structural characteristics. Alveolar spaces appeared regular, interalveolar septa were thin and within normal limits, and overall alveolar architecture was well preserved (Figure 6).
Figure 6.

Representative histopathological images of lung tissue. (A) Control group showing normal histomorphological appearance of bronchial and alveolar structures; bronchus (*), bronchoalveolar lavage fluid (BALF)‐associated area (black arrow), normal alveolar structure (blue arrow). (B) Silymarin‐treated group displaying mild focal thickening of alveolar septa (black arrow) and hyperemic alveolar capillaries (red arrow). (C) Methotrexate ‐treated group showing severe atelectatic areas within the lung parenchyma accompanied by focal lymphocytic infiltration (*), hyperplastic bronchiole (yellow arrow), desquamation of the bronchiolar epithelium (green arrow), and marked thickening of interalveolar septa (black arrow); normal alveolar structure (blue arrow). (D) Methotrexate + silymarin group demonstrating largely preserved bronchial and BALF tissue architecture, normal alveolar regions (blue arrow), and intact bronchiolar structure (*), with only mild hyperemic alveolar congestion (red arrow). (H&E staining; scale bar = 200 µm; magnification ×4x). Values are given as median ± range. Different letters in the columns (a, b) indicate statistically significant differences between groups (p < 0.05).
In the silymarin‐treated group (B), the alveolar architecture was generally maintained; however, mild focal thickening of the alveolar septa was observed in some regions. Alveolar capillaries exhibited focal hyperemia, but no widespread tissue damage or pronounced inflammatory cell infiltration was detected.
In the MTX‐induced lung injury group (C), extensive structural deterioration of the lung parenchyma was evident. Marked atelectatic areas were observed across large regions, often accompanied by focal lymphocytic infiltration. Bronchiolar hyperplasia and prominent desquamation of the bronchiolar epithelium were noted. In these areas, BALF‐associated structures were lost, indicating disruption of normal tissue integrity. Additionally, pronounced thickening of the interalveolar septa was observed, reflecting severe inflammatory injury.
In contrast, the MTX + SLM treated group (D) exhibited notable histopathological improvement compared with the MTX group. Bronchial structures and BALF‐associated tissue largely preserved their normal histological appearance, and alveolar regions appeared regular. Mild hyperemic congestion was observed in alveolar capillaries; however, overall lung architecture was substantially protected.
4. Discussion
MTX is frequently used in the clinical treatment of various cancers as well as chronic inflammatory disorders [1]; however, its dose‐dependent and unpredictable pulmonary toxicity limits its clinical utility [3]. MTX is known to enhance oxidative stress, inflammation, apoptosis, and tissue injury [4]. In this study, the pulmonary effects of MTX were comprehensively evaluated through assessments of oxidant–antioxidant balance, inflammatory and apoptotic markers, autophagy‐related gene expression, and histopathological findings, and the potential protective role of SLM treatment against MTX‐induced lung damage was also investigated.
Antioxidant enzymes and substances are essential for preserving the organism's oxidant/antioxidant equilibrium [18]. A reduction in antioxidant enzyme activity and the depletion of antioxidant molecules render cells more vulnerable to oxidative stress, leading to an accumulation of ROS [19]. The administration of MTX has been demonstrated to induce elevated levels of ROS production, which subsequently disrupts the antioxidant defence system. This process ultimately lowers tissue antioxidant enzyme activity and antioxidant compound availability [20]. It has been reported that MTX administration increases ROS production in lung tissue, leading to elevated lipid peroxidation and consequent membrane damage. Abdelall et al. [20] demonstrated that MTX significantly raises MDA levels and induces oxidative injury in pulmonary tissue. In our study, MTX administration markedly increased MDA levels in lung tissue, indicating intensified lipid peroxidation and oxidative injury. This aligns with previous findings showing that MTX enhances ROS production and suppresses antioxidant defenses by decreasing SOD, CAT, and GPx activities as well as depleting GSH levels in pulmonary tissue [20]. SLM administration significantly reversed MTX‐induced reductions in GSH content and restored the activities of GPx, CAT, and SOD enzymes. These findings demonstrate that SLM, provides substantial protection against MTX‐induced oxidative stress by enhancing antioxidant capacity and mitigating oxidative damage in lung tissue.
In models of toxic injury, the Nrf2/HO‐1 signaling axis an essential regulator of cellular antioxidant defenses is frequently examined to assess oxidative stress severity [18]. Through its interaction with Keap1, Nrf2 is kept in the cytoplasm during resting conditions. In response to oxidative stress, Nrf2 undergoes phosphorylation and translocates to the nucleus, where it binds to antioxidant response elements (AREs) to regulate the expression of downstream antioxidant genes, including HO‐1, NAD(P)H‐quinone oxidoreductase 1 (NQO1), thioredoxin systems, and GPx [21]. MTX dramatically decreased Nrf2 and HO‐1 levels in lung tissue in the current investigation, suggesting a suppression of the body's natural antioxidant defenses. This result is in line with other studies showing that cytotoxic drugs worsen oxidative and inflammatory damage by impairing Nrf2‐mediated signaling and attenuating HO‐1 function [22, 23].
SLM administration effectively restored Nrf2 and HO‐1 levels toward normal values. This suggests that SLM treatment enhances Nrf2 pathway activation and re‐establishes HO‐1‐dependent cytoprotection [24]. Taken together, our results support the concept that SLM exerts strong protective effects against MTX‐induced lung injury by upregulating the Nrf2/HO‐1 axis and strengthening the antioxidant barrier at the tissue level.
It is well established that oxidative stress and inflammation progress concurrently in MTX‐induced lung injury [20]. MTX‐related excessive ROS production increases cellular damage, and the resulting release of damage‐associated molecular patterns (DAMPs) such as HMGB1 initiates a strong inflammatory response through TLR‐4 [20]. Activation of TLR‐4 accelerates the nuclear translocation of NF‐κB, leading to the overproduction of TNF‐α and other pro‐inflammatory cytokines [25, 26]. In our study, MTX significantly upregulated the expression levels of NF‐κB, TNF‐α, TLR‐4, and HMGB1 in lung tissue. In contrast, SLM, owing to its potent antioxidant and NF‐κB‐inhibitory properties, markedly suppressed this inflammatory activation; by reducing TLR‐4/HMGB1 signaling and cytokine production, it alleviated MTX‐induced pulmonary injury [27, 28]. These findings suggest that SLM may serve as a protective agent against MTX‐associated pulmonary toxicity.
There is growing evidence that inflammation, oxidative stress and apoptosis are closely related [29]. MTX‐induced oxidative stress disturbs mitochondrial membrane potential and intracellular calcium equilibrium, which subsequently triggers cytochrome‐c release and intrinsic apoptosis [30]. This shift promotes the upregulation of pro‐apoptotic markers such as Bax and Caspase‐3, while suppressing the anti‐apoptotic protein Bcl‐2, ultimately facilitating mitochondrial‐dependent cell death [31]. In our study, MTX administration significantly increased Bax and Caspase‐3 mRNA levels while reducing Bcl‐2 expression in lung tissue, confirming activation of the apoptotic cascade. SLM treatment effectively attenuated these alterations. By reducing ROS accumulation and preserving mitochondrial membrane integrity, downregulated Bax and caspase‐3 expression and restored Bcl‐2 levels [32]. This pattern indicates that SLM mitigates MTX induced apoptosis by stabilizing the Caspase‐3/Bax/Bcl‐2 axis and preventing cytochrome‐c–mediated caspase activation. Overall, these findings support the protective role of SLM against MTX‐related mitochondrial dysfunction and apoptosis in lung tissue.
JAK2 and STAT3 are key signaling molecules that actively participate in inflammatory and apoptotic pathways [33]. Previous research has shown that IL‐6 signaling plays a central role in regulating activation of the JAK2/STAT3 axis, and that inhibition of the IL‐6–JAK2–STAT3 cascade attenuates cellular injury and inflammatory damage [34, 35]. In the present study, MTX administration markedly increased IL‐6 expression in lung tissue and upregulated JAK2 and STAT3 mRNA transcription, suggesting that MTX‐induced inflammation may be mediated, at least in part, through the STAT3/IL‐6/JAK2 pathway. Conversely, SLM treatment downregulated IL‐6 expression and subsequently inhibited JAK2 and STAT3 activation, indicating suppression of this pro‐inflammatory signaling cascade [36]. These findings suggest that SLM may protect lung tissue from MTX‐induced inflammatory and apoptotic injury by modulating the IL‐6/JAK2/STAT3 pathway.
Excessive ROS accumulation promotes irreversible oxidative damage to cellular macromolecules and nucleic acids, ultimately compromising cellular structure and function [37]. In this context, autophagy serves as a critical adaptive mechanism that facilitates the lysosomal removal of damaged organelles and misfolded proteins, thereby contributing to cellular homeostasis [38]. LC3A, LC3B, and Beclin‐1 are among the key regulatory proteins involved in the autophagy pathway [39]. LC3B, in particular, is widely used as a marker of autophagosome formation under oxidative stress conditions, while Beclin‐1 plays an essential role in the initiation of autophagy [40]. In the present study, MTX exposure significantly increased the expression levels of LC3A, LC3B, and Beclin‐1 in lung tissue, indicating enhanced autophagic activity in response to MTX‐induced oxidative injury. Conversely, SLM treatment markedly reduced the expression of these autophagy‐related genes, suggesting that SLM exerts a strong anti‐autophagic effect and mitigates excessive autophagy triggered by MTX. These findings indicate that SLM may protect lung tissue by preventing oxidative stress induced autophagic activation and restoring cellular homeostasis.
It is recommended that future studies concentrate on elucidating the detailed molecular mechanisms underlying the protective effects of SLM against methotrexate‐induced pulmonary toxicity. Such studies should integrate protein‐level validation techniques, such as Western blotting and immunohistochemistry, alongside gene expression analyses. In addition, investigating upstream and downstream components of key signaling pathways, particularly the Nrf2/Keap1 axis and autophagy‐related regulators, would provide deeper mechanistic insight. Longitudinal experimental designs examining different time points could further clarify the temporal progression of apoptosis, oxidative stress, autophagy, and inflammation during MTX exposure and SLM intervention. Moreover, dose–response studies and comparative evaluations using both sexes and alternative animal models are warranted to enhance translational relevance. It is imperative that clinical research is conducted to ascertain whether protective functions observed within this experimental model can be effectively translated into practical adjunctive strategies for the prevention of methotrexate‐associated pulmonary toxicity in patients.
5. Conclusion
In summary, the recent research study shows that MTX administration significantly increases autophagy, inflammation, apoptosis and oxidative stress in lung tissue by impairing mitochondrial integrity, activating inflammatory signaling pathways, disrupting antioxidant defenses, and inducing autophagy‐related gene expression. The administration of SLM resulted in a significant alleviation of these negative effects by means of restoring antioxidant capacity, which activated the Nrf2 and HO‐1 pathway, and reduced autophagy through the downregulation of LC3A, LC3B, and Beclin‐1. In addition, the administration of SLM suppressed TLR‐4/HMGB1/NF‐κB/TNF‐α/IL‐6‐mediated inflammation and stabilised the Bax/Bcl‐2/Caspase‐3 apoptotic axis. In conclusion, the results show that SLM offers significant protection against pulmonary damage caused by MTX and might be a useful therapeutic supplement for avoiding lung toxicity from chemotherapy.
Author Contributions
Aydin Genc: conceptualization and preparation of the original draft, critical revision and editing of the manuscript, validation of the data, supervision of the study, software support, project coordination, methodological design, experimental investigation, formal data analysis, and data management. Emre Sahin: contribution to the original manuscript preparation and revision process, software assistance, methodological support, experimental investigation, supervision, and data organization. Eren Cankaya: Performed and interpreted the histopathological examinations.
Funding
The authors have nothing to report.
Ethics Statement
The Animal Ethics Committee of Bingöl University gave its approval to the animal protocol (Protocol No: 2025, E‐85680299). Every animal experiment was conducted in compliance with the EU Directive 2010 for animal research, the ARRIVE guidelines, and the U.K. Animals (Scientific Procedures) Act, 1986.
Conflicts of Interest
The authors declare no conflicts of interest.
Data Availability Statement
All data contributing to the findings of the present study are accessible via the corresponding author upon request.
References
- 1. Viguier M., Carrascosa‐Carrillo J.‐M., Rakvit P., et al., “Comprehensive Literature Review Evaluating the Use, Safety, and Efficacy of Subcutaneous Methotrexate in the Treatment of Adult Patients With Moderate‐to‐Severe Plaque‐Type Psoriasis,” International Journal of Dermatology 64 (2025): 1558–1567, 10.1111/ijd.17758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Chen M., K. A. Daddy J.C., Su Z., et al., “Folate Receptor‐Targeting and Reactive Oxygen Species‐Responsive Liposomal Formulation of Methotrexate for Treatment of Rheumatoid Arthritis,” Pharmaceutics 11 (2019): 582, 10.3390/pharmaceutics11110582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Dawson J. K., Quah E., Earnshaw B., Amoasii C., Mudawi T., and Spencer L. G., “Does Methotrexate Cause Progressive Fibrotic Interstitial Lung Disease? A Systematic Review,” Rheumatology International 41 (2021): 1055–1064, 10.1007/s00296-020-04773-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Alkhatib M. H., Alyamani S. A., and Abdu F., “Incorporation of Methotrexate Into Coconut Oil Nanoemulsion Potentiates Its Antiproliferation Activity and Attenuates Its Oxidative Stress,” Drug Delivery 27 (2020): 422–430, 10.1080/10717544.2020.1736209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Surai P., “Silymarin as a Natural Antioxidant: An Overview of the Current Evidence and Perspectives,” Antioxidants 4 (2015): 204–247, 10.3390/antiox4010204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Okiljević B., Martić N., Govedarica S., et al., “Cardioprotective and Hepatoprotective Potential of Silymarin in Paracetamol‐Induced Oxidative Stress,” Pharmaceutics 16 (2024): 520, 10.3390/pharmaceutics16040520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zhang B., Wang B., Cao S., Wang Y., and Wu D., “Silybin Attenuates LPS‐Induced Lung Injury in Mice by Inhibiting NF‐κB Signaling and NLRP3 Activation,” International Journal of Molecular Medicine 39 (2017): 1111–1118, 10.3892/ijmm.2017.2935. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Placer Z. A., Cushman L. L., and Johnson B. C., “Estimation of Product of Lipid Peroxidation (Malonyl Dialdehyde) in Biochemical Systems,” Analytical Biochemistry 16 (1966): 359–364, 10.1016/0003-2697(66)90167-9. [DOI] [PubMed] [Google Scholar]
- 9. Sun Y., Oberley L. W., and Li Y., “A Simple Method for Clinical Assay of Superoxide Dismutase,” Clinical Chemistry 34 (1988): 497–500. [PubMed] [Google Scholar]
- 10. Aebi H., “Catalase in Vitro,” Methods in Enzymology 105 (1984): 121–126, 10.1016/s0076-6879(84)05016-3. [DOI] [PubMed] [Google Scholar]
- 11. Matkovics B., “Determination of Enzyme Activity in Lipid Peroxidation and Glutathione Pathways,” Laboratoriumi Diagnosztika 15 (1988): 248–250. [Google Scholar]
- 12. Sedlak J. and Lindsay R. H., “Estimation of Total, Protein‐Bound, and Nonprotein Sulfhydryl Groups in Tissue With Ellman's Reagent,” Analytical Biochemistry 25 (1968): 192–205, 10.1016/0003-2697(68)90092-4. [DOI] [PubMed] [Google Scholar]
- 13. Lowry O., Rosebrough N., Farr A. L., and Randall R., “Protein Measurement With the Folin Phenol Reagent,” Journal of Biological Chemistry 193 (1951): 265–275. [PubMed] [Google Scholar]
- 14. Livak K. J. and Schmittgen T. D., “Analysis of Relative Gene Expression Data Using Real‐Time Quantitative PCR and the 2(‐Delta Delta C(T)) Method,” Methods (San Diego, Calif.) 25 (2001), 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 15. Luna L. G., Manual of Histologic Staining Methods of the Armed Forces Institute of Pathology. (McGraw‐Hill, 1968), 12–258. [Google Scholar]
- 16. Matute‐Bello G., Downey G., Moore B. B., et al., “An Official American Thoracic Society Workshop Report: Features and Measurements of Experimental Acute Lung Injury in Animals,” American Journal of Respiratory Cell and Molecular Biology 44 (2011): 725–738, 10.1165/rcmb.2009-0210ST. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. IBM SPSS , Statistics for Windows, Version 22.0. (IBM Corp, 2013). [Google Scholar]
- 18. Jomova K., Alomar S. Y., Alwasel S. H., Nepovimova E., Kuca K., and Valko M., “Several Lines of Antioxidant Defense Against Oxidative Stress: Antioxidant Enzymes, Nanomaterials With Multiple Enzyme‐Mimicking Activities, and Low‐Molecular‐Weight Antioxidants,” Archives of Toxicology 98 (2024): 1323–1367, 10.1007/s00204-024-03696-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Sies H. and Jones D. P., “Reactive Oxygen Species (ROS) as Pleiotropic Physiological Signalling Agents,” Nature Reviews Molecular Cell Biology 21 (2020): 363–383, 10.1038/s41580-020-0230-3. [DOI] [PubMed] [Google Scholar]
- 20. Abdelall A. M. A., Khames A., Bekhit A. A., and Fathy M., “Potential Effect of Etoricoxib in Reducing Inflammation in Methotrexate‐Induced Pulmonary Injury in Rats: Role of Oxidative Stress and the TLR4/p38‐MAPK/NF‐κB Signaling Pathway,” Inflammation 48, no. 2025 (2025): 2407–2416, 10.1007/s10753-024-02198-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Matouk A. I., Awad E. M., El‐Tahawy N. F. G., El‐Sheikh A. A. K., and Anter A., “Dihydromyricetin Modulates Nrf2 and NF‐κB Crosstalk to Alleviate Methotrexate‐Induced Lung Toxicity,” Pharmaceuticals 16 (2023): 481, 10.3390/ph16040481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Mentese A., Demir S., Yulug E., et al., “Berberine Alleviated Methotrexate‐Induced Oxidative and Inflammatory Lung Injury by Modulating Nrf2 Signaling in Rats,” Kuwait Journal of Science 53 (2026): 100519, 10.1016/j.kjs.2025.100519. [DOI] [Google Scholar]
- 23. Turkmen Alemdar N., Demir S., Yulug E., et al., “Arbutin Protects Against Methotrexate‐Induced Pulmonary Injury in Rats Via Modulation of Oxidative Stress, Inflammation, and ER Stress,” Frontiers in Veterinary Science 12 (2025): 1680886, 10.3389/fvets.2025.1680886. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Ahmed R. F., Moussa R. A., Eldemerdash R. S., Zakaria M. M., and Abdel‐Gaber S. A., “Ameliorative Effects of Silymarin on HCl‐Induced Acute Lung Injury in Rats; Role of the Nrf‐2/HO‐1 Pathway,” Iranian Journal of Basic Medical Sciences 22 (2019): 1483–1492, 10.22038/IJBMS.2019.14069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Liang K., Xu L., Ta Y., et al., “Exploring the Mechanism of TLR4/NF‐κB Signaling Pathway in Hypoxic Myocardial Injury: Implications for Traditional Chinese Medicine Therapy,” Fitoterapia 185 (2025): 106721, 10.1016/j.fitote.2025.106721. [DOI] [PubMed] [Google Scholar]
- 26. Wang L., Botchway B. O. A., and Liu X., “The Repression of the HMGB1‐TLR4‐NF‐κB Signaling Pathway by Safflower Yellow May Improve Spinal Cord Injury,” Frontiers in Neuroscience 15 (2021): 803885, 10.3389/fnins.2021.803885. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Sayyad M., Sutar A. D., Shivhare K., Shukla R., and Flora S. J. S., “Silymarin as a Phytopharmaceutical Agent: Advances in Mechanistic Insights, Formulation Strategies, and Pre‐Clinical Applications,” Frontiers in Pharmacology 16 (2025): 1711653, 10.3389/fphar.2025.1711653. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Singh D., Khan M. A., and Siddique H. R., “Unveiling the Therapeutic Promise of Natural Products in Alleviating Drug‐Induced Liver Injury: Present Advancements and Future Prospects,” Phytotherapy Research 38 (2024): 22–41, 10.1002/ptr.8022. [DOI] [PubMed] [Google Scholar]
- 29. Aja P. M., Izekwe F. I., Famurewa A. C., et al., “Hesperidin Protects Against Cadmium‐Induced Pancreatitis by Modulating Insulin Secretion, Redox Imbalance and iNOS/NF‐ĸB Signaling in Rats,” Life Sciences 259 (2020): 118268, 10.1016/j.lfs.2020.118268. [DOI] [PubMed] [Google Scholar]
- 30. Al Maruf A., O'Brien P. J., Naserzadeh P., Fathian R., Salimi A., and Pourahmad J., “Methotrexate Induced Mitochondrial Injury and Cytochrome C Release in Rat Liver Hepatocytes,” Drug and Chemical Toxicology 41 (2018): 51–61, 10.1080/01480545.2017.1289221. [DOI] [PubMed] [Google Scholar]
- 31. Hassanein E. H. M., Mohamed W. R., Shalkami A.‐G. S., Khalaf M. M., and Hemeida R. A. M., “Renoprotective Effects of Umbelliferone on Methotrexate‐Induced Renal Injury Through Regulation of Nrf‐2/Keap‐1, P38MAPK/NF‐κB, and Apoptosis Signaling Pathways,” Food and Chemical Toxicology 116 (2018): 152–160, 10.1016/j.fct.2018.03.041. [DOI] [PubMed] [Google Scholar]
- 32. Singh M., Kadhim M. M., Turki Jalil A., et al., “A Systematic Review of the Protective Effects of Silymarin/Silibinin Against Doxorubicin‐Induced Cardiotoxicity,” Cancer Cell International 23 (2023): 88, 10.1186/s12935-023-02936-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Yu H., Lee H., Herrmann A., Buettner R., and Jove R., “Revisiting STAT3 Signalling in Cancer: New and Unexpected Biological Functions,” Nature Reviews Cancer 14 (2014): 736–746, 10.1038/nrc3818. [DOI] [PubMed] [Google Scholar]
- 34. Zhao Q., Dai H., Jiang H., et al., “Activation of the IL‐6/STAT3 Pathway Contributes to the Pathogenesis of Membranous Nephropathy and Is a Target for Mahuang Fuzi and Shenzhuo Decoction (MFSD) to Repair Podocyte Damage,” Biomedicine & Pharmacotherapy 174 (2024): 116583, 10.1016/j.biopha.2024.116583. [DOI] [PubMed] [Google Scholar]
- 35. Wang S.‐W. and Sun Y.‐M., “The IL‐6/JAK/STAT3 Pathway: Potential Therapeutic Strategies in Treating Colorectal Cancer,” International Journal of Oncology 44 (2014): 1032–1040, 10.3892/ijo.2014.2259. [DOI] [PubMed] [Google Scholar]
- 36. Zhao Y., Zhou Y., Gong T., et al., “The Clinical Anti‐Inflammatory Effects and Underlying Mechanisms of Silymarin,” iScience 27 (2024): 111109, 10.1016/j.isci.2024.111109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Valko M., Leibfritz D., Moncol J., Cronin M. T. D., Mazur M., and Telser J., “Free Radicals and Antioxidants in Normal Physiological Functions and Human Disease,” International Journal of Biochemistry & Cell Biology 39 (2007): 44–84, 10.1016/j.biocel.2006.07.001. [DOI] [PubMed] [Google Scholar]
- 38. Mizushima N. and Levine B., “Autophagy in Mammalian Development and Differentiation,” Nature Cell Biology 12 (2010): 823–830, 10.1038/ncb0910-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Martin L. M., Jeyabalan N., Tripathi R., et al., “Autophagy in Corneal Health and Disease: A Concise Review,” Ocular Surface 17 (2019): 186–197, 10.1016/j.jtos.2019.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Danish F., Qureshi M. A., Mirza T., et al., “Investigating the Association Between the Autophagy Markers LC3B, SQSTM1/p62, and DRAM and Autophagy‐Related Genes in Glioma,” International Journal of Molecular Sciences 25 (2024): 572, 10.3390/ijms25010572. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data contributing to the findings of the present study are accessible via the corresponding author upon request.
