Skip to main content
Poultry Science logoLink to Poultry Science
. 2026 Mar 20;105(6):106826. doi: 10.1016/j.psj.2026.106826

Dietary Schizochytrium algal powder is an effective strategy to develop docosahexaenoic acid-enriched eggs in Chinese yellow-feathered laying quails

Zihao Qin a,c,†, Zhixing Rong b,c,†, Gaofeng Chen a,b, Xinghuo Liu a,b, Chao Jia a,b, Xiang Zhong a,b, Debing Yu a,b, Shixian Yin b,c, Yueping Chen a,b,⁎
PMCID: PMC13054021  PMID: 41905075

Abstract

Although docosahexaenoic acid (DHA) enrichment in eggs has been extensively studied in laying hens, research on DHA-fortified eggs in quails remains limited. This study evaluated the effects of graded levels of Schizochytrium algae powder (SAP) on production performance, egg quality, egg DHA enrichment and fatty acid composition, and related gene expression responsible for DHA absorption and transport in yellow-feathered laying quails. A total of 960 birds were randomly assigned to four dietary groups (0%, 0.4%, 0.8%, or 1.2% SAP) for an eight-week trial, with each group consisting of six replicates of forty quails each. A quadratic response was observed for egg production and egg mass (P < 0.05), with the 0.4% SAP group higher than the control group (P < 0.05). A significant decreasing linear trend in mortality was observed with increasing SAP levels (P < 0.05). Egg yolk color responded linearly and quadratically to dietary SAP at both 4 and 8 weeks (P < 0.05), with all supplemented groups exhibiting higher values than the control (P < 0.05). DHA content in whole egg and yolk exhibited linear and quadratic increases with SAP supplementation at all timepoints (P < 0.05), resulting in higher levels than the control in all SAP-treated groups (P < 0.05) and plateauing at the 0.8% inclusion level. Moreover, SAP supplementation linearly elevated total omega-3 polyunsaturated fatty acid content and the omega-3/omega-6 ratio, while linearly reducing γ-linolenic acid and arachidonic acid concentrations in yolk (P < 0.05). Transcriptional analysis revealed linear upregulation of key genes involved in DHA absorption and transport in the duodenum, jejunum, and liver in response to SAP supplementation (P < 0.05). These findings demonstrate that dietary supplementation with SAP quadratically increased production performance, improved yolk color, enriched egg DHA content, elevated the omega-3/omega-6 ratio, and modulated the expression of genes involved in DHA absorption and transport. Collectively, this study provides an effective strategy for developing DHA-enriched quail eggs, with an optimal dietary SAP inclusion range of 0.4%–0.8%.

Keywords: Schizochytrium, Laying performance, Egg, Docosahexaenoic acid, Laying quails

Introduction

As a critical and essential structural component of the nervous system and cellular membranes, docosahexaenoic acid (DHA), a long-chain omega-3 polyunsaturated fatty acid (PUFA), is highly enriched in a variety of vital human organs and tissues, such as brain, retina, heart, and sperm, with its presence accounting for approximately 97% and 93% of the omega-3 PUFA pool in the brain and retina, respectively (Lauritzen et al., 2001; Esmaeili et al., 2015; Li et al., 2021). Although the human body can biosynthesize DHA from α-linolenic acid available in numerous plant oils through the actions of desaturase and elongase enzymes, this bioconversion is highly inefficient, with rates generally below 10% and sometimes even reported to be as low as 0.01% (Burdge and Wootton, 2002; Burdge and Calder, 2005; Hussein et al., 2005; Wang et al., 2025a). The collective findings from a large number of clinical investigations have documented that dietary supplementation with DHA confers a wide spectrum of health advantages across the human lifespan, including support for neurological and visual development in fetuses and infants, maintenance of cognitive and visual function in adults and the elderly, cardiovascular risk reduction, modulation of metabolic homeostasis, anti-inflammatory and immunomodulatory functions, gut microbiota composition balance, and prevention of early preterm delivery (Cardoso et al., 2016; López-Vicario et al., 2016; Ghasemi Fard et al., 2019; Li et al., 2021; Fu et al., 2021). Although national variations in expert recommendations for n-3 PUFAs (particularly DHA), a broad consensus exists for a daily intake of over 250 mg of combined DHA and eicosapentaenoic acid (EPA), and specifically for at least 200 mg of DHA alone for pregnant and lactating women (Kris-Etherton et al., 2009; Li et al., 2021). However, the substantial disparity between recommended n-3 PUFA intake especially DHA and the actual global consumption particularly in developing countries necessitates the use of supplements to address this nutritional deficiency. Usually, the human body's additional demand for DHA is primarily met by dietary supplements such as fish, krill, and algal oil, and DHA-fortified foods like eggs, milk, and infant formula.

Schizochytrium sp., a unicellular eukaryotic marine protist belonging to the family Thraustochytridiaceae (class Labyrinthulomycetes), is ubiquitously distributed across diverse marine environments, including oceanic, coastal, and deep-sea waters, as well as low-temperature habitats and sediments (Puri and Sahni, 2023). This specie is classified as an oleaginous microorganism due to its substantial production of single-cell oil rich in valuable fatty acids, characterized by a cellular lipid content exceeding 50% of the dry cell weight and a DHA proportion over 35% of the total fatty acids (Wang et al., 2021). The straightforward fermentation process of Schizochytrium sp., combined with the limited diversity of PUFAs in its oil which simplifies purification, makes it highly suitable for the industrial-scale production of DHA (Jesionowska et al., 2023; Peng et al., 2025). In addition to being used to produce human DHA supplements, Schizochytrium and its fermentation products are also utilized as valuable feed ingredients and additives for a variety of animal species, including aquatic animals, poultry, ruminants, and livestock (Madeira et al., 2017; Trevi et al., 2023; Orzuna-Orzuna et al., 2024). Studies have shown that compared to fish oil or krill oil, Schizochytrium is a superior and more cost-effective feed supplement for producing DHA-enriched foods. Unlike refined Schizochytrium oil consisting mainly of lipids, whole Schizochytrium biomass contains indigestible cell wall components and various antinutritional factors that may negatively affect animal health and growth performance when included at high levels in the diet; however, the high production cost of refined oil limits its feasibility for large-scale feeding, whereas whole microalgal biomass, with its lower production cost and additional nutritional value (rich in crude protein and other bioactive compounds), may represent a more economically viable and functionally advantageous strategy for DHA enrichment (Madeira et al., 2017; Kazemi, 2025). To date, research on using Schizochytrium to produce DHA-enriched eggs has been largely restricted to laying hens. A linear dose-dependent increase in the DHA content of egg yolks was observed in laying hens following dietary supplementation with Schizochytrium algae powder (SAP) at 0.25%, 0.50%, 0.75%, and 1.00% over 14- and 28-day feeding trials, with the highest level being observed in the 1.00% group, although only minimal benefits were found for laying performance and egg quality (Kiran et al., 2024). Similarly, supplementing 0.5% and 1.0% DHA-enriched Schizochytrium microalgae also markedly increased DHA accumulation in eggs, but it did not affect production performance and egg quality in laying hens (Liu et al., 2020). In another study, it has been reported that a 1% or 2% dietary inclusion of Schizochytrium in laying hens resulted in a higher level of DHA enrichment in egg yolk compared to 4% fish oil, although without significant improvements in production performance or egg quality (Kaewsutas et al., 2016). In contrast, dietary supplementation with 0.5% and 1.0% marine microalgae powder (Schizochytrium) not only significantly elevated egg yolk DHA concentrations but also improved egg production rate, egg quality, and lipid metabolism in layers (Park et al., 2015). Although the response of laying hens to dietary Schizochytrium sp. is somewhat inconsistent, its inclusion in feed nevertheless constitutes an effective and practical approach for producing DHA-enriched chicken eggs.

Globally, domestic quail account for about 11.8% of productive birds, ranking second only to laying hens, and contribute roughly 10% of the world's table eggs, with primary production centered in East Asia, Brazil, and China, the world's largest producer, which yields around 90 billion eggs annually (Lukanov, 2019). Given the prominence of quail as a source of table eggs, it is imperative to develop and optimize strategies for enhancing the nutritional profile of quail eggs. Extensive research on nutrient-enriched chicken eggs, including DHA-fortified products, has made them commercially available worldwide. However, parallel studies on DHA-fortified quail eggs remain considerably limited. This study systematically evaluated the effects of supplementing graded levels of SAP on laying performance, egg quality, egg DHA enrichment and fatty acid composition, and the expression of critical genes involved in DHA absorption, synthesis, and transport in laying quails, with the aim of providing a theoretical foundation for the rational use of this algae in laying quail diets and the development of DHA-enriched laying quail eggs.

Materials and methods

Animals, diet, experimental design, and housing

The animal experiments performed in this study were conducted in strict compliance with the ethical guidelines for the use of laboratory animals issued by the Department of Science and Technology of Jiangsu Province, P.R. China. The experimental protocol was reviewed and formally approved by the Institutional Animal Care and Ethics Committee of Nanjing Agricultural University.

A total of 960 healthy 232-day-old Chinese yellow-feathered laying quails with comparable laying rate were randomly distributed into one of four treatment groups following a completely randomized design. Each treatment group was comprised of six replicate cages, with each cage housing forty quails. The quails were provided with a corn-soybean meal basal diet supplemented with graded levels of SAP at 0% (Control group), 0.4%, 0.8%, or 1.2% by weight for an eight-week experimental period. The supplementation levels in this study were set based on the results of a preceding pilot trial, which was designed to establish appropriate and effective dosage ranges before the commencement of the formal study. The SAP used in this study was generously provided by Zhihe Biotechnology (Changzhou) Co., Ltd. (Changzhou, P.R. China). According to analysis performed on an Agilent 8890 gas chromatograph (Agilent Technologies, CA, USA) as described below, the Schizochytrium powder contained 22.4% DHA. The proximate analysis and fatty acid and amino acid profiles of SAP are presented in Table 1. The four experimental diets were prepared by replacing equivalent amounts of corn and lard oil in the basal corn-soybean meal diet with graded levels of SAP. The complete nutritional profile of the experimental diets, including fatty acid composition, is presented in Table 2. The quails were housed in stainless steel cages fitted with plastic mesh flooring and two automatic nipple drinkers, and maintained in a controlled environment at approximately 25°C with 60%–65% relative humidity under a 16 h: 8 h light–dark cycle. The quails had unrestricted access to water and were fed ad libitum throughout the study, except when feed was temporarily removed for the purpose of sample collection.

Table 1.

Proximate analysis and fatty acid and amino acid profiles of Schizochytrium algae powder (g/100 g).

Items Content
Proximate analysis
 Dry matter 97.59
 Crude protein 23.05
 Ether extract 42.41
 Crude ash 12.45
Fatty acids
 C12:0 0.028
 C14:0 0.298
 C15:0 0.100
 C16:0 6.861
 C16:1n-7 0.111
 C17:0 0.069
 C18:0 0.381
 C18:1n-9c 0.024
 C18:2n-6c 0.026
 C18:3n-3 0.089
 C18:3n-6 0.058
 C18:4 0.132
 C20:0 0.124
 C20:3n-6 0.097
 C20:4n-3 0.348
 C20:4n-6 0.046
 C20:5n-3 0.202
 C22:0 0.063
 C22:5n-3 0.039
 C22:5n-6 5.691
 C22:6n-3 22.431
 C24:0 0.035
Amino acids
 Lysine 0.89
 Methionine 0.46
 Cystine 0.25
 Threonine 0.64
 Leucine 0.76
 Isoleucine 0.44
 Tryptophan 0.17
 Valine 0.88
 Phenylalanine 0.48
 Arginine 2.78
 Histidine 0.28

Table 2.

Composition and nutrient levels of the basal diet.

Items Schizochytrium algae powder level
0.00% 0.40% 0.80% 1.20%
Ingredients, %
 Corn 30.00 29.75 29.50 29.25
 Soybean meal 35.45 35.45 35.45 35.45
 Wheat 14.00 14.00 14.00 14.00
 Corn gluten meal 2.00 2.00 2.00 2.00
 Fully defatted fish meal 1.50 1.50 1.50 1.50
 Lard oil 7.00 6.85 6.70 6.55
 Limestone 7.00 7.00 7.00 7.00
 Dicalcium phosphate 1.50 1.50 1.50 1.50
 L-Lysine hydrochloride 0.10 0.10 0.10 0.10
 DL-Methionine 0.25 0.25 0.25 0.25
 Sodium chloride 0.20 0.20 0.20 0.20
 Premix1 1.00 1.00 1.00 1.00
 Schizochytrium algae powder 0.00 0.40 0.80 1.20
 Total 100.00 100.00 100.00 100.00
Calculated nutrient levels
 Apparent metabolizable energy, MJ/kg 12.54 12.55 12.57 12.59
 Crude protein, % 22.12 22.19 22.26 22.33
 Calcium, % 3.16 3.16 3.16 3.16
 Available phosphorus, % 0.49 0.49 0.49 0.49
 Lysine, % 1.26 1.26 1.27 1.27
 Methionine, % 0.59 0.59 0.59 0.59
 Methionine + cystine, % 0.94 0.94 0.94 0.95
 Analyzed nutrient nutrients, %
 Crude protein 21.90 21.99 22.03 22.13
 Calcium 3.24 3.27 3.19 3.21
 Total phosphorus 0.75 0.77 0.80 0.81
 Lysine, % 1.35 1.38 1.29 1.34
 Methionine, % 0.62 0.64 0.57 0.60
 Methionine + cystine, % 0.98 1.01 1.00 0.99
Fatty acids, g/100 g diet
 C12:0 0.01 0.01 0.01 0.01
 C14:0 0.07 0.09 0.08 0.08
 C16:0 1.66 1.63 1.63 1.62
 C16:1 0.17 0.17 0.17 0.16
 C18:0 0.86 0.85 0.82 0.83
 C18:1n-9 2.85 2.86 2.79 2.72
 C18:2n-6 1.57 1.53 1.54 1.56
 C18:3n-3 0.11 0.12 0.13 0.12
 C22:6n-3 0.00 0.10 0.19 0.26
1

Premix provided per kilogram of diet: vitamin A (transretinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3,000 IU; vitamin E (all-rac-α-tocopherol), 20 IU; menadione, 2 mg; thiamin, 2 mg; riboflavin, 4 mg; nicotinamide, 50 mg; choline chloride, 400 mg; calcium pantothenate, 20 mg; pyridoxine·HCl, 1 mg; biotin, 0.2 mg; folic acid, 1 mg; vitamin B12 (cobalamin), 0.02 mg; Fe (from ferrous sulfate), 60 mg; Cu (from copper sulphate), 10.0 mg; Mn (from manganese sulphate), 80 mg; Zn (from zinc sulfate), 60 mg; I (from calcium iodate), 0.2 mg; Se (from sodium selenite), 0.3 mg.

Sample collection

At the ending of feeding experiment, two quails per replicate were randomly selected following a 12-h fasting period for euthanasia and sample collection. Blood was collected from the wing vein and centrifuged at 4000 × g for 15 min at 4°C. The resulting serum was aliquoted into sterile tubes and stored at −20°C pending analysis. The birds were then euthanized by cervical dislocation and subjected to a full necropsy. The liver was carefully dissected and freed of adherent adipose tissue. Approximately 3 g of tissue from the left hepatic lobe was then collected into a cryovial, snap-frozen in liquid nitrogen, and stored at liquid nitrogen tank for future analysis. The entire small intestine was aseptically removed from each carcass, placed on a pre‑chilled stainless‑steel tray, and segmented into three anatomical regions: the duodenum (from the pylorus to the distal duodenal loop), the jejunum (from the duodenal end to Meckel's diverticulum), and the ileum (from Meckel's diverticulum to the ileocecal junction). The duodenal and jejunal segments were longitudinally opened along the mesenteric border, and their luminal contents were cleared by gentle squeezing followed by rinsing with ice‑cold phosphate‑buffered saline. The mucosa from these washed and everted intestinal sections was scraped off using a sterile glass slide, pooled, placed into cryovials, immediately snap‑frozen in liquid nitrogen, and stored for subsequent analysis. Egg quality was assessed using three eggs collected from each replicate on days 28 and 56 of the trial. For DHA analysis, a separate sampling procedure was followed, in which four eggs per replicate (n = 24) were randomly collected on four occasions, specifically at 14, 28, 42, and 56 days of this experiment.

Productive performance

The daily egg weight, egg production rate, and mortality, along with weekly feed consumption data collected per experimental replicate, were used to calculate the average egg production rate, average egg weight, average egg mass, average daily feed intake, feed conversion ratio, and overall mortality rate.

Egg quality

The eggshell strength was assessed with an Eggshell Strength Gauge (Model-II, Robotmation, Tokyo, Japan), while yolk colour was determined using a Roche Colour Fan (Robotmation, Tokyo, Japan). The longitudinal and transverse diameters of each egg were measured with a digital vernier caliper (Mitutoyo Corporation, Kanagawa, Japan) to calculate the egg shape index (longitudinal diameter/transverse diameter). Eggshell thickness was obtained as the mean of measurements taken at three locations (equator, blunt end, and sharp end) using a digital micrometer (Mitutoyo Corporation, Kanagawa, Japan). After individual weighing, eggs were cracked, and the yolk was isolated with an egg separator. After being rolled on moist paper towels to remove any adhering albumen, the yolk was weighed. The empty shell was rinsed, its inner membrane removed manually, and then air-dried and weighed. Albumen weight was calculated as the difference between the whole egg weight and the combined weight of yolk and dry shell. Component ratios were then expressed as percentages of the whole egg weight: eggshell ratio (%) = (eggshell weight/whole egg weight) × 100%; albumen ratio (%) = (albumen weight/whole egg weight) × 100%; yolk ratio (%) = (yolk weight/whole egg weight) × 100%.

Measurement of fatty acids

The DHA content and other fatty acids in the egg yolks, diets, and algal powder were analyzed via gas chromatography. Fresh whole eggs were individually weighed, and their yolks were separated, weighed, and carefully stripped of the surrounding membrane. Yolks from eggs within the same experimental replicate were pooled, homogenized, and stored at −80 °C. Prior to analysis, a representative aliquot of homogenized yolk from each replicate was freeze-dried for 12 h using an ALPHA‑1‑4 LSC freeze‑dryer (Martin Christ Gefriertrocknungsanlagen GmbH, Osterode am Harz, Germany). A 100 mg of the freeze-dried sample was weighed into a 15 mL screw‑cap tube and treated sequentially with 1 mL of n‑hexane, 1 mL of an internal standard solution (1 mg/mL triundecanoin), and 4 mL of a chloroacetyl‑methanol mixture (1:10, v/v). For analysis of diets and algal powder, samples were ground to pass through a 0.5 mm sieve. Aliquots of 500 mg of each diet and 100 mg of algal powder were weighed into 15 mL screw-cap tubes and methylated using the same procedure described for egg yolks. After vortex mixing, the tube was incubated in an 80 °C water bath for 2 h to complete methylation. Following methylation, the tube was removed from the water bath and 2 mL of n-hexane was added to the tube, which was then cooled to room temperature before the dropwise addition of 5 mL of a 7% potassium carbonate solution. The mixture was vigorously vortexed for 5 min and centrifuged at 1700 × g for 5 min. The upper organic layer was collected with a syringe, passed through a 0.22 μm organic nylon membrane filter (13 mm diameter), and transferred to a chromatography vial for analysis. Fatty acid methyl esters were separated and quantified using an Agilent 8890 gas chromatograph (Agilent Technologies, CA, USA) equipped with a flame ionization detector and a DB‑FastFAME capillary column (30 m × 0.25 mm × 0.25 μm). Nitrogen served as the carrier gas. A 1 μL sample was injected in split mode (20: 1 ratio) with the injector temperature set at 250 °C. The detector temperature was maintained at 260 °C, with hydrogen, air, and makeup nitrogen flows set at 40, 400, and 25 mL/min, respectively. The oven temperature program started at 80°C with a 0.5 min hold, then increased to 165°C at 40°C/min and held for 1 min, and finally ramped to 230°C at 4°C/min for a final 4 min hold. The fatty acid methyl ester standard used for calibration was obtained from Sigma-Aldrich (St. Louis, MO, USA).

RNA extraction and PCR analysis

Total RNA was extracted from approximately 30 mg of liver tissue and duodenal and jejunal mucosal scrapings using the SteadyPure RNA Extraction Kit (Accurate Biology, AG21024, P.R. China). RNA integrity was evaluated by electrophoresis on a 1.5% agarose gel stained with Ultra GelRed (Vazyme Biotech, GR501-01, P.R. China). The purity and concentration of RNA were determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA) based on the A260/A280 absorbance ratio. For complementary DNA synthesis, qualified RNA samples were reverse transcribed using the All-In-One 5X RT MasterMix (Applied Biological Materials Inc., G592, P.R. China). Quantitative real-time PCR was subsequently performed on a QuantStudio5 system (Thermo Fisher Scientific, MA, USA) with TOROGreen® qPCR Master Mix (TOROIVD, QST-100, P.R. China). The thermal cycling protocol consisted of an initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 30 s. Gene-specific primers for target and reference genes are provided in Table 3 (Fatty acid-binding protein 1 (FABP1), fatty acid-binding protein 2 (FABP2), apolipoprotein B (apoB), major facilitator superfamily domain-containing 2a (Mfsd2a), elongation of very long-chain fatty acid 2 (ELOVL2), cluster of differentiation 36 (CD36), microsomal triglyceride transfer protein (MTTP), fatty acid transport protein 4 (FATP4), very low density apolipoprotein II (apoVLDL-Ⅱ), vitellogenin-1 (VTG-1), vitellogenin-1 (VTG-2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and β-actin). Relative mRNA expression levels were calculated using the 2–ΔΔCT method (Livak and Schmittgen, 2001).

Table 3.

Sequences of primers for polymerase chain reaction.

Primers1 Gene bank ID Primer sequences Length (bp)
FABP1 XM 015862881.2 TCACCATTGGGGAGGAGTGT
TAGGTGAGGTCTCCCTTCGT
172
Mfsd2a XM 015883509.2 GAACCACGGTGCCTACATCA
CGGAAGCCCAAAGTGTAGGT
111
MTTP XM 015862082.2 CCACGTATTCAGCCTCCGTT 114
GGGATGCTTTAGCCCGATCA
CD36 XM 032442274.1 AGCAGCCTAACAGCAAGGTTT
GCACTCTTCTTGGTTAGTGGC
132
apoVLDL-Ⅱ XM 015875179.2 TGATAGAGGCCGTCGTGACT
CAGCTCTAGGTGAAACCGTGT
89
VTG-1 XM 032446247.1 TGTGATGGCCCTGAAAAGCA
TCACGATTGGAAGACCTGGC
152
VTG-2 XM 032446226.1 GCGTCCTGGCCTAAGTTTCT
CATCCGTGGCTTGACAGACT
138
ELOVL2 XM 015854637.2 ACCTCCGAAGGAGCCTACAA
GTGGAGGAAGGTGATCTGGC
171
FABP2 XM 015861896.1 TCTCGCTGATGGGACTGAAC
TCTGTACGCTGTGAGTGCTT
106
apoB XM 015859545.2 CCCAGCGTACACCATTGACT
TCAGTTTTGGCAGTGTGGGT
95
FATP4 XM 015879127.2 TGCCCCTACCTGCAAAAGAG 97
TCACGTAGCGCAAGTCAAGT
GAPDH XM 015873412.2 ACCAACTGTCTGGCACCATT
TGCCATCCCTCCACAACTTC
139
β-actin XM 015876619.1 TTTGGCGCTTGACTCAGGAT
TGTAGAACTTTGGGGGCGTT
99
1

FABP1, fatty acid-binding protein 1; Mfsd2a, major facilitator superfamily domain-containing 2a; MTTP, microsomal triglyceride transfer protein; CD36, cluster of differentiation 36; apoVLDL-Ⅱ, very low density apolipoprotein II; VTG-1, vitellogenin-1; VTG-2, vitellogenin-2; ELOVL2, elongation of very long-chain fatty acid 2; FABP2, fatty acid-binding protein 2; apoB, apolipoprotein B; FATP4, fatty acid transport protein 4; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Statistical analysis

All statistical procedures were conducted using IBM SPSS Statistics software (version 22.0; IBM Corp., Armonk, NY, USA). Prior to analysis, the assumptions of normality for data distribution and homogeneity of variances were evaluated using the Shapiro-Wilk test and Levene's test, respectively. Data meeting parametric assumptions were analyzed by one-way analysis of variance (ANOVA) with the dietary inclusion level of SAP as the main effect. Where ANOVA indicated a significant overall effect, differences between individual treatment means were assessed using Duncan’s multiple range test. Orthogonal polynomial contrasts were used to examine significant linear and quadratic trends in response to increasing algae supplementation. Results are presented as means with the pooled standard error of the mean. A probability level of P < 0.05 was considered statistically significant.

Results

Productive performance

As shown in Table 4, no significant difference was observed in the initial average egg production rate among the treatment groups (P > 0.05). A quadratic effect was detected for both the average egg production rate (P = 0.047) and the average egg mass (P = 0.027) during the eight-week feeding trial. Specifically, the group supplemented with 0.4% SAP demonstrated a higher average egg production rate (P = 0.037) and average egg mass (P = 0.028) compared to the control and other supplementation groups. However, this beneficial effect was not observed in birds fed a basal diet supplemented with 0.8% or 1.2% Schizochytrium (P > 0.05). Meanwhile, mortality exhibited a decreasing linear trend (P = 0.011), although no significant differences were found between the control and any of the treatment groups (P > 0.05). In contrast, no significant differences were detected in average daily feed intake, average egg weight, or average feed conversion ratio (P > 0.05). Similarly, neither linear nor quadratic effects were observed for any of the above production performance parameters (P > 0.05).

Table 4.

Effects of graded levels of dietary Schizochytrium algae powder supplementation on the productive performance in laying quails.

Items Schizochytrium algae powder level
SEM1 P-values
Control 0.40% 0.80% 1.20% Treatment Linear Quadratic
Initial average egg production rate, % 79.65 80.75 79.98 79.93 0.24 0.444 0.975 0.253
Average egg production rate, % 79.08b 84.57a 80.60b 80.76b 0.72 0.037 0.854 0.047
Average egg weight, g 11.86 11.85 11.88 11.81 0.02 0.693 0.554 0.433
Average egg mass, g 9.37b 10.03a 9.58b 9.54b 0.08 0.028 0.941 0.027
Average daily feed intake, g/d 23.25 24.37 23.34 23.16 0.20 0.102 0.441 0.092
Average feed conversion ratio 2.48 2.43 2.44 2.43 0.02 0.675 0.338 0.590
Mortality rate, %, 4.58 2.92 2.50 1.25 0.46 0.069 0.011 0.804
a-b

Means within a row with different superscripts are different at P < 0.05.

1

SEM, standard error of the mean (n = 6).

Egg quality

A quadratic effect on eggshell thickness was observed at the four-week time point (28 days) of the feeding trial (Table 5, P = 0.036). Dietary supplementation with 0.4% or 0.8% SAP tended to increase eggshell thickness compared to the control, but the differences did not reach statistical significance (P > 0.05). However, this alteration in eggshell thickness disappeared at eight weeks of experiment (56 days). Dietary supplementation with SAP increased yolk color in both linear and quadratic patterns at four and eight weeks of the experiment (P < 0.001). Compared with the control group, dietary inclusion of SAP increased yolk color at both egg sampling timepoints (four and eight weeks), irrespective of its supplemental dosage (P < 0.001), whereas no significant differences were observed across the different Schizochytrium-supplemented groups (P > 0.05). No significant differences in egg shape index, eggshell strength, eggshell weight, albumen weight, yolk weight, or the ratios of eggshell, albumen, and yolk were observed among the four groups (P > 0.05).

Table 5.

Effects of graded levels of dietary Schizochytrium algae powder supplementation on the egg quality in laying quails.

Items Schizochytrium algae powder level
SEM1 P-values
Control 0.40% 0.80% 1.20% Treatment Linear Quadratic
4 week
 Egg weight, g 12.20 12.15 12.23 12.07 0.05 0.744 0.530 0.613
 Eggshell weight, g 1.89 1.81 1.80 1.77 0.02 0.219 0.054 0.540
 Yolk weight, g 3.94 3.96 3.97 3.94 0.02 0.949 0.934 0.570
 Albumen weight, g 6.37 6.38 6.46 6.36 0.05 0.878 0.937 0.564
 Egg shape index 1.29 1.29 1.29 1.28 0.00 0.762 0.489 0.618
 Eggshell strength, N 15.32 13.64 13.67 13.76 0.33 0.204 0.115 0.178
 Eggshell thickness, mm 0.17 0.18 0.18 0.17 0.00 0.197 0.680 0.036
 Eggshell ratio, % 15.50 14.91 14.75 14.70 0.17 0.339 0.101 0.437
 Yolk ratio, % 32.28 32.57 32.48 32.62 0.17 0.898 0.539 0.831
 Albumen ratio, % 52.22 52.53 52.77 52.68 0.22 0.837 0.424 0.666
 Yolk color 10.61b 12.44a 12.83a 12.28a 0.14 <0.001 <0.001 <0.001
8 week
 Egg weight, g 11.75 11.87 11.85 11.80 0.04 0.800 0.760 0.355
 Eggshell weight, g 1.73 1.78 1.74 1.76 0.03 0.915 0.863 0.844
 Yolk weight, g 3.84 3.81 3.82 3.82 0.03 0.990 0.868 0.812
 Albumen weight, g 6.18 6.28 6.30 6.22 0.06 0.917 0.828 0.502
 Egg shape index 1.28 1.28 1.28 1.29 0.00 0.644 0.897 0.468
 Eggshell strength, N 14.41 13.50 14.89 14.21 0.37 0.610 0.812 0.881
 Eggshell thickness, mm 0.18 0.18 0.18 0.18 0.00 0.872 0.569 0.804
 Eggshell ratio, % 14.77 14.99 14.67 14.96 0.23 0.957 0.905 0.942
 Yolk ratio, % 32.70 32.14 32.25 32.40 0.29 0.913 0.766 0.542
 Albumen ratio, % 52.53 52.88 53.07 52.64 0.40 0.966 0.884 0.634
 Yolk color 10.89b 12.89a 12.94a 12.72a 0.13 <0.001 <0.001 <0.001
a-b

Means within a row with different superscripts are different at P < 0.05.

1

SEM, standard error of the mean (n = 6).

Egg DHA level

As detailed in the Table 6, graded levels of SAP supplementation (0.4%, 0.8%, and 1.2%) increased DHA level in both whole egg and egg yolk in linear and quadratic patterns across all measured timepoints (14, 28, 42, and 56 days) of the feeding trial (P < 0.001). With regard to intergroup differences, whole egg and egg yolk DHA content exhibited an identical pattern of statistical significance. Specifically, DHA levels in both whole egg and yolk were significantly higher in all SAP-supplemented groups compared to the control group at 14 days of experiment (P < 0.001). The highest concentration was found in the 1.2% supplementation group, although no statistically significant differences were detected among the various Schizochytrium-treated groups at this stage (P > 0.05). By day 28, dietary inclusion of SAP continued to result in significantly elevated DHA levels in whole egg and egg yolk compared to the control group, regardless of the supplemental dosage (P < 0.001). Furthermore, the DHA content in the 0.8% supplementation group was higher than that of the 0.4% group (P < 0.05), while the 1.2% group showed an intermediate level that did not differ from either of the other two treatment groups (P > 0.05). At the later timepoints of 42 and 56 days, birds receiving the basal diet supplemented with any level of SAP maintained significantly higher DHA content in both whole egg and egg yolk relative to the control group (P < 0.001). Additionally, DHA levels in the 0.8% and 1.2% groups were significantly greater than those in the 0.4% group (P < 0.05). Notably, the highest DHA concentrations at these stages were consistently observed in the 0.8% supplementation group. However, no significant difference in DHA content was found between the 0.8% and 1.2% groups at either 42 or 56 days (P > 0.05). This result indicated that DHA enrichment had reached a plateau, with no further increase observed at the higher supplemental dose of 1.2%.

Table 6.

Effects of graded levels of dietary Schizochytrium algae powder supplementation on the docosahexaenoic acid levels in whole egg and egg yolk in laying quails (mg/100 g).

Items Schizochytrium algae powder level
SEM1 P-values
Control 0.40% 0.80% 1.20% Treatment Linear Quadratic
Whole egg
 14 days 89.94b 184.33a 196.88a 205.65a 10.41 <0.001 <0.001 <0.001
 28 days 106.90c 221.83b 255.14a 234.56ab 12.58 <0.001 <0.001 <0.001
 42 days 104.23c 227.53b 260.82a 250.79a 13.39 <0.001 <0.001 <0.001
 56 days 94.83c 218.83b 258.71a 249.78a 13.47 <0.001 <0.001 <0.001
Egg yolk
 14 days 276.36b 565.95a 603.81a 636.40a 32.15 <0.001 <0.001 <0.001
 28 days 330.41c 681.96b 786.48a 719.92ab 38.90 <0.001 <0.001 <0.001
 42 days 322.98c 702.71b 798.32a 780.92a 41.40 <0.001 <0.001 <0.001
 56 days 290.33c 680.57b 802.85a 771.39a 42.21 <0.001 <0.001 <0.001
a-b

Means within a row with different superscripts are different at P < 0.05.

1

SEM, standard error of the mean (n = 6).

Yolk fatty acid profile

As shown in Table 7, dietary SAP supplementation led to significant linear and quadratic increases in DHA (C22:6n-3) deposition at eight week of this experiment (P < 0.05). This resulted in corresponding elevations of total omega-3 PUFAs and the omega-3 to omega-6 ratio, with values in all SAP groups being significantly higher than those of control group (P < 0.05). Furthermore, these indices were significantly higher in the 0.8% and 1.2% groups compared to the 0.4% group (P < 0.05), although no significant difference was observed between the two higher supplementation levels (P > 0.05). Conversely, SAP linearly reduced the concentrations of γ-linolenic acid (GLA, C18:3n-6) and arachidonic acid (ARA, C20:4n-6), thereby linearly decreasing the total omega-6 PUFAs concentrations (P < 0.05). ARA levels in the 0.8% and 1.2% SAP groups were lower than those in the control group (P < 0.05). Additionally, ARA content was higher in the 0.8% group than in the 1.2% group (P < 0.05). No significant difference in ARA was observed between the control and 0.4% groups (P > 0.05). In contrast, yolk GLA concentration did not differ among any of the treatment groups (P > 0.05). For the remaining fatty acids analyzed, no significant treatment effects were detected (P > 0.05). These included the saturated fatty acids: myristic acid (C14:0), palmitic acid (C16:0), margaric acid (C17:0), and stearic acid (C18:0); the monounsaturated fatty acids: palmitoleic acid (C16:1n-7) and oleic acid (C18:1n-9); and the polyunsaturated fatty acids: linoleic acid (C18:2n-6), α-linolenic acid (C18:3n-3), and EPA (C20:5n-3).

Table 7.

Effects of graded levels of dietary Schizochytrium algae powder supplementation on fatty acid composition in egg yolk (mg/100 g).

Fatty acids Schizochytrium algae powder level
SEM1 P-values
0.00% 0.40% 0.80% 1.20% Treatment Linear Quadratic
C14:0 143.10 137.61 144.42 143.76 2.67 0.818 0.729 0.671
C16:0 7662.15 7523.87 7725.28 7448.38 90.35 0.717 0.606 0.716
C16:1n-7 464.95 460.27 483.38 512.84 12.33 0.447 0.148 0.499
C17:0 62.21 56.47 60.70 56.98 1.23 0.285 0.300 0.681
C18:0 3044.64 2833.08 3088.85 2915.32 56.73 0.378 0.796 0.868
C18:1n-9 12734.24 12915.33 13910.19 13109.43 220.78 0.255 0.282 0.266
C18:2n-6 4680.33 4605.71 4427.64 4439.85 59.14 0.361 0.102 0.715
C18:3n-6 65.74 63.42 60.97 57.00 1.33 0.106 0.017 0.741
C18:3n-3 142.83 146.44 142.42 143.81 2.41 0.944 0.963 0.831
C20:4n-6 558.44a 533.13ab 495.34b 427.78c 13.38 <0.001 <0.001 0.264
C20:5n-3 30.41 30.75 30.93 34.15 0.78 0.304 0.111 0.358
C22:6n-3 290.33c 680.57b 802.85a 771.39a 42.21 <0.001 <0.001 <0.001
Total omega-3 polyunsaturated fatty acids 463.57c 857.77b 976.20a 949.35a 44.19 <0.001 <0.001 <0.001
Total omega-6 polyunsaturated fatty acid 5304.52 5202.25 4983.95 4924.63 64.35 0.113 0.019 0.859
Omega-3/omega-6 ratio 0.09c 0.17b 0.20a 0.19a 0.01 <0.001 <0.001 <0.001
a-c

Means within a row with different superscripts are different at P < 0.05.

1

SEM, standard error of the mean (n = 6).

Gene expression

The graded inclusion of SAP linearly up-regulated the expression of CD 36 and apoB in the duodenal mucosa (Fig. 1A, P < 0.05). Compared with the control, duodenal CD36 mRNA abundance was higher in all Schizochytrium supplementation groups, regardless of dosage (P < 0.05); however, no significant differences were detected among the supplemented groups themselves (P > 0.05). Similarly, duodenal apoB expression was increased in the 0.8% and 1.2% supplementation groups relative to the control (P < 0.05), with no significant difference observed between these two groups (P > 0.05). In contrast, apoB expression in the 0.4% group did not differ from the control group (P > 0.05), but was significantly lower than that in both the 0.8% and 1.2% groups (P < 0.05). However, dietary treatment did not alter FABP2 or FATP4 gene expression in the duodenal mucosa (P > 0.05).

Fig. 1.

Fig 1 dummy alt text

Effects of graded levels of dietary Schizochytrium algae powder supplementation on the mRNA expression of genes involved in lipid absorption and transport in the duodenum (A), jejunum (B), and liver (C) in laying quails.

The column and its bar represented the mean value and corresponding standard error (n = 6), respectively. Bars with different letters differ significantly at P < 0.05. SAP, Schizochytrium algae powder; CD36, cluster of differentiation 36; FABP2, fatty acid-binding protein 2; apoB, apolipoprotein B; FATP4, fatty acid transport protein 4; FABP1, fatty acid-binding protein 1; Mfsd2a, major facilitator superfamily domain-containing 2a; apoVLDL-Ⅱ, very low density apolipoprotein II; VTG-1, vitellogenin-1; VTG-2, vitellogenin-2; ELOVL2, elongation of very long-chain fatty acid 2; MTTP, microsomal triglyceride transfer protein.

As shown in the Fig. 1B, dietary supplementation with SAP linearly up-regulated the expression of jejunal mucosal FABP2 and apoB (P < 0.05). A significantly higher expression of jejunal apoB was observed in the 1.2% group compared with the control (P < 0.05). The inclusion of 0.4% and 0.8% SAP did not alter the expression of jejunal apoB (P > 0.05), although their mean values were higher than those of the control group and did not differ from the 1.2% group (P > 0.05). Nevertheless, no significant difference was detected in CD 36 or FATP4 expression in the jejunal mucosa among the treatment groups (P > 0.05).

A linear effect was observed for the hepatic expression of FABP1, Mfsd2a, and apoVLDL-Ⅱ in laying quails fed a basal diet supplemented with graded levels of SAP (Fig. 1C, P < 0.05). Compared with the control group, hepatic FABP1 expression was up-regulated in the 0.8% and 1.2% supplementation groups (P < 0.05). Although FABP1 expression in the 0.4% group was similar to that in the 0.8% and 1.2% groups, it did not differ significantly from the control group (P > 0.05). No significant difference was found in hepatic FABP1 expression between the 0.8% and 1.2% groups (P > 0.05). As for hepatic Mfsd2a, its expression was higher in the 1.2% group compared with the control and the other Schizochytrium-treated groups (0.4% and 0.8%) (P < 0.05). In contrast, no significant differences were observed among the control, 0.4%, and 0.8% groups (P > 0.05). Moreover, all SAP-supplemented groups exhibited higher hepatic apoVLDL-II expression than the control group (P < 0.05), while no significant differences were detected among the supplemented groups (P > 0.05). However, hepatic expression of ELOVL2, MTTP, and apoB did not differ significantly among the four groups (P > 0.05).

Discussion

Although dietary supplementation with DHA-rich microalgae has proven effective in enriching the DHA content of eggs, its impact on the performance and physiology of laying poultry remains inconsistent. For example, the recommended inclusion level for DHA-rich microalgae oil in laying hen diets is no more than 20 g/kg, as feeding higher levels (≥30 g/kg) has been shown to impair productive performance, induce liver enlargement, and disrupt ovarian follicle hierarchy (Elkin et al., 2023). In agreement with this finding, we observed a non‑linear, quadratic response between the SAP supplementation level and production performance in laying quails during the eight‑week feeding trial, which differs from the more commonly reported linear dose‑response relationship for egg DHA enrichment. Specifically, the average egg production rate and egg mass exhibited significant quadratic responses, peaking at 0.4% SAP supplementation and indicating an optimal dosage point, whereas higher levels (0.8% and 1.2%) conferred no further significant benefits. Although research to date has primarily focused on laying hens, the effects of dietary Schizochytrium on their performance remain inconsistent. This finding is distinct from previous reports, in which the dose-dependent enhancement of egg DHA content following SAP supplementation was not accompanied by a significant impact on laying performance (Kaewsutas et al., 2016; Liu et al., 2020; Kiran et al., 2024). The results also contrast with a previously reported finding that supplementation with Schizochytrium at 0.5–1.0% improved production performance in laying hens (Park et al., 2015). This observed divergence reveals that the benefits of SAP on productive performance cannot be attributed solely to its role in supplying DHA. The superior laying performance observed at the 0.4% SAP level, compared to both control and higher doses (0.8% and 1.2%), indicates an optimal functional range for SAP incorporation. Within this optimal range, the long-chain polyunsaturated fatty acids such as DHA and EPA (Lee et al., 2019; Kapoor et al., 2021; Alagawany et al., 2022) and other bioactive substances (Wu et al., 2021; Mavrommatis et al., 2023) derived from SAP are likely to collectively improve metabolic balance, redox status, immune function, and liver and intestine health in laying quails, thereby enhancing their overall physiological homeostasis and ultimately resulting in greater egg production rate and egg mass. At higher inclusion levels (0.8% and 1.2%), dietary supplementation with SAP did not further improve the productive performance of laying quails in this study, which may be attributed to a combination of metabolic alterations. The elevated intakes of DHA and other bioactive components such as natural antioxidants from SAP likely modulate hepatic lipid metabolism, reduce hepatic metabolic burden, and improve antioxidant capacity and immune function, thereby diverting energetic and nutritional resources toward egg synthesis (Estévez, 2015; Hodson and Gunn, 2019; Zaefarian et al., 2019; Imtiaz et al., 2025). Collectively, these interrelated mechanisms likely contribute to the productive performance plateau observed at elevated supplementation levels in this study. The absence of significant differences in feed intake, egg weight, and feed conversion ratio across treatment groups aligns with earlier reports in laying hens (Kaewsutas et al., 2016; Liu et al., 2020; Kiran et al., 2024), suggesting that SAP within the tested range did not affect feed palatability, feed efficiency, or egg size. This consistency in these parameters further implies that the optimal laying performance rate and egg mass observed at 0.4% SAP is not attributed to the feed intake, but rather results from metabolic and physiological improvement elicited at this supplementation level. The observed linear decrease in mortality, although not statistically significant among specific groups, may be correlated with the potential health-modulating properties of various bioactive components derived from Schizochytrium, including DHA, carotenoids, squalene, and polysaccharides (Puri and Sahni, 2023). In addition to its role as a precursor to specialized pro-resolving mediators, a class of lipid mediators that actively resolve inflammation, DHA also contributes to membrane integrity, modulates immune responses, and exerts direct regulatory effects on metabolism (López-Vicario et al., 2016; Li et al., 2021), which may also be associated with a non-significant linear reduction in mortality among quails fed increasing dietary levels of SAP.

As a critical economic and nutritional characteristic, egg quality directly influences the hatchability, market value, and consumer acceptance across all types of poultry eggs (Wilson, 2017; Sharaf Eddin et al., 2019). In the present study, eggshell thickness displayed a quadratic increase to dietary supplementation with SAP at four weeks of this experiment, although pairwise comparisons with the control group did not achieve statistical significance. The similar beneficial effects of Schizochytrium on eggshell thickness have also been observed previously in laying hens at inclusion levels of 0.5% and 1% (Park et al., 2015), although it should be noted that other studies have reported no significant effect of microalgal supplementation on this trait. An earlier study has demonstrated that DHA significantly improves calcium bioavailability and promotes its deposition in bone, with a notable positive correlation observed in male rats between DHA supplementation levels and both bone density and bone calcium content (Kruger and Schollum, 2005). Mechanistically, DHA is known to facilitate calcium absorption by modulating intestinal vitamin D receptors and adenosine triphosphatases, both of which play crucial roles in calcium uptake (Haag and Kruger, 2001; Leonard et al., 2001; Haag et al., 2003). The observed quadratic increase in the eggshell thickness in the current experiment may be partially attributable to the DHA derived from dietary SAP. However, the modulatory effect of SAP supplementation on eggshell thickness was no longer detectable by the eighth week. Although the precise mechanism remains unclear, this attenuation may reflect an adaptive physiological response or a time-related shift in mineral metabolism dynamics, and further studies are needed to assess the long-term implications of SAP on calcium homeostasis. Additionally, the yolk color of quail eggs was elevated in a dose-dependent manner by SAP supplementation, with both linear and quadratic effects observed at weeks four and eight of this feeding trial. Dietary SAP supplementation significantly enhanced yolk color compared with the control group, regardless of dosage. The enhancement of yolk color observed in this study corroborates with prior findings, wherein laying hens receiving Schizochytrium-supplemented feed exhibited a similar increase (Park et al., 2015; Wu et al., 2019; Kiran et al., 2024). The increase in yolk color observed in this study can be explained by the carotenoid composition of SAP, including β-carotene, astaxanthin, and lutein, which are efficiently absorbed and subsequently deposited into the yolk during egg formation (Tang et al., 2022; Song et al., 2024). Moreover, DHA and other fatty acids in the SAP has been demonstrated to improve carotenoid bioavailability through intestinal emulsification, solubilization, and micellar incorporation and by regulating lipid transporter-mediated transepithelial pathways to further facilitate the deposition of pigments such as β-carotene, astaxanthin, and lutein into the yolk, resulting in significant color intensification (Reboul et al., 2019; Guo et al., 2024). In laying hens, dietary inclusion of DHA-rich microalgae oil at up to 20 g/kg enabled near-maximal enrichment of egg yolks with very long-chain n-3 PUFAs without impairing hen performance, whereas feeding at 40 g/kg resulted in hypotriglyceridemia, decreased egg production, liver enlargement, altered ovarian follicle hierarchy, and attenuated expression of key genes involved in hepatic triglyceride synthesis and secretion, ultimately leading to a reduction in yolk ratio (Elkin et al., 2023). In our study, dietary supplementation with SAP did not significantly affect eggshell weight, albumen weight, yolk weight, or the ratios of these components to total egg weight, which may be attributable to the lower inclusion level of SAP used in the present study.

As expected, graded supplementation with SAP (0.4% to 1.2%) resulted in a dose-dependent increase in DHA content in both whole eggs and yolks throughout the 56-day trial period, indicating that Schizochytrium powder supplementation in quail feed represents an effective strategy for producing DHA-enriched quail eggs, which mirrors the outcomes observed in earlier laying hen studies (Wu et al., 2019; Kralik et al., 2020; Kiran et al., 2024). In this study, all SAP-supplemented groups consistently surpassed the control in DHA content (whole egg and egg yolk) throughout the trial, with the 0.8% group reaching the highest level after day 28 and the 1.2% group showing no further increase, which demonstrates a clear plateau in DHA accumulation beyond 0.8% dietary inclusion. In laying hens, dietary supplementation with Schizochytrium powder has been shown to linearly increase egg DHA content at inclusion levels of 0.5%, 1.0%, and 2.0% in an eight-week feeding trial; however, excessive supplementation (2.0%) can compromise egg production performance, and a 1.0% inclusion level is therefore recommended (Wang et al., 2025b). The 1.0% supplementation level of Schizochytrium has also been consistently identified in multiple independent studies as the optimal dosage for maximizing DHA concentration in the eggs of laying hens (Park et al., 2015; Kaewsutas et al., 2016; Liu et al., 2020; Kiran et al., 2024). Collectively, these findings indicate that the optimal inclusion level of Schizochytrium powder is broadly comparable between laying hens and quails for maximizing egg DHA deposition, though this may vary with the DHA content of the Schizochytrium powder, feed composition, and animal age. At week 8 of the experiment, SAP supplementation significantly increased yolk DHA concentration, following both linear and quadratic patterns. This rise in DHA contributed to a corresponding linear and quadratic increase in total omega-3 PUFA content, as well as a greater omega-3 to omega-6 ratio in the yolk. Concurrently, SAP supplementation linearly reduced the levels of two key omega-6 PUFAs, GLA and ARA, resulting in a linear decrease in total omega-6 PUFAs. The observed reductions in yolk GLA and ARA concentrations with increasing levels of SAP supplementation can be explained by competitive inhibition between omega-3 and omega-6 PUFAs, as these two families are metabolized by the same desaturation and elongation enzymes (Saini and Keum, 2018). Dietary DHA, which was highly abundant in the SAP used in our study, has shown to inhibit Δ6-desaturase and Δ5-desaturase activities (Lamaziere et al., 2013). These enzymes catalyze key steps in the omega-6 PUFA biosynthetic pathway, with Δ6-desaturase converting linoleic acid to GLA, which is subsequently elongated and then desaturated by Δ5-desaturase to generate ARA. Notably, linoleic acid concentrations remained unaffected across dietary treatments, indicating that the decreases in GLA and ARA may be due to suppressed desaturase activity rather than limited substrate availability. The simultaneous decrease in both GLA and ARA indicates that the inhibition may occur at or upstream of the Δ6-desaturase step, rather than at Δ5-desaturase, since inhibition at Δ5-desaturase would lead to the accumulation of GLA or its elongated intermediate. Importantly, DHA has been shown to act as a non-competitive inhibitor of Δ6-desaturase with respect to α-linolenic acid, exhibiting a more potent inhibitory effect than the other fatty acids tested (Valenzuela et al., 2025). Together, these findings provide direct mechanistic evidence that DHA enrichment from SAP supplementation suppressed linoleic acid conversion to GLA and subsequently ARA, leading to the observed dose-dependent decreases in these omega-6 PUFAs. The omega‑3 to omega‑6 ratio is of critical physiological significance, as omega-3 and omega-6 PUFAs are metabolized by the same enzymes yet exert opposing physiological functions. Omega-6-derived eicosanoids, particularly from ARA, are predominantly pro-inflammatory, pro-aggregatory, and vasoconstrictive, while omega-3-derived mediators exhibit anti-inflammatory and anti-aggregatory effects and promote vasodilation (Patel et al., 2022). Therefore, the elevated omega-3 to omega-6 ratio observed in eggs from SAP-supplemented laying quails in this study represents a nutritional improvement, which may contribute to the prevention of chronic diseases such as cardiovascular disease, cancer, diabetes, and inflammatory disorders (Kar et al., 2023).

The transcriptional results from the duodenum and jejunum indicated segment-specific regulatory effects of SAP on lipid transport genes. In the duodenum, graded SAP inclusion linearly upregulated CD36 and apoB expression. While duodenal CD36 was elevated at all supplementation levels compared to the control, apoB expression increased significantly only at the 0.8% and 1.2% levels. In the jejunum, SAP supplementation similarly enhanced apoB and FABP2 expression in a dose-dependent manner, with apoB reaching statistical significance specifically at the 1.2% inclusion level. CD36, a multifunctional membrane receptor abundantly expressed along the digestive tract, plays a critical role in lipid absorption by facilitating recognition and uptake of long-chain fatty acids in enterocytes and promoting chylomicron secretion (Cifarelli and Abumrad, 2018). Intestinal FABP2, a cytosolic protein specifically expressed in enterocytes, binds long-chain fatty acids with high affinity to facilitate their intracellular transport and metabolism (Gajda and Storch, 2015; Hotamisligil and Bernlohr, 2015). apoB is the essential structural component for the assembly and secretion of triglyceride-rich lipoproteins. In contrast to mammals, avian species express only apoB100, and this intestinal isoform is responsible for assembling and transporting absorbed dietary lipids into the circulation (Walzem et al., 1999; Damsteegt et al., 2018). The observed upregulation of CD36, FABP2, and apoB in the duodenum and/or jejunum may stem from an adaptive positive-feedback response triggered by dietary DHA and other fatty acids from SAP, in which the body coordinately enhances the expression of key genes involved in intestinal fatty acid uptake, intracellular transport, and lipid export to optimize assimilation of these essential nutrients. In alignment with the intestinal gene expression patterns, hepatic expression of FABP1, Mfsd2a, and apoVLDL-II also exhibited a linear dose-response to SAP supplementation. Specifically, FABP1 was upregulated at 0.8% and 1.2% SAP compared to the control, while Mfsd2a increased at the highest dose of 1.2% relative to all other groups. ApoVLDL-II, by contrast, was upregulated across all SAP-supplemented groups compared to the control. FABP1, the liver fatty acid-binding protein, is predominantly expressed in the liver and functions as a key intracellular lipid transporter (Lagakos et al., 2011). This protein is responsible for the transport of lipids to organelles where they are either metabolized to generate energy or stored, while simultaneously modulating metabolic pathways and transcriptional activity (Agellon, 2024). Mfsd2a, a sodium-dependent transporter, mediates the uptake of dietary-derived omega-3 PUFAs in the form of lysophosphatidylcholine-bound DHA from the circulation into the central nervous system and other tissues (Blades et al., 2025; Cunha et al., 2025). apoVLDL-II acts as a lipoprotein lipase inhibitor, thereby ensuring that lipid-transporting particles are delivered intact from the liver to the oocytes for egg production and subsequent embryonic development (Alvarenga et al., 2011). The observed upregulation of hepatic FABP1, Mfsd2a, and apoVLDL-II would provide a plausible mechanism for the elevated DHA content found in whole eggs and yolks. In avian species, unlike in mammals, the liver serves as the primary site for de novo lipogenesis and lipoprotein production (Zaefarian et al., 2019). The upregulated expression of FABP1 in laying quails likely facilitates trafficking of long‑chain fatty acids such as DHA, directing them toward esterification pathways. Simultaneously, the upregulation of Mfsd2a may promote the hepatic secretion of DHA-enriched lipoproteins into the circulation. The increased expression of apoVLDL-II further facilitates DHA delivery to the ovaries by inhibiting lipoprotein lipase, thus maintaining circulating DHA-rich lipoproteins and promoting their uptake by ovarian tissues. These hepatic adaptations, together with the earlier observed upregulation of intestinal CD36, FABP2, and apoB that improves dietary DHA absorption, collectively increase the flux of DHA available for hepatic uptake. This expanded DHA pool is then incorporated into yolk-directed very-low-density lipoproteins, resulting in greater DHA deposition in the egg yolks of laying quails fed the basal diet supplemented with SAP.

Conclusions

Dietary supplementation with SAP resulted in linear and/or quadratic improvements in egg production rate, egg mass, and yolk color, while decreasing mortality at inclusion levels of up to 1.2%.Furthermore, yolk DHA content and total omega-3 PUFAs, as well as the omega-3/omega-6 ratio, increased in a dose-dependent manner, with DHA levels reaching a plateau at 0.8% SAP. These effects were linked to the linear upregulation of key genes involved in lipid absorption and transport in the intestine and liver. Following a comprehensive assessment of laying performance, egg quality, DHA enrichment and fatty acid composition, and gene expression, the optimal dietary SAP inclusion level for Chinese yellow-feathered laying quails is recommended to be 0.4–0.8%. These findings provide a scientific foundation for the production of DHA-enriched quail eggs as functional foods.

Disclosures

All authors have read and approved the final manuscript. The authors declare no conflicts of interest. This manuscript is original and is not under consideration elsewhere.

CRediT authorship contribution statement

Zihao Qin: Visualization, Software, Project administration, Methodology, Investigation, Formal analysis, Data curation. Zhixing Rong: Supervision, Project administration, Investigation, Conceptualization. Gaofeng Chen: Project administration. Xinghuo Liu: Project administration. Chao Jia: Supervision. Xiang Zhong: Supervision. Debing Yu: Supervision. Shixian Yin: Supervision. Yueping Chen: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Software, Resources, Formal analysis, Conceptualization.

Acknowledgments

This study was funded by the Special Fund Project for Central Government to Guide Local Science and Technology Development (2024ZYQ066).

References

  1. Agellon L.B. Importance of fatty acid binding proteins in cellular function and organismal metabolism. J. Cell. Mol. Med. 2024;28 doi: 10.1111/jcmm.17703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alagawany M., Elnesr S.S., Farag M.R., El-Sabrout K., Alqaisi O., Dawood M.A.O., Soomro H., Abdelnour S.A. Nutritional significance and health benefits of omega-3, -6 and -9 fatty acids in animals. Anim. Biotechnol. 2022;33:1678–1690. doi: 10.1080/10495398.2020.1869562. [DOI] [PubMed] [Google Scholar]
  3. Alvarenga R.R., Zangeronimo M.G., Pereira L.J., Rodrigues P.B., Gomide E.M. Lipoprotein metabolism in poultry. World’s Poult. Sci. J. 2011;67:431–440. [Google Scholar]
  4. Blades F., Yazici A.T., Cater R.J., Mancia F. MFSD2A in focus: the molecular mechanism of omega-3 fatty acid transport. Physiology. 2025;40:470–483. doi: 10.1152/physiol.00068.2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Burdge G.C., Calder P.C. Conversion of alpha-linolenic acid to longer-chain polyunsaturated fatty acids in human adults. Reprod. Nutr. Dev. 2005;45:581–597. doi: 10.1051/rnd:2005047. [DOI] [PubMed] [Google Scholar]
  6. Burdge G.C., Wootton S.A. Conversion of alpha-linolenic acid to eicosapentaenoic, docosapentaenoic and docosahexaenoic acids in young women. Br. J. Nutr. 2002;88:411–420. doi: 10.1079/BJN2002689. [DOI] [PubMed] [Google Scholar]
  7. Cardoso C., Afonso C., Bandarra N.M. Dietary DHA and health: cognitive function ageing. Nutr. Res. Rev. 2016;29:281–294. doi: 10.1017/S0954422416000184. [DOI] [PubMed] [Google Scholar]
  8. Cifarelli V., Abumrad N.A. Intestinal CD36 and other key proteins of lipid utilization: role in absorption and gut homeostasis. Compr. Physiol. 2018;8:493–507. doi: 10.1002/cphy.c170026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cunha C.V.A., Oharomari L.K., de Lima J.B., de Paula L.M., Katashima C.K., Rios T., Meneguelli T., Pinto A.P., Buoro D.H.T., da Silva Carneiro F., Ropelle E., Pauli J.R., da Silva A.S.R., Cintra D.E. The influence of diet, age, and obesity on hypothalamic omega-3 fatty acid transporter MFSD2a. Food Res. Int. 2025;218 doi: 10.1016/j.foodres.2025.116906. [DOI] [PubMed] [Google Scholar]
  10. Damsteegt E.L., Davie A., Lokman P.M. The evolution of apolipoprotein B and its mRNA editing complex. Does the lack of editing contribute to hypertriglyceridemia? Gene. 2018;641:46–54. doi: 10.1016/j.gene.2017.10.024. [DOI] [PubMed] [Google Scholar]
  11. Elkin R.G., El-Zenary A.S.A., Bomberger R., Haile A.B., Weaver E.A., Ramachandran R., Harvatine K.J. Feeding laying hens docosahexaenoic acid-rich microalgae oil at 40 g/kg diet causes hypotriglyceridemia, depresses egg production, and attenuates expression of key genes affecting hepatic triglyceride synthesis and secretion, but is rescued by dietary co-supplementation of high-oleic sunflower oil. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Esmaeili V., Shahverdi A.H., Moghadasian M.H., Alizadeh A.R. Dietary fatty acids affect semen quality: a review. Andrology. 2015;3:450–461. doi: 10.1111/andr.12024. [DOI] [PubMed] [Google Scholar]
  13. Estévez M. Oxidative damage to poultry: from farm to fork. Poult. Sci. 2015;94:1368–1378. doi: 10.3382/ps/pev094. [DOI] [PubMed] [Google Scholar]
  14. Fu Y., Wang Y., Gao H., Li D., Jiang R., Ge L., Tong C., Xu K. Associations among dietary omega-3 polyunsaturated fatty acids, the gut microbiota, and intestinal immunity. Mediators Inflamm. 2021;2021 doi: 10.1155/2021/8879227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gajda A.M., Storch J. Enterocyte fatty acid-binding proteins (FABPs): different functions of liver and intestinal FABPs in the intestine. Prostaglandins Leukot. Essent. Fatty Acids. 2015;93:9–16. doi: 10.1016/j.plefa.2014.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ghasemi Fard S., Wang F., Sinclair A.J., Elliott G., Turchini G.M. How does high DHA fish oil affect health? A systematic review of evidence. Crit. Rev. Food Sci. Nutr. 2019;59:1684–1727. doi: 10.1080/10408398.2018.1425978. [DOI] [PubMed] [Google Scholar]
  17. Guo Z., Liu Y., Luo Y. Mechanisms of carotenoid intestinal absorption and the regulation of dietary lipids: lipid transporter-mediated transintestinal epithelial pathways. Crit. Rev. Food Sci. Nutr. 2024;64:1791–1816. doi: 10.1080/10408398.2022.2119204. [DOI] [PubMed] [Google Scholar]
  18. Haag M., Kruger M.C. Upregulation of duodenal calcium absorption by poly-unsaturated fatty acids: events at the basolateral membrane. Med. Hypotheses. 2001;56:637–640. doi: 10.1054/mehy.2000.1182. [DOI] [PubMed] [Google Scholar]
  19. Haag M., Magada O.N., Claassen N., Böhmer L.H., Kruger M.C. Omega-3 fatty acids modulate ATPases involved in duodenal Ca absorption. Prostaglandins Leukot. Essent. Fatty Acids. 2003;68:423–429. doi: 10.1016/s0952-3278(03)00067-x. [DOI] [PubMed] [Google Scholar]
  20. Hodson L., Gunn P.J. The regulation of hepatic fatty acid synthesis and partitioning: the effect of nutritional state. Nat. Rev. Endocrinol. 2019;15:689–700. doi: 10.1038/s41574-019-0256-9. [DOI] [PubMed] [Google Scholar]
  21. Hotamisligil G.S., Bernlohr D.A. Metabolic functions of FABPs–mechanisms and therapeutic implications. Nat. Rev. Endocrinol. 2015;11:592–605. doi: 10.1038/nrendo.2015.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hussein N., Ah-Sing E., Wilkinson P., Leach C., Griffin B.A., Millward D.J. Long-chain conversion of [13C] linoleic acid and alpha-linolenic acid in response to marked changes in their dietary intake in men. J. Lipid Res. 2005;46:269–280. doi: 10.1194/jlr.M400225-JLR200. [DOI] [PubMed] [Google Scholar]
  23. Imtiaz A., Bin Tahir M.T., Zhao M., Gong D., Ge J., Geng T. Non-alcoholic fatty liver disease in poultry: risk factors, mechanism of development, and emerging strategies. Int. J. Mol. Sci. 2025;26:8460. doi: 10.3390/ijms26178460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jesionowska M., Ovadia J., Hockemeyer K., Clews A.C., Xu Y. EPA and DHA in microalgae: health benefits, biosynthesis, and metabolic engineering advances. J. Am. Oil Chem. Soc. 2023;100:831–842. [Google Scholar]
  25. Kaewsutas M., Sarikaphuti A., Nararatwanchai T., Sittiprapaporn P., Patchanee P. The effects of dietary microalgae (Schizochytrium spp.) and fish oil in layers on docosahexaenoic acid omega-3 enrichment of the eggs. J. Appl. Anim. Nutr. 2016;4:e7. [Google Scholar]
  26. Kapoor B., Kapoor D., Gautam S., Singh R., Bhardwaj S. Dietary polyunsaturated fatty acids (PUFAs): uses and potential health benefits. Curr. Nutr. Rep. 2021;10:232–242. doi: 10.1007/s13668-021-00363-3. [DOI] [PubMed] [Google Scholar]
  27. Kar A., Ghosh P., Patra P., Chini D.S., Nath A.K., Saha J.K., Patra B.C. Omega-3 fatty acids mediated cellular signaling and its regulation in human health. Clin. Nutr. Open Sci. 2023;52:72–86. [Google Scholar]
  28. Kazemi M. Algae as a sustainable feed resource: revolutionizing animal nutrition. Aquacult. Int. 2025;33:535. [Google Scholar]
  29. Kiran I., Umbreen H., Nisa M.U., Al-Asmari F., Zongo E. Supplementation of laying hens' feed with Schizochytrium powder and its effect on physical and chemical properties of eggs. BMC Vet. Res. 2024;20:557. doi: 10.1186/s12917-024-04424-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kralik Z., Kralik G., Grčević M., Hanžek D., Margeta P. Microalgae Schizochytrium limacinum as an alternative to fish oil in enriching table eggs with n-3 polyunsaturated fatty acids. J. Sci. Food Agric. 2020;100:587–594. doi: 10.1002/jsfa.10052. [DOI] [PubMed] [Google Scholar]
  31. Kris-Etherton P.M., Grieger J.A., Etherton T.D. Dietary reference intakes for DHA and EPA. Prostaglandins Leukot. Essent. Fatty Acids. 2009;81:99–104. doi: 10.1016/j.plefa.2009.05.011. [DOI] [PubMed] [Google Scholar]
  32. Kruger M.C., Schollum L.M. Is docosahexaenoic acid more effective than eicosapentaenoic acid for increasing calcium bioavailability? Prostaglandins Leukot. Essent. Fatty Acids. 2005;73:327–334. doi: 10.1016/j.plefa.2005.08.001. [DOI] [PubMed] [Google Scholar]
  33. Lagakos W.S., Gajda A.M., Agellon L., Binas B., Choi V., Mandap B., Russnak T., Zhou Y.X., Storch J. Different functions of intestinal and liver-type fatty acid-binding proteins in intestine and in whole body energy homeostasis. Am. J. Physiol. Gastrointest. Liver Physiol. 2011;300:G803–G814. doi: 10.1152/ajpgi.00229.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lamaziere A., Wolf C., Barbe U., Bausero P., Visioli F. Lipidomics of hepatic lipogenesis inhibition by omega 3 fatty acids. Prostaglandins Leukot. Essent. Fatty Acids. 2013;88:149–154. doi: 10.1016/j.plefa.2012.12.001. [DOI] [PubMed] [Google Scholar]
  35. Lauritzen L., Hansen H.S., Jørgensen M.H., Michaelsen K.F. The essentiality of long chain n-3 fatty acids in relation to development and function of the brain and retina. Prog. Lipid Res. 2001;40:1–94. doi: 10.1016/s0163-7827(00)00017-5. [DOI] [PubMed] [Google Scholar]
  36. Lee S.A., Whenham N., Bedford M.R. Review on docosahexaenoic acid in poultry and swine nutrition: consequence of enriched animal products on performance and health characteristics. Anim. Nutr. 2019;5:11–21. doi: 10.1016/j.aninu.2018.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Leonard F., Haag M., Kruger M.C. Modulation of intestinal vitamin D receptor availability and calcium ATPase activity by essential fatty acids. Prostaglandins Leukot. Essent. Fatty Acids. 2001;64:147–150. doi: 10.1054/plef.2001.0254. [DOI] [PubMed] [Google Scholar]
  38. Li J., Pora B.L.R., Dong K., Hasjim J. Health benefits of docosahexaenoic acid and its bioavailability: a review. Food Sci. Nutr. 2021;9:5229–5243. doi: 10.1002/fsn3.2299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Liu B., Zhou Q., Zhu J., Lin G., Yu D., Ao T. Time course of nutritional and functional property changes in egg yolk from laying hens fed docosahexaenoic acid-rich microalgae. Poult. Sci. 2020;99:4616–4625. doi: 10.1016/j.psj.2020.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  41. López-Vicario C., Rius B., Alcaraz-Quiles J., García-Alonso V., Lopategi A., Titos E., Clària J. Pro-resolving mediators produced from EPA and DHA: overview of the pathways involved and their mechanisms in metabolic syndrome and related liver diseases. Eur. J. Pharmacol. 2016;785:133–143. doi: 10.1016/j.ejphar.2015.03.092. [DOI] [PubMed] [Google Scholar]
  42. Lukanov H. Domestic quail (Coturnix japonica domestica), is there such farm animal? World’s Poult. Sci. J. 2019;75:547–558. [Google Scholar]
  43. Madeira M.S., Cardoso C., Lopes P.A., Coelho D., Afonso C., Bandarra N.M., Prates J.A.M. Microalgae as feed ingredients for livestock production and meat quality: a review. Livest. Sci. 2017;205:111–121. [Google Scholar]
  44. Mavrommatis A., Tsiplakou E., Zerva A., Pantiora P.D., Georgakis N.D., Tsintzou G.P., Madesis P., Labrou N.E. Microalgae as a sustainable source of antioxidants in animal nutrition, health and livestock development. Antioxidants. 2023;12:1882. doi: 10.3390/antiox12101882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Orzuna-Orzuna J.F., Godina-Rodríguez J.E., Garay-Martínez J.R., Reséndiz-González G., Joaquín-Cancino S., Lara-Bueno A. Milk yield, composition, and fatty acid profile in milk of dairy cows supplemented with microalgae schizochytrium sp.: a meta-analysis. Agriculture. 2024;14:1119. [Google Scholar]
  46. Park J.H., Upadhaya S.D., Kim I.H. Effect of dietary marine microalgae (Schizochytrium) powder on egg production, blood lipid profiles, egg quality, and fatty acid composition of egg yolk in layers. Asian-Australas. J. Anim. Sci. 2015;28:391–397. doi: 10.5713/ajas.14.0463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Patel A., Desai S.S., Mane V.K., Enman J., Rova U., Christakopoulos P., Matsakas L. Futuristic food fortification with a balanced ratio of dietary ω-3/ω-6 omega fatty acids for the prevention of lifestyle diseases. Trends Food Sci. Technol. 2022;120:140–153. [Google Scholar]
  48. Peng Z., Zhong L., Li Y., Feng S., Mou J., Miao Y., Lin C.S.K., Wang Z., Li X. Harnessing oleaginous protist schizochytrium for docosahexaenoic acid: current technologies in sustainable production and food applications. Food Res. Int. 2025;205 doi: 10.1016/j.foodres.2025.115996. [DOI] [PubMed] [Google Scholar]
  49. Puri M., Gupta A., Sahni S. Schizochytrium sp. Trends Microbiol. 2023;31:872–873. doi: 10.1016/j.tim.2023.01.010. [DOI] [PubMed] [Google Scholar]
  50. Reboul E. Mechanisms of carotenoid intestinal absorption: where do we stand? Nutrients. 2019;11:838. doi: 10.3390/nu11040838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Saini R.K., Keum Y.S. Omega-3 and omega-6 polyunsaturated fatty acids: dietary sources, metabolism, and significance-A review. Life Sci. 2018;203:255–267. doi: 10.1016/j.lfs.2018.04.049. [DOI] [PubMed] [Google Scholar]
  52. Sharaf Eddin A., Ibrahim S.A., Tahergorabi R. Egg quality and safety with an overview of edible coating application for egg preservation. Food Chem. 2019;296:29–39. doi: 10.1016/j.foodchem.2019.05.182. [DOI] [PubMed] [Google Scholar]
  53. Song Y., Yang X., Li S., Luo Y., Chang J.S., Hu Z. Thraustochytrids as a promising source of fatty acids, carotenoids, and sterols: bioactive compound biosynthesis, and modern biotechnology. Crit. Rev. Biotechnol. 2024;44:618–640. doi: 10.1080/07388551.2023.2196373. [DOI] [PubMed] [Google Scholar]
  54. Tang X., Man Y., Hu X., Xu X., Ren L. Identification of carotenoids biosynthesis pathway in Schizochytrium sp. and utilization in astaxanthin biosynthesis. Enzyme Microb. Technol. 2022;156 doi: 10.1016/j.enzmictec.2022.110018. [DOI] [PubMed] [Google Scholar]
  55. Trevi S., Uren Webster T., Consuegra S., Garcia de Leaniz C. Benefits of the microalgae spirulina and schizochytrium in fish nutrition: a meta-analysis. Sci. Rep. 2023;13:2208. doi: 10.1038/s41598-023-29183-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Valenzuela R., Metherel A.H., Cisbani G., Smith M.E., Chouinard-Watkins R., Klievik B.J., Farias C., Videla L.A., Bazinet R.P. Specific activity of mouse liver desaturases and elongases: time course effects using n-3 and n-6 PUFA substrates and inhibitory responses of delta-6 desaturase. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2025;1870 doi: 10.1016/j.bbalip.2025.159594. [DOI] [PubMed] [Google Scholar]
  57. Walzem R.L., Hansen R.J., Williams D.L., Hamilton R.L. Estrogen induction of VLDLy assembly in egg-laying hens. J. Nutr. 1999;129:467S–472S. doi: 10.1093/jn/129.2.467S. [DOI] [PubMed] [Google Scholar]
  58. Wang L., Cheng C., Yu X., Guo L., Wan X., Xu J., Xiang X., Yang J., Kang J., Deng Q. Conversion of α-linolenic acid into n-3 long-chain polyunsaturated fatty acids: bioavailability and dietary regulation. Crit. Rev. Food Sci. Nutr. 2025;65:6470–6502. doi: 10.1080/10408398.2024.2442064. [DOI] [PubMed] [Google Scholar]
  59. Wang Q., Han W., Jin W.B., Gao S.H., Zhou X. Docosahexaenoic acid production by Schizochytrium sp.: review and prospect. Food Biotechnol. 2021;35:111–135. [Google Scholar]
  60. Wang Q., Huang H., Li C., Huang Z., Wu Z., Kong L., Zhao Z., Wang Z. The role of dietary Schizochytrium powder in chicken production performance, egg quality, and antioxidant status. Animals. 2025;15:3494. doi: 10.3390/ani15233494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wilson P.B. Recent advances in avian egg science: a review. Poult. Sci. 2017;96:3747–3754. doi: 10.3382/ps/pex187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wu J., Gu X., Yang D., Xu S., Wang S., Chen X., Wang Z. Bioactive substances and potentiality of marine microalgae. Food Sci. Nutr. 2021;9:5279–5292. doi: 10.1002/fsn3.2471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wu Y.B., Li L., Wen Z.G., Yan H.J., Yang P.L., Tang J., Xie M., Hou S.S. Dual functions of eicosapentaenoic acid-rich microalgae: enrichment of yolk with n-3 polyunsaturated fatty acids and partial replacement for soybean meal in diet of laying hens. Poult. Sci. 2019;98:350–357. doi: 10.3382/ps/pey372. [DOI] [PubMed] [Google Scholar]
  64. Zaefarian F., Abdollahi M.R., Cowieson A., Ravindran V. Avian liver: the forgotten organ. Animals. 2019;9:63. doi: 10.3390/ani9020063. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES