Dietary rutin supplementation enhances growth performance, intestinal health, and cecal microbiota in broiler chickens

Abstract

This study evaluated the effects of rutin supplementation on the growth performance and gut health of broilers. A total of 270 one-day-old Arbor Acres broilers were raised in a 28-day feeding trial. The birds were randomly divided into three groups (6 replicates per treatment, 15 broilers per replicate): CON (basal diet); RUT500 (basal diet + 500 mg/kg rutin); RUT1000 (basal diet + 1000 mg/kg rutin). Compared to the CON group, dietary rutin supplementation significantly improved growth performance, villus height, serum sIgA levels, and catalase (CAT) activity. The RUT500 group showed a significant increase in spleen index (p < 0.05), while the RUT1000 group exhibited significantly higher bursa index, serum IgM levels, serum d-lactic acid (D-LA) levels, and total antioxidant capacity (T-AOC) (p < 0.05). In both RUT500 and RUT1000 groups, mRNA expression of IL-4, IL-6, INF-γ, TNF-α, NF-кB, BAX, Caspase-3, and TLR-4 was significantly downregulated (p < 0.05), whereas BCL-2 and Mucin-2 expression was upregulated (p < 0.05). At the protein level, TLR-4, Caspase-3, and BAX were significantly reduced (p < 0.05), while BCL-2 was increased in rutin-supplemented groups. The RUT1000 group also showed decreased NF-кB and TLR-4 protein expression (p < 0.05). Microbiota analysis revealed that the RUT500 and RUT1000 groups had significantly higher Chao1 and Simpson diversity indices (p < 0.05) compared to CON. Beta diversity differed significantly between CON and RUT1000 (p < 0.05). Rutin supplementation reduced the abundance of Proteobacteria and Erysipelotrichaceae (p < 0.05), while the RUT500 group showed increased Bacteroidaceae and Ruminococcaceae_Ruminococcus compared to CON group.

In conclusion, dietary rutin enhanced growth performance and gut health in broilers.

Introduction

With growing concerns about food safety, plant extracts and their bioactive compounds (e.g., flavonoids) have gained significant attention as antibiotic alternatives. These natural substances represent a new trend in growth promoters and meat quality enhancers due to their broad applicability and absence of toxic residues in animal products (Long et al., 2020). Rutin, a flavonoid plant extract, is widely present in various foods and medicinal plants as yellowish or light green needle-like crystals or powder. It exhibits diverse pharmacological properties, including antioxidant (Boyle et al., 2000), anti-inflammatory (Yoo et al., 2014), anticancer (Alonso-Castro et al., 2013), and immune-enhancing effects. Additionally, rutin demonstrates potential mucosal protective and anti-ulcer properties (Olaleye and Akinmoladun., 2013). Gautam et al. (Gautam et al., 2016) reported that rutin possesses strong reactive oxygen species (ROS) scavenging activity. Studies have also shown that rutin protects pancreatic islets, the liver, kidneys, testes, brain, and other tissues from free radical damage (Hosseinzadeh and Nassiri-Asl, 2014), mitigating oxidative stress and thereby enhancing overall antioxidant function and immune response (Caglayan et al., 2019). As an inexpensive, natural plant extract with multiple biological functions, rutin holds promise as an efficient, green feed additive for broilers. The intestinal tract is not only the primary site for nutrient digestion and absorption but also a major secretory and immune organ in animals (Chamorro et al., 2019). The addition of feed additives to diets to enhance intestinal functions—such as gut morphology, barrier integrity, immunity, and antioxidant capacity—is a simple yet effective strategy to maintain health and promote growth in broilers (Wang et al., 2021; Yang et al., 2023).

It was hypothesized that dietary supplementation with rutin could improve intestinal function, thereby enhancing broiler growth performance. However, few studies have explored the application of rutin in broilers, and the mechanisms underlying its effects on growth performance and intestinal function remain unclear.

Therefore, the primary objective of the current study was to investigate the effects of rutin as a feed additive on the growth performance and its potential preventive and protective roles in ileal mucosa, including antioxidant and anti-inflammatory activity, immune modulation, cell proliferation and apoptosis regulation, and gut microbiota composition of broilers.

Materials and methods

Animal care, diets and experimental design

Rutin (95 % purity) was purchased from Nanjing Jingzhu Biotechnology Co Ltd (Nanjing, China). A total of 300 one-day-old male Arbor Acres broilers were obtained from a local hatchery and randomly allocated into three dietary treatment groups: CON (basal diet); RUT500 (basal diet+500 mg/ Kg rutin) and RUT1000 (basal diet+1000 mg/ Kg rutin). (10 replicate cages of 10 birds each). The doses were based on prior poultry studies (Chen et al., 2022; Zhang et al., 2025). Each group consisted of 10 replicate cages with 10 birds per cage. After a 7-day pre-feeding period, rutin supplementation began on day 7 and continued for 21 consecutive days at concentrations of 0, 500, or 1000 mg/kg.

All broilers were housed in wire cages (10 birds per cage) under controlled environmental conditions. The temperature was maintained at 34 ± 1 °C for the first 3 days and then gradually reduced by 2–3 °C per week. Relative humidity was kept at 45–55 %. All broilers were kept in wire cages (10 broilers per cage). Birds were fed a starter diet (days 1–21) followed by a grower diet (days 22–28), both formulated to meet or exceed the nutrient requirements of the National Research Council (Council, 1994).The ingredients and nutritional composition of the basal diets are provided (Table 1). All the feed were fed daily and mixed with rutin daily. To ensure the products could mixed well into the diets, the rutin was first mixed with 1 kg feed by hand mix, and then this premix feed was mixed properly with the remaining feed by using a mixer according to the manufacturer’s protocol. Throughout the trial, broilers had ad libitum access to feed (in mash form) and clean water. The lighting schedule was as follows: 24 h light (L) : 0 h dark (D) (days 1–3), 21 h L : 3 h D (days 4–21), 18 h L : 6 h D (days 22–28).

Table 1.

Ingredient and nutrient levels of the basal diets(fed basis).

Items	2-3 weeks	4week
Ingredients (%)
Corn	58.5	61.15
Soybean meal	30.0	26.3
Corn peotein meal	4.06	4.33
Soybean oil	2.70	3.80
Limestone	1.33	1.26
Calcium phosphate	1.60	1.52
L-Lysine, 99 %	0.20	0.14
DL-Methionine, 98 %	0.21	0.10
Sodium chloride	0.30	0.30
Chlorocholine chloride	0.10	0.10
Premix	1.00	1.00
Nutrient levels%
Metabolizable energy (MJ/kg)	12.54	12.96
Crude protein(%)	21.50	20.09
Calcium(%)	1.06	0.91
Total phosphorus (%)	0.73	0.69
Available phosphorus(%)	0.45	0.43
Lysine(%)	1.15	1.01
Methionine(%)	0.55	0.43
Methionine + Cysteine(%)	0.91	0.77
Threonine(%)	0.80	0.73

¹The premix provides, per kg of feed: Vitamin A, 12,000-IU; cholecalciferol, 2,500-IU; Vitamin E, 20-IU; Vitamin K3, 1.3 mg; Thiamine, 2.2 mg; Riboflavin, 8.0 mg; Niacinamide, 40 mg; Calcium Pantothenate, 10 mg; Shampoo Dox, 4 mg; Biotin, 0.04 mg; Folic Acid, 1 mg; Vitamin B12, 0.013 mg;.

²The mineral premix provides the following quantities per kilogram of diet: Iron (from Ferrous Sulfate), 80 mg; Copper (from Copper Sulfate), 8.0 mg; Copper (from Ferrous Sulfate), 8.0 mg; and Folate (from Ferrous Sulfate), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8.0 mg; Mn (from sulfuric acid), 110 mg; Zn (from zinc sulfate), 60 mg; (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg.

³The nutrient levels are calculated value.

Growth performance measurements

At the beginning and end of the experiment, broilers were fasted and weighed by replicate cage. Daily feed intake and health status were recorded throughout the trial period. The average daily gain (ADG), average feed intake (ADFI) and feed-to-weight ratio (F/G) of broilers from 1 to 28 were calculated.

Sample collection

On day 28, one broiler per replicate was randomly selected after a 12-hour fasting period and humanely euthanized. Blood samples were collected, centrifuged at 3,000 × g for 15 min, and the resulting serum was stored at −20 °C for subsequent analysis. The middle jejunal segments were excised and fixed in 4 % paraformaldehyde solution for ileal morphology and goblet cell quantification. Ileal intestinal mucosa was collected and stored in liquid nitrogen rapid freezing at −80 °C. The bursa of Fabricius, thymus, and spleen were dissected and weighed to calculate immune organ indices using the formula: Immune organ index (g/kg) = organ weight (g) / body weight (kg).

Histopathological analysis of ileal tissue

Hematoxylin and eosin (H&E) staining was performed to assess in testinal morphology following previously established protocols (Chen et al., 2023). The paraformaldehyde-fixed jejunal segments were processed by paraffin embedding and sectioned into 5-μm slices (corrected from "mm" to standard histological unit). Tissue sections were mounted on glass slides and stained with hematoxylin and eosin (H&E) for morphological examination. In each section, villus height (VH, the distance from the tip of the villus to the crypt opening), villus width (VW), and crypt depth (CD, the distance from the crypt opening to the bottom) were measured using a computer-assisted light microscope (Nikon, Japan) and Image-Pro Plus 6.0 software (Media Cybernetics, USA). The mean values of each cross-section were used for statistical analysis. The ratio of villus height to crypt depth (VH:CD) was calculated.

PAS stain

Sections were deparaffinized to water, washed with water, cleared overnight with periodate for 10 min, rinsed with tap water for 10 min, rinsed with Schiff's solution for 10 min, rinsed with running water for 5 min, hematoxylin for 3 min (the nuclei of the cells stained too deeply could be differentiated with hydrochloric acid and alcohol), and rinsed with running water for 5 min, and then routinely dehydrated, clarified, and blocked.

Indices measured by enzyme-linked immunoassay (ELISA)

Immunoglobulin A (IgA, HB 174-Ch), G (IgG, HB 107-Ch), Immunoglobulin M (IgM, HB 102-Ch), d-lactate (D-LA, HB 378-Ch) and diamine oxidase (DAO, HB178X-Ch). The corresponding kit provided by Shanghai Hengyuan Biotechnology Co., Ltd. (Shanghai, China) were tested by ELISA.

Antiantioxidant index of ileum

The antioxidant parameters of the ileum mucosa, including malondialdehyde (MDA, Catalogue no. A003-1-2) concentration, and total superoxide dismutase (TSOD, Catalogue no. A001-1-2a), glutathione peroxidase(GSH-Px, Catalogue no. A005-1-2), catalase (CAT, Catalogue no. A007-2-1) and total antioxidant capacity (T-AOC, Catalogue no. A015-2-1) activities were measured by the corresponding kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). To allow for inter-sample comparison, the acquired data were normalised against the total protein content in each sample.

RNA extraction and quantitative real-time PCR analysis

The total RNA was extracted to analyse the relative mRNA expression in ileum mucosa according to the previous methods (Liu et al., 2022). The primer sequences for immunity (the nuclear factor kappa-B (NF-кB), myeloid differentiation primary response 88 (MyD88), interleukin-2 (IL-2), tumour necrosis factor-a(TNF-a) and interferon-γ (INF-γ)), intestinal barrier(Mucin2 (MUC2), occludin (OCLN), zonula occludens-1 (ZO-1)), and cell proliferation andapoptosis (B-cell lymphoma 2 (Bcl-2), Bcl-2 associated X (BAX), Ki67, and Caspase3) were synthesised by Sangon Biotech Co., Ltd. (Shanghai, China) and are listed (Table 2).

Table 2.

Sequences, product sizes, and TM values of primers for target genes.

Transcript	Accession number		Gene sequence (5′–3′)	Product length (bp)
NFKB	XM_046915553.1	Forwad	ATAAGACGCACCACACTGAGATCC	195
		Reverse	ATAAGACGCACCACACTGAGATCC
MYD88	NM_001030962.5	Forwad	CCGTGGGTCAACTGCTGGAG	115
		Reverse	TCCTGCTGCTTCCTTCGTAAGTAC
TLR4	NM_001030693.2	Forward	TCACCGCTTTCACTTCCCTTCC	188
		Reverse	CAGCAGCACCCCAAGAGTCAG
INF-γ	FJ538012.1	Forwad	CGGAATTCATGACTTGCCAGACTTAC	182
		Reverse	GCGTCGACATTAGCAATTGCATCTCCTCTG
TNF-α	XM_046900549.1	Forwad	TTCGGGAGTGGGCTTTAAGAAGAC	196
		Reverse	AGGTTGTGGGACAGGGTAGGG
IL-2	NM_204153	Forwad	TTGGCTGTATTTCGGTAGCAATGC	802
		Reverse	CCTGGGTCTCAGTTGGTGTGTAG
IL-4	XM_046900385.1	Forwad	CCTGGGATACGGAGAAACGAAGAAG	80
		Reverse	GATAACAGTGGTAGGAGGCAGATGG
IL-6	NM_204628.2	Forwad	TCGTTTATGGAGAAGACCGTGAGG	108
		Reverse	GTGGCAGATTGGTAACAGAGGATTG
IL-10	NM_001004414.4	Forwad	CAGACCAGCACCAGCCATCAG	153
		Reverse	ATCCATCTTCTCGAACGTCTCCTTG
BAX	XM_040662228.2	Forwad	GGAGTGAGTGCTGCGAAGAGAC	89
		Reverse	GTTGCTGCCGTAGTTGAAGTCATC
BCL-2	XM_046931463.1	Forwad	TTGACCCCATCACGGA	1035
		Reverse	TGGAGAGCGTGGACAAGGAG
Caspase-3	XM_046915477.1	Forwad	GAACTTCCACCGAGATACC	374
		Reverse	GTCCACTGTCTGCTTCAAT
MUC-2	XM_040673077.2	Forwad	TTACCACCATAGTTACCACAA	76
		Reverse	CACTCAGACCAATCACAGA
Z0-1	XM_046925214.1	Forwad	ATGAATGAAGGATGGTATGG	191
		Reverse	GATGTATGTCTGCTGTCTG
Occludin	XM_046904540.1	Forwad	TCATCGCCTCCATCGTCTAC	240
		Reverse	TCTTACTGCGCGTCTTCTGG
Claudio-1	NM_001013611.2	Forwad	AACGGCTAGCAAACTCCCAA	106
		Reverse	CAATGCAGCAGCCCTAGAGA
NOTCH1	XM_046928732.1	Forwad	GGACGGAGGTGTGCCAGTG	134
		Reverse	TGTGTAGTCGGCGGTGCTG
JAG1	XM_046915030.1	Forwad	AGCCATACACACACAGCA	180
		Reverse	GTCATCTTCCTCCACCTCT
HES-1	XM_040679737.2	Forwad	CTGCTGGATGCAACGCTAGT	1073
		Reverse	CGTCACCTCGTTCATGCACT
β-actin	NM_205518.2	Forwad	CTGTGCCCATCTATGAAGGCTA	139
		Reverse	ATTTCTCTCTCGGCTGTGGTG

TM,Melting Temperature; NFKB, Nuclear Factor Kappa-light-chain-enhancer of Activated B Cells; MYD88, Myeloid Differentiation Primary Response Gene 88; TLR4, Toll-like Receptor 4; INF-γ, Interferon-γ; TNF-α, Tumor Necrosis Factor-α; IL-2, Interleukin-2; IL-4, Interleukin-4; IL-6, Interleukin-6; IL-10, Interleukin-10; BAX, BCL2-Associated X Protein; BCL-2, B-Cell Lymphoma 2; Caspase-3, Cysteine Aspartate Protease-3; MUC-2, Mucin 2; ZO-1,Zonula Occludens-1; Notch1, Notch Homolog 1; Jagged-1, Jagged Canonical Notch Ligand 1; Hes-1, Hairy and Enhancer of Split-1.

Western blotting

According to previous procedures (Han et al., 2020), a western blot analysis of the Ileal muscle was performed. Ileal muscle tissue was homogenized in ice-cold RIPA buffer supplemented with 1 mM PMSF (Beyotime, Shanghai, China). Total protein concentration was quantified using a bicinchoninic acid (BCA) assay kit (Nanjing Jiancheng Bioengineering Institute, China). Proteins were resolved by SDS-PAGE using 10 % or 12 % polyacrylamide gels (selected based on target molecular weights) and subsequently transferred to PVDF membranes (Beyotime) using a semi-dry transfer system. The PVDF membrane was washed 3 times for 10 min each time in 1 × PBST and then blocked 2 h in 5 % skim milk. The PVDF membrane was washed 3 times again, and incubated withβ-ACTIN, nfkb and TLR-4 (Beyotime Biotechnology, Shanghai, China) primary antibodies for 8–12 h at 4 °C, respectively. Next day, the PVDF membrane was washed 3 times again, and incubated with corresponding horseradish peroxidase labeled antibody at 37 °C for 1 h, then washed 3 times again. Target protein bands were detected and visualized under the action of the enhanced fluorescence detection kit BeyoECL Star (Beyotime Biotechnology, Shanghai, China). Images of blots were recorded and analyzed by the Essential V6 imaging platform (UVITEC, Cambridge, England). β-ACTIN protein served as an internal control protein. All the results of experiment were repeated in triplicate. The relative expressions of target proteins were expressed as the ratio of band intensities of proteins to β-ACTIN.

16S DNA sequencing of the gut microbiome

The extraction of DNA from cecal contents and 16S rRNA gene sequencing was performed as described previously (Ren et al., 2021). Cecal content samples from chicks were immediately flash-frozen on dry ice and transported to Paysono Gene Cloud (or: Paysono Gene Cloud Platform) for 16S rDNA amplification using domain-specific primers. To ensure data reliability, all samples underwent technical replicates during processing. The specific process includes (1) Sorting data filtered to get raw clean data (clean data). (2) PE sequences were spliced according to the overlap degree, and 16 SrDNA sequences of high quality were obtained by quality control filtering and elimination of redundant chimeras; (3) OTU clustering; (4) PCA analysis and heatmap analysis; (5) Alpha Diversity Index analysis; and (6) comparison of species differences between samples based on the sample colony abundance data using the Mann-Wallis test.

Statistical Analysis

Data were subjected to analysis as a completely randomized design by using the GLM procedure of SAS (SAS Institute Inc., Cary, NC, USA). Each cage was considered as the experimental unit. Differences between treatments were detected by Duncan’s multiple range tests. The data were presented as the pooled standard error of means. The p < 0.05 was considered as significant.

Results

Effect of dietary rutin on growth performance of broilers

As shown in Table 3, addition 500 and 1000 mg/kg rutin significantly increased body weight on day 28 compared to control group (p < 0.05). Whereas, the ADFI in RUT1000 group was decreased compared to control group (p < 0.05). Throughout the experimental period, 1000 mg/kg rutin significantly (p < 0.05) decreased F/G in broilers.

Table 3.

Effects of dietary rutin on growth performance of broilers.

	CON	RUT500	RUT1000
IBW	40.33 ± 1.23	40.84 ± 1.26	39.67 ± 0.43
FBW	826.26 ± 7.74b	839.85 ± 11.98a	844.70 ± 6.77a
ADG	28.07 ± 0.30	28.54 ± 0.43	28.75 ± 0.25
ADFI	41.05 ± 0.61a	40.57 ± 0.62a	36.29 ± 0.51b
F/G	1.46 ± 0.03a	1.42 ± 0.01a	1.26 ± 0.01b

^a,b,cThe values are expressed as mean ± SEM (n = 10). Labeled (a, b and c, a > b > c) means in a row without a common letter differ; p < 0.05.

CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basal diet+1000 mg/ Kg rutin; IBW, Initial Body Weight; FBW, Final Body Weight; ADG, Average Daily Gain; ADFI, Average Daily Feed Intake; F/G, Feed to Gain Ratio / Feed Conversion Ratio (FCR).

Effect of dietary rutin on immune organ index and immunoglobulin in broilers

As shown (Table 4), RUT500 group significantly increased the spleen index of broilers compared to CON group (p < 0.05). The bursa index in RUT1000 group was significantly increased compared with CON group of broilers (p < 0.05). The serum sIgA levels in both RUT500 and RUT1000 groups were significantly increased compared with the CON group (p < 0.05). The RUT1000 group significantly increased the serum IgM levels compared with the control group (p < 0.05). And the serum IgG levels in RUT500 and RUT1000 groups significantly lower compared with the control group (p < 0.05).

Table 4.

Effect of dietary rutin on immune organ index and immunoglobulin in broilers.

Items	CON	RUT500	RUT1000
Thymus index	3.58 ± 0.10	3.77 ± 0.10	3.81 ± 0.03
The spleen index	0.77 ± 0.12b	1.30 ± 0.14a	1.05 ± 0.11ab
Falkstone sac index	0.91 ± 0.18b	1.16 ± 0.11b	2.02 ± 0.09a
slgA (μg/ml)	1247.64 ± 37.42b	1454.33 ± 36.04a	1497.88 ± 24.17a
IgM(μg/ml)	3075.49 ± 250.56b	3616.30 ± 192.09b	4337.05 ± 156.73a
IgG(μg/ml)	97.72 ± 1.52a	89.23 ± 1.69b	78.20 ± 0.72c

^a,b,cThe values are expressed as mean ± SEM (n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05.

CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; sIgA, Secretory Immunoglobulin A; IgM, Immunoglobulin M; IgG, Immunoglobulin G.

Effect of dietary rutin on intestinal tissue morphology and intestinal permeability of broilers

As shown (Table 5, Fig. 1), the villus height in the RUT500 and RUT1000 groups were higher compare to the CON group (p < 0.05), and the villus-crypt ratio of the ileum in the RUT1000 group was higher compared with the CON group (p < 0.05). There was no significant difference in the crypt depth among all treatment groups (p > 0.05). It can be concluded that the serum d-lactic acid (D-LA) levels were higher (p < 0.05) in the RUT1000 group, whereas there was no significant difference in the serum d-LA levels between the RUT500 group and the CON group (Fig. 2) (p > 0.05). There was no significant difference in the DAO levels among all treatment groups (p > 0.05).

Table 5.

Effect of rutin on intestinal tissue morphology of broiler chicks.

Items	CON	RUT500	RUT1000
Villus heights (μm)	706.87 13.22c	781.57 17.72b	869.17 17.72a
Crypt depth (μm)	175.68 10.81	183.22 7.49	160.38 13.12
V/C (μm)	4.08 0.32b	4.31 0.37ab	5.56 0.56a

^a,b,cThe values are expressed as mean ± SEM(n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05.

CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; V/C, Villus Height/Crypt Depth Ratio.

Fig. 1.

Effect of rutin on the ileum morphology of broiler chickens. Representative sample of a hematoxylin-eosin-stained ileal section (magnification of 100; scale bar, 200 μ m). CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin.

Fig. 2.

Effect of rutin on the intestinal permeability of broiler chicks. ^a,b,c The values are expressed as mean ± SEM (n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05. CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; DAO, Diamine Oxidase; d-LA, d-Lactate.

Effect of rutin on the antioxidant indexes of the ileum mucosa of broilers

As shown (Table 6), there was a dose-dependent improvement (p < 0.05) in T-AOC content compared to the CON group. The CAT content was higher in RUT500 and RUT1000 groups compared to CON group (p < 0.05). There was no significant difference in the MDA and T-SOD content among all treatment groups (p > 0.05).

Table 6.

Effect of rutin on the antioxidant indexes of the ileum mucosa of broiler chicks.

Items	CON	RUT500	RUT1000
T-AOC	3.82 0.15c	4.50 0.12b	5.47 0.13a
CAT(U/mg prot)	28.64 2.41b	34.81 0.60a	34.97 0.71a
MDA (nmol/mg prot)	1.62 0.01	1.36 0.31	1.23 0.06
T-SOD(U)	56.58 0.21	59.49 0.01	60.58 0.21

^a,b,cThe values are expressed as mean ± SEM(n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05.

CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; T-AOC, Total Antioxidant Capacity; CAT, Catalase; MDA, Malondialdehyde; T-SOD, Total Superoxide Dismutase.

Effect of rutin on mRNA gene expression in goblet cells and Mucin-2 in broilers

As shown (Fig. 3), the number of ileal cupped cells was dose-dependently elevated in the RUT500 and RUT1000 groups compared to the CON group, but a significant difference was not observed. However, the relative expression of Mucin-2 mRNA expressions in the ileal mucosa was significantly increased in the RUT500 and RUT1000 groups compared with the CON group (p < 0.05).

Fig. 3.

A Effect of dietary rutin addition on ileal cupped cells of broilers, (PAS, 200 μm) B Effect of dietary rutin addition on the number of ileal cupped cells and the mRNA expression level of Mucin-2 in broilers. ^a,b,c The values are expressed as mean ± SEM(n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05. CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin;MUC-2, Mucin 2.

Effect of dietary rutin on mucosal tight junction proteins and Notch1 / Jagged1 / Hes-1 signaling pathway in the ileum of broilers

As shown (Fig. 4A), mRNA expression of ZO-1 was significantly elevated in the RUT1000 group compared to the CON group, the occludin mRNA expression was higher in the RUT500 and RUT1000 groups compared to the CON group, and the claudio-1 mRNA expression was higher in the RUT500 group compared to the CON group. As shown (Fig. 4C), the protein expression of ZO-1 and claudio-1 was significantly increased in the RUT500 and RUT1000 groups compared to the CON group. As shown (Fig. 4B,D), the mRNA expression of Jagged1 and caspase-3 was lower in the RUT500 and RUT1000 groups, and the protein expression of Notch-1 and Jagged1 was lower in the RUT500 and RUT1000 groups compared with the CON group.

Fig. 4.

A Effect of dietary rutin on mRNA expression of genes related to ileal mucosal tight junction proteins. b Effect of dietary rutin on mRNA expression of genes related to Notch1/ Jagged1/Hes-1 signaling pathway in ileal mucosa. c Effect of dietary rutin on protein expression of ileal mucosal tight junction proteins. Effect of dietary rutin on protein expression of Notch1/ Jagged1/Hes-1 signaling pathway in ileal mucosa. ^a,b,c The values are expressed as mean ± SEM(n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05. CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; ZO-1, Zonula Occludens-1; Notch-1, Notch Homolog 1; Jagged1, Jagged Canonical Notch Ligand 1; Hes-1, Hairy and Enhancer of Split-1.

Effect of dietary rutin on ileal inflammatory factors and TLR 4 / NF- к B signaling in broiler chickens

As shown (Fig. 5A), the mRNA expression of IL-4, IL-6,INF-γ and TNF-α was lower (p < 0.05) in RUT500 and RUT1000 groups compared to the CON group. As shown (Fig. 5B), the mRNA expression of TLR-4 was significantly reduced in RUT500 group compared with CON group (p < 0.05), and the mRNA expression of NF-кB was significantly reduced in RUT500 and RUT1000 groups compared with CON group (p < 0.05). There was no significant difference in the MYD88 mRNA expressions among all treatment groups(p > 0.05). As shown (Fig. 5C), the protein expression of NF-кB and TLR-4 in RUT500 and RUT1000 groups was significantly (p < 0.05) and dose-dependently (p < 0.05) decreased compared with the CON group.

Fig. 5.

A Effect of dietary rutin on mRNA expression of genes related to inflammatory factors in the ileal mucosa. B Effect of dietary rutin on mRNA expression of genes related to the TLR4/NF-кB signaling pathway in the ileal mucosa. C Effect of dietary rutin on protein expression of the TLR4/NF-кB signaling pathway in the ileal mucosa. ^a,b,c The values are expressed as mean ± SEM(n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05. CON,basal diet; RUT500,basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; IL-4, Interleukin-4; IL-6, Interleukin-6; INF-γ, Interferon-γ; TNF-α, Tumor Necrosis Factor-α; NF-κB, Nuclear Factor Kappa-light-chain-enhancer of Activated B Cells; TLR-4, Toll-like Receptor 4; MYD88, Myeloid Differentiation Primary Response Gene 88.

Effect of dietary rutin on mRNA expression of genes involved in proliferation and apoptosis in ileal mucosa

As shown (Fig. 6A), the mRNA expression of BAX and Caspase-3 was lower (p < 0.05) and the mRNA expression of BCL-2 was higher (p < 0.05) in the RUT500 and RUT1000 groups compared to the CON group. As shown in Fig. 6B, the protein expression of BAX and Caspase-3 was lower (p < 0.05) and the protein expression of BCL-2 was higher in the RUT500 and RUT1000 groups compared to the CON group.

Fig. 6.

A Effect of dietary rutin on mRNA expression of genes involved in proliferation and apoptosis in ileal mucosa. B Effect of dietary rutin on the protein expression of genes involved in proliferation and apoptosis in the ileal mucosa. ^{a, b, c} The values are expressed as mean ± SEM (n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05. CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; BAX,BCL2-Associated X Protein; BCL-2,B-Cell Lymphoma 2; Caspase-3, Cysteine Aspartate Protease-3.

Effect of rutin on the cecal microbiota of broiler chickens

As shown (Fig. 7A), the Chao1 index was higher (p < 0.05) in the RUT500 and RUT1000 groups compared to the CON group, and there was a tendency for observed species to characterize richness in the RUT1000 group. The Simpson's index characterizing diversity was higher in the RUT500 and RUT1000 groups compared to the control group (p < 0.05). Fig. 7B can be analyzed by Principal coordinate analysis (PCoA), there is a significant difference in beta diversity compared to the control group RUT1000 group (p < 0.05). (Fig. 8)

Fig. 7.

A Comparison of OTUs and Shannon, simpnon and Chao1 indexes of the cecum microbiota of broiler chicks. B Principal coordinate analysis (PCoA) plot of the microbial composition curve. ^{a, b, c} The values are expressed as mean ± SEM(n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05. CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin; PCoA, Principal coordinate analysis.

Fig. 8.

Broiler cecum contents flora composition (phylum level). CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin.

As shown (Table 7), the abundance of Proteobacteria was lower (p < 0.05) and Erysipelotrichaceae was lower (p < 0.05) in the RUT500 and RUT1000 groups compared to the CON group, and the abundance of Bacteroidaceae and the Ruminococcaceae_Ruminococcus abundance was higher in the RUT500 group (p < 0.05) compared with the CON group.

Table 7.

Effect of rutin on the relative abundance of the microbiota of the cecal contents in broiler chicks.

Items	CON	RUT500	RUT1000
phylum
Proteobacteria	3.1822 ± 0.5462a	1.2550 0.04000b	1.1088 0.1136b
family
Bacteroidaceae	21.3441 3.6920b	42.1403 1.3364a	17.2887 8.3389b
Erysipelotrichaceae	2.7076 0.4702a	0.6990 0.1265b	1.4441 0.2262b
genus
Ruminococcaceae_Ruminococcus	0.0084 0.0016b	0.0218 0.0027a	0.0274 0.0037b

^a,b,cThe values are expressed as mean ± SEM (n = 10). Labeled (a, b, c, a > b > c) means in a row without a common letter differ; p < 0.05.

CON, basal diet; RUT500, basal diet+500 mg/ Kg rutin; RUT1000, basaldiet+1000 mg/ Kg rutin.

Discussion

In the present study, the supplementation of rutin showed a positive influence on growth performance in broilers. Consistent with previous research results, plant extracts were shown to promote the growth performance of broilers (Guo et al., 2004). Additionally, the inclusion of rutin at doses of 500 and 1000 mg/kg in the diet has been confirmed in previous studies to have positive effects on growth performance, intestinal health, immunity, and antioxidant capacity in broilers(Chen et al., 2022; Hafez et al., 2025; Ma et al., 2025; Zhang et al., 2025). However, the mechanism by which rutin improves broiler growth performance remains poorly understood. In addition, by 28 days of age, the intestinal morphology and function of broilers mature rapidly, the immune system reaches its developmental peak, and the intestinal microflora gradually stabilizes. Studies have shown that the rapid development of digestive organs (proventriculus, gizzard, pancreas) and intestinal length in AA broilers mainly occurs before 28 days of age, and the growth of the digestive tract tends to stabilize thereafter. The immune system of broilers also undergoes a critical stage of development and maturation around 28 days of age, accompanied by significant changes in T lymphocyte subsets and immunoglobulin levels. Therefore, selecting 28 days as the experimental endpoint allows for a comprehensive evaluation of the effects of rutin on the early rapid growth and development of broilers, the maturation of intestinal function, as well as its immunomodulatory effect(Adeleye et al., 2020; Juanchich et al., 2021). Therefore, this experimental period allows clear observation of the effects of rutin on intestinal morphology, immune regulation, and the modulation of gut microbial community structure. Therefore, this study investigated the preventive and protective effects of rutin on broiler ileum mucosa, focusing on its antioxidant, anti-inflammatory, immunomodulatory, and gut microbiota-modulating properties, as well as its role in regulating cell proliferation and apoptosis. These findings may help elucidate the potential mechanisms by which rutin improves broiler growth performance. The current study highlights the contributory roles of the Notch1/Jagged1/Hes-1 signaling pathway in goblet cells and Mucin-2 in relation to these parameters in the experimental groups. Additionally, the villus height-to-crypt depth (VH/CD) ratio, a key indicator of small intestinal absorption and mechanical barrier function, was assessed (Touchette et al., 2002). In our findings, Rutin significantly increased the duodenal VH/CD ratio, and improved intestinal villous morphology in the treatment groups compared with the control. Specifically, the RUT1000 group exhibited a more pronounced improving effect on intestinal villus height and the villus height/crypt depth (VH/CD) ratio in the jejunum compared with the RUT500 group. Previous studies have shown that the number of mature intestinal epithelial cells increases with the increase in VH/CD ratio in the small intestine. Besides facilitating the absorption of intestine nutrients, such mature cells help to secrete more mucin to resist the invasion of pathogenic microorganisms, therefore, important in mediating gut microbes and immune balance (Johnson-Henry et al., 2004). Cup cells are a type of specialized mucus-secreting cell characterized by abundant mucin-rich granules. These intracellular granules fuse together and undergo exocytosis, releasing their contents which then combine with water to form mucus. This mucus adheres to the intestinal mucosal surface, providing lubrication and protection. As an essential component of the intestinal mechanical barrier, cup cells also contribute to mucosal immunity in chicks. Therefore, cup cells are closely related to the intestinal health of chicks. The present study demonstrated that dietary Rutin significantly increased the number of ileal mucosal cup cells and MUC-2 expression in a dose-dependent manner. This means that the addition of rutin strengthens the chemical barrier in the broiler's gut. The Notch signaling pathway regulates intestinal epithelial cell fate determination by activating its downstream target Hes-1, which suppresses Hath1 expression and drives differentiation toward the absorptive lineage. Conversely, Notch inhibition reduces Hes-1-mediated repression of Hath1, promoting secretory lineage differentiation(Jensen et al., 2000; Yang et al., 2001). Genetic silencing of Notch1/Notch2 impairs stem cell proliferation and differentiation while increasing cup cell numbers in intestinal villi (van Es et al., 2005). From this study, it can be concluded that rutin inhibits the expression of the Notch-1 signaling pathway, which leads to an increase in the number of cup cells and ultimately an increase in mucin secretion. High-dose rutin provides fermentable substrates for lactic acid-producing bacteria in the hindgut, thereby increasing the microbial source of d-lactic acid. Meanwhile, high-dose rutin may cause certain physiological fluctuations in the intestinal epithelium, resulting in a slight increase in intestinal permeability, but without inducing pathological damage, This phenomenon has also been observed in previous studies(Juanchich et al., 2021). In response to this change, the body activates a compensatory repair mechanism (upregulation of tight junction protein genes) and systemic immune defense (elevation of immunoglobulins), and this phenomenon has also been observed in other studies.

The activities of T-AOC, CAT, MDA, and T-SOD in the endogenous antioxidant enzyme system reflect the capacity for free radical scavenging in vivo. In the present study, administration of different doses of rutin resulted in a significant increase in the activities of T-AOC and CAT in the small intestine of broilers, thereby enhancing the antioxidant capacity of the small intestinal mucosa. Specifically, the RUT1000 group exhibited a stronger effect. The significant antioxidant capacity of rutin is attributed to its abundant constituents such as polyphenols and flavonoids, which have been shown to have favorable antioxidant capacity (Rusu et al., 2018; Liu et al., 2023b). Similarly, a study found that rutin significantly increased the enzymatic activities of SOD and MDA and possessed antioxidant properties that reduced oxidative stress (Liu et al., 2023a). Notably, although the RUT1000 supplementation enhanced indicators of antioxidant capacity and increased d-lactate levels, no adverse changes in intestinal barrier function markers were observed. Based on a comprehensive analysis of multiple parameters, we hypothesize that this elevation in d-lactate may be attributed to enhanced microbial fermentation activity in the intestine—specifically, an increased 'source' of d-lactate—rather than alterations in intestinal permeability. As a polyphenolic compound, rutin reaching the hindgut may be utilized by specific microbiota, thereby promoting the proliferation and metabolic activity of these bacterial populations and consequently resulting in enhanced d-lactate production(Mazzeo et al., 2015).

Previous studies have demonstrated that rutin exhibits protective effects against inflammation and oxidative stress while reducing TNF-α production (Wu et al., 2023). TNF-α is primarily characterized as a pro-inflammatory cytokine that plays a dual role in intestinal homeostasis - while essential for maintaining intestinal integrity, it also contributes significantly to the pathogenesis of intestinal inflammation (Lubberts and van den Berg, 2003).We found that rutin dose-dependently reduced TNF-α secretion levels in ileal mucosa. The phosphorylation of IκB and translocation of NF-κB into the nucleus occurs when NF-κB is activated by stimulators. Then NF-κB binds to DNA and promotes the transcription and translation of proinflammatory cytokines, leading to the production of proinflammatory cytokines (Hoesel and Schmid, 2013). The NF-κB transcription factor is a master regulator of inflammation and immune homeostasis, which can be rapidly activated by environmental stress. Activation of NF-κB increases the expression levels of pro-inflammatory cytokines such as TNF-α (Jin et al., 2021). The present study demonstrated that rutin improved anti-inflammatory ability and inhibited NF-κB signaling pathway in broilers.

The results show that dietary treatments had no effect on thymus, bursa or spleen indexes of broilers, which is consistent with the results of Yang et al. (Yang et al., 2019). However, serum IgA concentration linearly dose-dependently increased with the increasing rutin levels. The IgA, as one of the main immunoglobulins in serum, is an important indicator of humoral immunity (Li et al., 2020). These findings suggest that dietary rutin supplementation enhances humoral immunity in broilers without compromising immune organ development. Moreover, Yang et al. (Yang et al., 2020) found that dietary quercetin (0.02–0.06 %) improved the serum IgA concentration of broilers in a dose-dependent manner. The current results demonstrate that dietary supplementation with 500-1000 mg/kg rutin significantly reduced serum TNF-α levels and IL-2 mRNA expression. Furthermore, the 500 mg/kg dose specifically downregulated NF-κB and TNF-α mRNA expression in jejunal mucosa. TNF-α and IL-2 are cytokines that promote inflammation, which participate in the important inflammatory processes (Kammoun et al., 2014). NF-κB is a transcription factor that controls immunological response, especially for inflammation, by inducing the transcription and synthesis of pro-inflammatory factor TNF-α (Xu et al., 1998). It was reported that rutin showed strong anti-inflammatory effects on inhibiting the synthesis of NF-κB and reducing proinflammatory factors, such as TNF-a, and IL-6 content. Collectively, these findings suggest that rutin enhances immune function and attenuates inflammation in broilers, potentially through suppression of the NF-κB signaling pathway.

Alpha diversity: Chao1 and Observed species characterize richness, Shannon and Simpson indices characterize diversity, and Good's coverage index characterizes coverage. Beta diversity refers to the dissimilarity of species composition or the rate of species turnover along an environmental gradient between different communities that vary along the gradient, and is therefore also referred to as between-habitat diversity (BHD). Principal coordinate analysis (PCoA) enables dimensional reduction of microbial data, revealing major variation trends through sample ordination, while clustering analysis identifies discrete environmental subsets for data categorization. In the present study, it showed that addition of 1000 mg/Kg rutin ration significantly increased Chao1 and Observed species, indicating that rutin improves chick cecum representation richness, and similarly increased Simpson's index, indicating that rutin improves chick cecum representation diversity. The ultimate goal is to improve production and maintain the health and welfare of birds in the poultry industry. The intestinal tract contains a complex community of microorganisms (gut flora) that play an important role in digestion, absorption and metabolism in chicks (Rothe and, Blaut, 2013). The composition of intestinal flora in chicks may be influenced by breed, age, environment and diet, with diet being the most important factor influencing intestinal flora (Kers et al., 2018). The cecum bacterial zonation is complex and flexible, including the phylum Thick-walled Bacteria, Bacteroidetes, Actinobacteria, and Ascomycetes. The cecum is also a major site of microflora fermentation, with bacterial communities exceeding 1012 per gram of coeliac (Brisbin et al., 2008), affecting chick health and performance (Zhang et al., 2021). Flavonoids have a significant effect on intestinal flora. Flavonoids increased the beneficial flora community in yellow-feathered broilers (Xue et al., 2021). Addition of 500 mg/kg rutin to the ration promotes broiler growth by improving intestinal flora (Chen et al., 2022). This study showed that Bacteroidetes, Firmicutes and Actinobacteria domina ted in cecum of chick at the phylum level, however, were not affected by Rutin. The abundance of Proteobacteria was significantly lowerand Erysipelotrichaceae was significantly lower in the RUT500 and RUT1000 groups compared to the control group, and the abundance of Bacteroidaceae and Ruminococcaceae_Ruminococcus abundance was significantly higher in the RUT500 group. This agrees with previous study (Guo et al., 2018), the results indicate that rutin improves the microflora of the cecum in broilers.

Based on a comprehensive analysis of multiple indicators, rutin activates the Nrf2 pathway to enhance antioxidant capacity, thereby inhibiting the TLR4/NF-κB inflammatory pathway, and upregulates the expression of tight junction proteins and mucins to strengthen the intestinal barrier. Meanwhile, the alleviation of oxidative stress and inflammation improves the function of intestinal epithelial cells and enhances goblet cell activity, thus improving barrier integrity. The strengthened intestinal barrier and improved intestinal microenvironment promote the proliferation of beneficial bacteria and reduce pathogenic bacteria. Collectively, these changes induced by rutin contribute to improved intestinal health and enhanced nutrient absorption efficiency. This systematic and comprehensive mechanism reveals that rutin, as a botanical extract, can exert health-promoting effects in broilers through multiple regulatory pathways.

Based on a comprehensive analysis of all indicators in the present study, 1000 mg/kg rutin supplementation exhibited more balanced overall benefits. The inclusion of 1000 mg/kg rutin resulted in significant dose dependent improvements in key production related indicators, including growth performance (F/G, ADG), intestinal morphology (VH, V/C), antioxidant capacity (T AOC, CAT, T SOD), and mucosal immunity (sIgA). These indicators serve as the primary criteria for dose selection in practical production. Regarding the elevation in D lactic acid (D LA), its synchronous increase with the abundance of Ruminococcus (a lactic acid producing genus) and the continuous improvement in diamine oxidase (DAO) collectively indicate that this change mainly reflects enhanced microbial fermentation activity in the hindgut, rather than genuine impairment of intestinal barrier function. The shifts in microbial community structure should also be regarded as dynamic remodeling under high dose conditions, which correspond to the optimal improvement in growth performance. Therefore, 1000 mg/kg rutin represents the level with more balanced comprehensive benefits in commercial broiler production scenarios where maximized growth performance is pursued.

In this study, the improvement in growth performance at 1000 mg/kg rutin could be translated into economic benefits, but the incremental input should be balanced against production objectives. In terms of feasibility, rutin is a powdery solid that can be added via premixes and is compatible with existing feed processing techniques. It has good thermal stability and can withstand pelleting temperatures. As a natural flavonoid, rutin is safe, low-toxic and residue‑free, which is consistent with the policy of reducing and replacing antibiotics(Goyal and Verma, 2023). For practical application, 500 mg/kg is recommended for routine farming to fully activate the basic protective mechanisms, while 1000 mg/kg can be considered for maximizing growth performance, accompanied by intestinal health monitoring. Future research can explore the synergistic effects of rutin with probiotics and enzyme preparations.

Conclusion

In conclusion, rutin enhanced ileal mucosal antioxidant and anti-inflammatory capacity, suppressed the Notch1/Jagged1/Hes-1 and TLR4/NF-κB signaling pathways, and modulated cecal microbiota composition in broilers, ultimately improving growth performance. Furthermore, based on a comprehensive analysis, a dietary rutin supplementation level of 1000 mg/kg is more conducive to the healthy breeding of broilers.

Data availability

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Funding

This work was supported by the Heilongjiang Provincial Natural Science Foundation of China (LH2022C029).

Ethics approval

The study was conducted in accordance with the guidelines of the Declaration of Helsinki and approved by the Northeast Agricultural University Institutional Animal Care and Use Committee (Protocol number: NEAU [2011]−9), China.

CRediT authorship contribution statement

Xiao Liu: Writing – review & editing, Writing – original draft, Methodology, Formal analysis, Data curation, Conceptualization. Xinyan Li: Writing – review & editing, Validation, Formal analysis. Han Chen: Software, Data curation. Xinyu Wang: Software, Data curation. Peiyue Guan: Writing – review & editing, Data curation. Xingjun Feng: Writing – review & editing, Conceptualization.

Disclosures

We confirm that there are no conflicts of interest associated with this publication.