Normoxic stress enhance the secretion of adhesion-promoting membrane vesicles by Streptococcus mutans

Guxin Cui; Ye Tao; Yang Zhou; Yan Zhou; Huancai Lin

doi:10.1080/20002297.2026.2648321

. 2026 Apr 5;18(1):2648321. doi: 10.1080/20002297.2026.2648321

Normoxic stress enhance the secretion of adhesion-promoting membrane vesicles by Streptococcus mutans

Guxin Cui ^a,^b,¹, Ye Tao ^a,^b,¹, Yang Zhou ^a,^b, Yan Zhou ^a,^b,^*, Huancai Lin ^a,^b,^*

PMCID: PMC13055021 PMID: 41952811

ABSTRACT

Background

Streptococcus mutans (S. mutans) is the primary pathogen of dental caries and one of the pioneer colonizers of dental plaque biofilms. The normoxic stress experienced by S. mutans during initial adhesion is detrimental to biofilm formation. Membrane vesicles (MVs) can modulate the stress adaptability and biofilm formation of parental bacteria. However, it remains unclear whether normoxic stress influences the secretion, composition and function of MVs.

Materials and methods

We conducted characterization, omics analysis, and functional validation of MVs secreted by S. mutans under normoxic and hypoxic conditions. Furthermore, we performed a comparative analysis of protein expression profiles between MVs and their parental bacteria under normoxic stress.

Results

Compared with those of hypoxic MVs, the secretion of normoxic MVs is increased approximately 100-fold, and significantly enrich the adhesion proteins GtfC and SpaP. Normoxic MVs promote the initial adhesion and early biofilm formation of S. mutans through enhancing glucan synthesis, self-aggregation and the surface adhesion force. On the contrary, the magnitude of expression changes of GtfC and SpaP at the transcriptional and cellular levels under normoxic stress are modest.

Conclusion

Normoxic stress enhances the secretion of adhesion-promoting MVs by S. mutans. The cargo composition of S. mutans MVs may dynamically modulate in response to environmental stresses to facilitate their colonization.

KEYWORDS: Dental caries, Streptococcus mutans, membrane vesicles, normoxic stress, biofilm, GtfC, SpaP

Key messages

Successful adhesion under normoxic stress is a prerequisite for biofilm formation of S. mutans. MVs play a crucial role in regulating stress adaptation and biofilm formation in bacteria.
Normoxic stress enhances S. mutans MVs secretion and promotes initial adhesion as well as early biofilm formation of S. mutans.
Developing MV-targeted strategies to prevent the colonization of S. mutans, and the formation of cariogenic biofilms is promising.

Introduction

Dental caries is a chronic bacterial infectious disease caused by biofilms, affecting 80%–90% of the global population and imposing substantial strain on public health and economic resources [1,2]. Streptococcus mutans (S. mutans) is the primary cariogenic pathogen, exhibiting robust acidogenic and aciduric properties, along with the capacity to tolerate oxygen and form biofilms [3,4].

S. mutans biofilm formation is an organized and sequential process initiated by the adhesion of planktonic cells to tooth surfaces [5–8]. Following initial adhesion, bacteria undergo two developmental fates: progression to mature biofilms or reversion to the planktonic state [9]. Mature biofilms are highly resistant to removal, and embedded cells exhibit increased tolerance to environmental stress and antimicrobial interventions [5,10–12]. Therefore, the investigation of S. mutans initial adhesion is crucial for developing more effective strategies to prevent the formation of cariogenic biofilms.

Oxygen is a key environmental variable and regulatory factor in biofilm development, significantly influencing the physiological behavior of S. mutans [13,14]. As one of the early colonizers of dental plaque biofilms, S. mutans is exposed to oxygen concentrations approaching the atmospheric level –referred to as normoxic stress – during its initial adhesion to tooth surfaces [15–18]. S. mutans is a type of facultative anaerobe, and increased oxygen concentration will compromise its ability to form biofilms [13,19,20]. Under normoxic stress, S. mutans exhibits significant alterations in cell membrane composition and surface protein profiles, along with reduced tolerance to acid stress [13,14,20]. However, normoxic stress can enhance the adhesion of S. mutans to polystyrene surfaces, yet the underlying mechanisms remain poorly understood [14].

Surface proteins primarily mediate the initial adhesion of S. mutans to the acquired enamel pellicle (AEP) on tooth surfaces, including glucosyltransferases (Gtfs), glucan-binding proteins (GbPs) and SpaP (also known as Pac, Antigen I/II, P1 or MSL-1) [21–24]. S. mutans produces three types of Gtfs (GtfB, GtfC and GtfD), which are encoded by gtfB, gtfC and gtfD, respectively [25,26]. Depending on the presence or absence of sucrose, S. mutans utilizes two independent mechanisms for initial adhesion. In the sucrose-dependent pathway, GtfB and GtfC synthesize insoluble glucans with α-1,3 glycosidic linkages [25,26]. Insoluble glucans constitute the primary structure component of the biofilm matrix, providing favorable conditions for bacterial adhesion, microcolony formation and maintenance of mature biofilms [25–27]. GtfC is secreted mainly extracellularly and exhibits the highest affinity for salivary-coated hydroxyapatite, possessing more binding sites than either GtfB or GtfD [28]. The increased production and binding affinity to cell surfaces of GtfC under normoxic stress reflect its crucial role in initial adhesion [13]. In the sucrose-independent pathway, SpaP mainly mediates the adhesion of S. mutans to AEP by interacting specifically with salivary agglutinin (SAG) [29–31]. S. mutans mutants lacking SpaP exhibit a significantly impaired ability to adhere to SAG-coated surfaces [32]. SpaP also plays a critical role in both self-aggregation and interspecies coaggregation; for example, it mediates interspecies interactions between S. mutans and Candida albicans, as well as with Fusobacterium nucleatum [33,34]. Gtfs and SpaP, as crucial adhesins in their respective adhesion pathways, are recognized as key targets for inhibiting S. mutans colonization and biofilm formation [11,35–37].

Bacterial membrane vesicles (MVs) are nanoscale, bilayered membranous structures secreted by bacteria, encapsulating diverse bioactive molecules such as lipids, proteins, nucleic acids, and toxins; MVs play critical roles in intercellular communication, biofilm formation, pathogenicity and antimicrobial resistance [38–42]. MVs not only serve as the biofilm matrix but also play a critical role in modulating biofilm virulence properties [10,41,43,44]. S. mutans MVs were successfully isolated from culture supernatants and identified in 2014; they contain various virulence factors, such as Gtfs, SpaP and Gbps, which can promote biofilm formation by both parental bacteria and many other early colonizers [45–47]. We previously isolated MVs secreted by S. mutans under acidic stress conditions simulating mature biofilm conditions and found that the surface proteins GbpA, GbpD, GtfB, and GtfD were enriched, whereas GtfC was significantly reduced [48]. As another environmental stress during the initial adhesion of S. mutans, it remains unclear whether normoxic stress influences the secretion, composition, and function of MVs.

This study investigated the functional roles of normoxic MVs in initial adhesion and early biofilm formation based on their physical characteristics and molecular composition. These findings provide a theoretical foundation for understanding how S. mutans overcome environmental stresses to establish host colonization and offer insights into MV-targeted strategies for preventing the colonization of S. mutans and the formation of cariogenic biofilms.

Materials and methods

Bacterial strains and culture conditions

S. mutans UA159 (ATCC 700610) and S. mutans UA159 ΔgtfBC mutant [49] were revived in brain heart infusion (BHI; Difco, United States) medium at a 1:100 ratio under hypoxic conditions (5% CO₂) at 37 °C. For normoxic (21% O₂) growth, the cultures were grown in a 37 °C incubator with aeration. For hypoxic (5% CO₂) growth, the cultures were incubated in a smart microbial culture system (DW-100A-K; DW, China) at 37 °C.

Growth curves

The revived S. mutans were subcultured into fresh BHI at a ratio of 1:100 and grown in 96-well plates. S. mutans growth under normoxic or hypoxic conditions was monitored by measuring OD600 nm every hour for 24 h using a microbial growth curve analyzer (MGC-500; SCIENTZ, China).

CFU counts

Simultaneously with the initiation of MVs extraction, 1 mL of bacterial culture was collected from each of the two systems (normoxic and hypoxic) for CFU counts. Afterward, the cultures were subjected to serial 10-fold dilutions in sterile phosphate-buffered saline (PBS) to a final dilution of 10⁻⁶, and a 10 μL aliquot was inoculated onto the BHI agar plate, which was then cultured at 37 °C under hypoxic conditions for 24 h. Finally, distinguishable single colonies were selected for CFU counting.

Preparation of MVs

The preparation of S. mutans MVs was performed as previously described with a few modifications [45]. S. mutans strains were incubated in 400 mL of BHI medium at 37 °C overnight (approximately 12 h) under either normoxic or hypoxic conditions [50]. After centrifugation at 6,000 × g for 15 min at 4 °C, followed by 10,000 × g for 15 min at 4 °C, nearly all of the cells and large amounts of cellular debris in the culture supernatants were removed. The supernatants were filtered through 0.22-μm filters (Millipore, United States) and then concentrated using a 100 kDa Amicon ultrafiltration system (Millipore, United States) at 3,500 × g for 30 min at 4 °C. The concentrates were subjected to ultracentrifugation at 100,000 × g for 70 min at 4 °C, and the pellets were centrifuged once under the same circumstances after being rinsed with sterile PBS. Finally, the pellets were resuspended with 500 μL of sterile PBS for subsequent experiments. The MVs used in the biofilm assays were sterilized using 0.22-μm filters.

Characterized MVs

For morphology, 10 μL of freshly isolated MVs were loaded onto 400-mesh carbon-coated grids (ZJKY, China) for 15 min. Subsequently, the grids were stained with 3% phosphotungstic acid for 1 min and then rinsed once with dd H₂O for 10 s. Morphological images were captured by a transmission electron microscopy (TEM) (HT7800; HITACHI, Japan).

MVs size and particle concentration were measured using an NS300 instrument (Malvern Panalytical, UK) by nanoparticle tracking analysis (NTA). Three videos were recorded for each sample, each lasting 1 min. The NanoSight NTA (version 3.4) software was used to analyze the particle size and concentration. The Nano Flow Cytometer (N30E; Nano FCM, China) was also used to analyze the particle size and concentration.

MVs total protein concentration was estimated using a BCA Protein Assay Kit (CWBIO, China) following the manufacturer’s instructions.

Proteomics and metabolomics analyses

Detailed information regarding sample processing, mass spectrometry procedures and data analysis methodologies is provided in the supplementary materials.

For the proteomic analysis of MVs and S. mutans, data-independent acquisition (DIA) mode was employed for qualitative and quantitative protein analysis. Initially, the identified proteins were annotated in common functional databases, including the Gene Ontology (GO) database and Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Concurrently, quantitative and differential expression analyses were performed at the protein level, followed by GO and KEGG functional enrichment analyses of the differentially expressed proteins.

For the untargeted metabolomics analysis of MVs, XCMS software was used for peak picking and quality control, and metaX was used for metabolite identification. The identified metabolites were annotated using standard functional databases. Thereafter, quantitative and differential analyses of the metabolites were conducted. The functional characterization of the differentially expressed metabolites included KEGG pathway enrichment.

Gene expression

Quantitative reverse transcriptase PCR (qRT-PCR) was used to identify the impact of normoxic stress on the expression levels of gtfC and spaP, with 16S rRNA serving as a quantified internal control. S. mutans was cultured overnight in BHI at 37 °C under either normoxic or hypoxic conditions. Overnight bacterial cultures were centrifuged at 12,000 × g for 5 min at 4 °C. The bacterial cells were lysed for 1 h with 20 mg/mL lysozyme lysate, followed by treatment with proteinase K for at least 30 min. Total RNA was extracted from the cell pellets using miRNeasy Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. The RNA concentration and purity (A260/A280) were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, United States). The RNA was reverse transcribed into cDNA using a PrimeScript RT reagent kit (Takara, Japan) following the manufacturer’s instructions. qRT-PCR was performed on the LightCycler 96 Real-Time System (Roche, Switzerland) using 2 × Super SYBR Green qPCR Master Mix (ES Science, China) to amplify and quantify target RNA. The primers used in this study are listed in Table 1. The 2^-ΔΔCT method was used to quantify the fold changes in gene expression.

Table 1.

Primers used in this study.

Primer name	Sequences (5’–3’)	References
gtfC	Forward: GATGCTGCAAACTTCGAACA	[51]
gtfC	Reverse: TATTGACGCTGCGTTTCTTG	[51]
spaP	Forward: GACTTTGGTAATGGTTATGCATCAA	[52]
spaP	Reverse: TTTGTATCAGCCGGATCAAGTG	[52]
16S rRNA	Forward: AGCGTTGTCCGGATTTATTG	[51]
16S rRNA	Reverse: CTACGCATTTCACCGCTACA	[51]

Open in a new tab

Atomic force microscope (AFM)

AFM (Nano Wizard V; BRUKER, United States) was used to observe morphology and measure the surface adhesion forces. For morphology, 10 μL of S. mutans cultures, which were grown overnight under normoxic or hypoxic conditions, were deposited onto a freshly cleaved mica surface and allowed to air-dry naturally. The surface morphology of S. mutans was subsequently imaged in the gas phase using a ScanAsyst-Air cantilever under Peak Force Tapping mode.

For surface adhesion forces, 900 μL of S. mutans was co-cultured with two types of 100 μL of MVs (with a final concentration of 1 × 10⁸ particles/mL) or PBS (blank control) in 24-well plates. Cell slides were placed at the bottom of each well. The cultures were incubated overnight at 37 °C under normoxic conditions, then gently rinsed three times with dd H₂O and air-dried naturally. The surface adhesion forces of S. mutans were measured in the liquid phase using a DNP-A cantilever under Quantitative Nanomechanical Mapping (QNM) mode, with an approach and retraction speed of 1 µm/s.

Crystal violet staining

To investigate the effects of normoxic MVs on early biofilm formation, 180 μL of S. mutans or S. mutans ΔgtfBC was co-cultured with two types of 20 μL MVs (with a final concentration of 1 × 10⁸ particles/mL) or sterile PBS (blank control) in 96-well plates under normoxic conditions, BHI medium was used for S. mutans and 0.25% BHIS (BHI supplemented with 0.25% sucrose) for S. mutans ΔgtfBC. After 12 h, the biofilm biomass was quantified by crystal violet staining. In brief, the supernatants were removed, and the biofilms were washed three times with sterile PBS. Subsequently, 150 μL of absolute methanol was added to fix the biofilms for 15 min. The fixed biofilms were stained with 0.1% (w/v) crystal violet for 15 min, followed by gentle rinsing under flowing water to remove excess dye. After that, the plates were air-dried for 1 h. Crystal violet was solubilized in 95% ethanol at room temperature in a shaking incubator for 1 h in the dark. Finally, solubilization was transferred to a new 96-well plate, and the absorbance was measured at 595 nm using a spectrophotometer (Tecan, Switzerland).

Confocal laser scanning microscopy (CLSM)

For the determination of early biofilm biomass and extracellular polysaccharide (EPS) production, 900 μL of S. mutans ΔgtfBC was co-cultured with two types of 100 μL MVs (with a final concentration of 1 × 10⁸ particles/mL) or PBS (blank control) in 0.25% BHIS within glass-bottom dishes, and 2.5 μM Alexa Fluor 647 (Invitrogen, United States) was added to each sample for staining EPS, followed by incubation in the dark at 37 °C under normoxic conditions for 12 h.

For the determination of S. mutans adhesion, the surface of the glass-bottom dish was pre-treated with a mixture of 900 μL 0.25% BHIS and two types of 100 μL MVs (with a final concentration of 1 × 10⁸ particles/mL) or PBS (blank control), and 2.5 μM Alexa Fluor 647 was added to each sample for staining EPS. The samples were incubated in the dark overnight at 37 °C under normoxic conditions. Subsequently, the supernatants were removed, and non-adherent MVs were gently washed three times with sterile PBS. 1 mL of S. mutans cultures without sucrose were then added to each dish [48]. Bacterial adhesion was allowed to proceed for 4 h at 37 °C under normoxic conditions [53,54].

To visualize the spatial co-localization between S. mutans and MVs, both types of MVs were labeled using a PKH26 Fluorescent Cell Linker Kit (Sigma, United States). Briefly, following the second ultracentrifugation in MVs isolation, the pellets were gently resuspended in 500 μL of Diluent C. A total of 500 μL of 2 μM PKH26 dye was then added by gentle mixing and incubation for 2 min in the dark. The labeling reaction was then terminated by adding 1 mL of 10% BSA solution. Unbound dye was removed by ultracentrifugation at 100,000 × g for 70 min at 4 °C. Finally, 900 μL of S. mutans was co-cultured with 100 μL of labeled MVs (with a final concentration of 1 × 10⁸ particles/mL) or sterile PBS (blank control) in BHI medium within glass-bottom dishes, incubated in the dark at 37 °C under normoxic conditions for 8 h [55].

The samples from the above three experiments were all gently rinsed with PBS to remove the supernatants and floating cells, and the adhered bacteria were stained with 2.5 μM SYTO-9 (Invitrogen, United States) in darkness for 15 min. Images were acquired using a CLSM (FV3000; Olympus, Japan) from three distinct regions of three independent biological replicates. The excitation wavelength was 488 nm for SYTO-9, 647 nm for Alexa Fluor 647 and 551 nm for PKH26. The bacterial biomass and EPS biomass were quantified using the COMSTAT image analysis system.

Scanning electron microscope (SEM)

SEM (Apero 2S HiVac; Thermo Fisher Scientific, United States) was used to observe the surface structure of the biofilms. 900 μL of S. mutans was co-cultured with two types of 100 μL of MVs (with a final concentration of 1 × 10⁸ particles/mL) or with PBS (blank control) using BHI on round coverslips in 24-well plates, followed by incubation at 37 °C under normoxic conditions for 12 h. The supernatants were removed, and the biofilms were gently rinsed three times with PBS to eliminate planktonic cells, followed by fixation with 2.5% (w/v) glutaraldehyde for 4 h. The fixed biofilms were subsequently washed four times with PBS, and then subjected to graded dehydration with 30%, 50%, 70%, 90% and 100% concentration ethanol. The biofilms were then immersed in tert-butanol three times for 15 min each, followed by overnight lyophilization and gold sputter-coating. The biofilms were observed by SEM at magnifications of 2000×, 5000× and 10,000×, respectively.

Statistical analysis

The results are expressed as mean ± standard deviation (SD) from at least three biological replicates and three technical replicates. The level of statistical significance was evaluated using t-test or one-way ANOVA in GraphPad Prism 9 (GraphPad Software, United States). Dunnett’s or Tukey’s tests were applied for multiple comparisons. P < 0.05 was considered statistically significant.

Results

Physical characteristics of MVs

S. mutans produces MVs under both normoxic and hypoxic conditions. Consistent with the previous research, although the growth of S. mutans was slightly delayed under normoxic stress, OD600 nm and CFU counts revealed no significant difference in the number of viable bacteria at the time (12 h) of MVs isolation among the groups (Figure 1a–b), which ensures equivalent microbial input for MVs preparation [13].

A six panel figure shows S. mutans growth, M V characteristics, and protein concentration. The six panel figure arranged in a two by three grid shows the growth of S. mutans and the physical characteristics of M V s. Panel a, located top left, is a line graph titled Growth curve. The horizontal axis is Time h from 0 to 24, and the vertical axis is O D 600 nanometer from 0.0 to 1.2. Two lines are plotted: Hypoxic condition, which increases from 0.2 O D at 0 hour to a peak of 1.0 O D at 10 hour, then gradually decreases to 0.8 O D at 24 hour; and Normoxic condition, which increases from 0.2 O D at 0 hour to a peak of 1.0 O D at 10 hour, then gradually decreases to 0.8 O D at 24 hour. Both lines show similar growth patterns. Panel b, located top right, is a bar graph with the horizontal axis labeled Normoxic and Hypoxic, and the vertical axis labeled l g C F U per milliliter from 0 to 10. Both Normoxic and Hypoxic conditions show a bar height of approximately 8.5 l g C F U per milliliter. Panel c, located middle left, shows T E M images of M V s. The top image is labeled Hypoxic M V s, showing a circular particle. The bottom image is labeled Normoxic M V s, also showing a circular particle. A white bar represents 200 nanometer. Panel d, located middle center, is a bar graph with the horizontal axis labeled Normoxic M V s and Hypoxic M V s, and the vertical axis labeled Size nanometer from 0 to 150. — The growth of *S. mutans* and the physical characteristics of MVs. (a) The 24 h growth curve of *S. mutans* under normoxic and hypoxic conditions. (b) CFU counts of viable bacteria at the time of MVs isolation. (c) MVs images taken by TEM. The scale bar represents 200 nm. (d) The average diameter of MVs was determined by NTA and nanoflow cytometer. (e) The particle concentration of MVs determined by NTA and nanoflow cytometer. (f) The total protein concentration of MVs was determined by BCA assay. The data are presented as means ± SD from three independent experiments. (n = 3, ∗P < 0.05, ∗∗P < 0.01).

TEM images confirmed that MVs derived from both conditions exhibited typical spherical, bilayered and closed membranous structures (Figure 1c). NTA suggests that the average diameter of the normoxic MVs was approximately 80 nm, which was significantly smaller than hypoxic MVs (approximately 120 nm) (Figure 1d; P < 0.05). It is worth noting that the particle concentration of normoxic MVs was approximately 100-fold higher than that of hypoxic MVs (Figure 1e; P < 0.05). The quantification of total protein by BCA assay indicated that normoxic MVs yield substantially more protein from the same volume (400 mL) of culture supernatants (Figure 1f; P < 0.05). However, the substantial increase in the yield of normoxic MVs may reduce the protein content of individual MV, suggesting a potential trade-off between MVs quantity and cargo loading. These differences in physical characteristics may contribute to the functional advantages of normoxic MVs.

Proteomic and metabolomic analyses of MVs

GtfC, GtfB, fructosyl transferase (Ftf), MurD and AtlA are the most abundant proteins in both normoxic and hypoxic MVs. Ftf catalyzes the conversion of sucrose into fructan and, together with GtfC and GtfB, contributes to the adhesion of S. mutans [3]. AtlA is essential for the maturation of biofilms, autolysis of cells, and the biogenesis of a variety of surface-associated proteins, including SpaP [20,56]. Therefore, both normoxic and hypoxic MVs are closely associated with the adhesion and biofilm formation of S. mutans.

Differentially expressed proteins or metabolites were identified using the threshold criteria of a fold change (FC) ≥ 1.2 or FC ≤ 0.83 and a p-value < 0.05. Compared to hypoxic MVs, normoxic MVs exhibited 252 enriched and 129 reduced proteins. GtfC and SpaP were the most significantly enriched proteins in normoxic MVs, showing increases of 133.87-fold and 22.52-fold, respectively. Differentially expressed proteins with a FC ≥ 2 or FC ≤ 0.5 are provided in the Supplementary materials. In addition, proteins involved in glycogen synthesis, acid and oxidative stress responses, along with other stress-related proteins, such as GlgC, SpxA and GroEL, were significantly enriched in normoxic MVs [57–60]. Approximately one-quarter of the differentially expressed proteins are localized to the plasma membrane and extracellular space. Domains of SpaP are enriched with numerous differentially expressed proteins, including the variable V region that distinguishes SpaP variants in S. mutans; the LPXTG motif that is recognized by sortase A during the anchoring of SpaP to cell wall peptidoglycan; and the A region and C-terminal domain, which are critical for SpaP adherence to SAG [30,32,37,61](Figure 2a).

A 5-panel graph shows protein and gene enrichment analyses, plus g t f C and s p a P expression changes. The 5-panel graph arranged in a 2-by-2 grid with a fifth panel below the right column shows protein and gene enrichment analyses, plus g t f C and s p a P expression changes. Moving left to right across the top row, Panel a is a bar graph showing protein number on the vertical axis from 0 to 15, and I P R description on the horizontal axis. The bars represent Surface antigen I slash I I, V-domain; L P X T G cell wall anchor domain; Surface antigen I slash I I, A repeat; Surface antigen I slash I I, C-terminal; and Surface antigen I slash I I, N-terminal. Panel b is a bar graph showing Gene Number on the vertical axis from 0 to 30, and G O Term on the horizontal axis. The G O Terms are grouped into Biological Process, Cellular Component, and Molecular Function. Moving to the bottom row, Panel c is a bar graph showing Pathway Name on the vertical axis and Gene Number on the horizontal axis from 0 to 15. The pathways are grouped into Environmental Information Processing, Genetic Information Processing, and Metabolism. Panel d is a bar graph titled g t f C, showing Fold gene expression on the vertical axis from 0 to 4, and Normoxic and Hypoxic conditions on the horizontal axis. The Normoxic bar is higher than the Hypoxic bar, with 3 asterisks indicating a p value less than 0.001. — Enrichment analysis of differentially expressed proteins in normoxic MVs and expression changes of *gtfC* and *spaP*. (a) Domain enrichment analysis. (b) GO enrichment analysis. (c) KEGG enrichment analysis. (d, e) Transcriptional expression changes of *gtfC* and *spaP* in *S. mutans* under normoxic stress. The data are presented as means ± SD from three independent experiments (n = 3, ^∗∗∗P < 0.001).

GO enrichment analysis revealed that the differentially expressed proteins in normoxic MVs are associated with multiple crucial biological processes, including transport, proteolysis, glycolysis, peptidoglycan biosynthesis, extracellular polysaccharide biosynthesis and carbohydrate metabolism, as well as with the plasma membrane or membrane components and protein binding functions (Figure 2b). KEGG enrichment analysis revealed that the differentially expressed proteins in normoxic MVs were enriched in the ABC transporter pathway, glycolysis pathway and amino acid metabolism pathways (Figure 2c).

We further validated the transcriptional expression changes of gtfC and spaP in S. mutans using qRT-PCR assays. The results revealed that the expression trends were consistent with those observed at the protein level in MVs, and both genes showed significant upregulation (approximately 3-fold) (Figure 2d–e; P < 0.05).

Metabolomic analyses of MVs revealed that the majority of differentially expressed metabolites in normoxic MVs were enriched in pathways associated with cell membrane stability and fluidity, including glycerophospholipid and sphingolipid metabolism (Figure 3a), which may indicate that the surface morphology of S. mutans is altered under normoxic stress. To verify this metabolism-based speculation, we further examined the surface morphology of S. mutans under normoxic and hypoxic conditions. AFM images showed distinct morphological differences between the two groups: S. mutans cultured under hypoxic conditions exhibited smooth and flat surfaces (Figure 3b). In contrast, under normoxic conditions, some cells exhibited surface depressions approximately 6–12 nm in depth, and most cells displayed granular protrusions (Figure 3c, d).

A four panel figure shows K E G G analysis and S. mutans surface morphology under normoxic and hypoxic conditions. The four panel figure shows K E G G analysis and S. mutans surface morphology under normoxic and hypoxic conditions. Panel a, in the upper left, is a bubble plot titled "Pathway" on the vertical axis and "Rich Factor" on the horizontal axis. The plot shows 12 pathways, including "Metabolic pathways" and "Glycerophospholipid metabolism," with varying rich factors and P value. A legend on the right indicates "Gene Number" from 1 to 11, represented by circle size, and "P.value" from 0.25 to 0.75, represented by brightness. Panel b, in the upper right, shows A F M images of S. mutans under hypoxic conditions. It contains two images, each with a 1 micrometer scale bar. The left image shows a textured surface, and the right image shows a magnified view of the surface. Panel c, in the middle right, shows A F M images of S. mutans under normoxic stress. It contains two images, each with a 200 nanometer scale bar. The left image shows a textured surface, and the right image shows a magnified view of the surface. Panel d, in the lower left, is a line graph titled "Height measured in nanometers" on the vertical axis and "Offset in nanometers" on the horizontal axis. The vertical axis ranges from 22 to 36 nanometers, and the horizontal axis ranges from 0 to 275 nanometers. — KEGG analysis of the differentially expressed metabolites in normoxic MVs and the surface morphology of *S. mutans*. (a) KEGG enrichment analysis of differentially expressed metabolites in normoxic MVs. ‘Rich factor’ represents the proportion of differentially expressed metabolites among all metabolites annotated to this KEGG pathway. The smaller the p-value, the greater the enrichment of the associated KEGG pathways. (b) AFM images showing the surface morphology of *S. mutans* under hypoxic conditions. (c) AFM images showing the surface morphology of *S. mutans* under normoxic stress. The white arrow points to the cell surface depression. (d) The depression depth on the cell surface in the magnified area of figure c.

Effects of normoxic MVs on early biofilm formation and initial adhesion by S. mutans

S. mutans was co-cultured with normoxic MVs or hypoxic MVs under normoxic conditions to develop early biofilms. Since GtfC and SpaP mediate sucrose-dependent and sucrose-independent adhesion, respectively, we used sucrose-containing medium (0.25% BHIS) to assess the functional activity of GtfC in MVs and sucrose-free medium to evaluate that of SpaP in MVs. Crystal violet staining results revealed that normoxic MVs exhibited a stronger promoting effect on early biofilm formation of S. mutans in the sucrose-free medium, reflecting the functional activity of MV-associated SpaP, whereas no significant difference was observed between the two types of MVs in the sucrose-containing medium (Figure 4a; P < 0.05). It cannot be ruled out that endogenously secreted normoxic MVs exert biological effects across all groups during early biofilm formation. Moreover, endogenously Gtfs produced by S. mutans may synthesize a substantial amount of glucan, thereby obscuring the specific contribution of MV-associated GtfC to this process. We then substituted S. mutans with S. mutans ΔgtfBC to validate the functional activity of MV-associated GtfC. Compared with hypoxic MVs, normoxic MVs significantly enhanced the early biofilm formation of S. mutans ΔgtfBC (Figure 4a; P < 0.05). This observation is consistent with the functional activity of GtfC within normoxic MVs, although it does not rule out potential contributions from other MVs components.

A six panel diagram shows S. mutans biofilm formation and E P S biomass under different M V conditions. The six panel diagram arranged in a two by three grid shows S. mutans biofilm formation and E P S biomass under different M V conditions. Moving left to right across the top row, then left to right across the middle row, and finally left to right across the bottom row. Panel a, in the top left, shows crystal violet staining results for biofilm formation. The top part of panel a displays three sets of six wells each, labeled from left to right as S. mutans plus B H I, S. mutans plus B H I S, and delta g t f B C plus B H I S. Below these wells are three bar graphs. The leftmost bar graph, labeled Biofilm formation O D 595 nanometers, compares Normoxic M V s, Hypoxic M V s, and P B S for S. mutans plus B H I. Normoxic M V s show a significantly higher bar than Hypoxic M V s and P B S, with two asterisks above the comparison between Normoxic M V s and Hypoxic M V s, and three asterisks above the comparison between Normoxic M V s and P B S. The middle bar graph, also labeled Biofilm formation O D 595 nanometers, compares Normoxic M V s, Hypoxic M V s, and P B S for S. mutans plus B H I S. Normoxic M V s show a significantly higher bar than Hypoxic M V s and P B S, with two asterisks above the comparison between Normoxic M V s and Hypoxic M V s, and two asterisks above the comparison between Normoxic M V s and P B S. — Effects of MVs on the early biofilm formation and initial adhesion of *S. mutans*. (a) Crystal violet staining was applied to quantify early biofilms. *S. mutans* or *S. mutans* Δ*gtfBC* were co-cultured with two types of MVs or with PBS under normoxic conditions for 12 h to form early biofilms. ‘*S. mutans* + BHI’ group aimed to assess the effect of SpaP enriched in normoxic MVs. The ‘Δ*gtfBC* + BHIS’ group aimed to assess the effect of GtfC enriched in normoxic MVs. The bar represents 6.45 mm. (b) CLSM images of *S. mutans* Δ*gtfBC* early biofilms. *S. mutans* Δ*gtfBC* were co-cultured with two types of MVs in 0.25% BHIS under normoxic conditions for 12 h. (c) CLSM images of adherent *S. mutans* and EPS pre-synthesized by MVs. The adherent surfaces were pre-incubated with two types of MVs in 0.25% BHIS under normoxic conditions for 12 h. Following supernatants removal, *S. mutans* cultured in BHI were allowed to adhere for 4 h. (d) The biomass of EPS in figure b. (e) The biomass of EPS in figure c. (f) The biomass of *S. mutans* in figure c. CLSM images were taken at 60× magnification. The bar represents 50 μm. The data are presented as means ± SD from three independent experiments (n = 3, ^∗P < 0.05, ^∗∗P < 0.01, ^∗∗∗P < 0.001).

CLSM images showed that in early biofilms of S. mutans ΔgtfBC, normoxic MVs produced more clustered EPS with bacteria aggregating into numerous near-circular microcolonies (Figure 4b, d; P < 0.05). Although the bacterial biomass has no significantly differences between the normoxic MVs and hypoxic MVs groups (data not shown), both EPS and bacteria in the hypoxic MVs group appeared more diffusely distributed (Figure 4b). Since S. mutans ΔgtfBC lacks the capacity to synthesize insoluble glucan, the increase in EPS biomass observed in the normoxic MVs group is likely attributed to the high expression of GtfC within normoxic MVs.

Furthermore, we conducted an adhesion assay and showed that surfaces pretreated with normoxic MVs had greater glucan synthesis (Figure 4c, e; P < 0.05) and adhered more S. mutans (Figure 4c, f; P < 0.05), indicating that the glucan provided more binding sites for S. mutans and established favorable conditions for S. mutans initial adhesion. As previously noted, hypoxic MVs containing multiple factors associated with biofilm formation. Consequently, compared to the control group (PBS), they promote early biofilm formation (Figure 4a–b; P < 0.05) and initial adhesion (Figure c, e; P < 0.05) to a certain extent, although the effect was less pronounced than that of the normoxic MVs.

Normoxic MVs mediate the self-aggregation of S. mutans

To determine whether the aggregation of S. mutans shown in Figure 4b is mediated by normoxic MVs, we labeled MVs with PKH 26, followed by examination of their co-localization using CLSM. Normoxic MVs were predominantly localized in the center of S. mutans colonies (magnified view in Figure 5a). SEM images also revealed that the early biofilms of S. mutans treated with normoxic MVs exhibited a more compact surface structure (Figure 5b). The samples for CLSM and SEM observations were cultured in sucrose-free medium under normoxic conditions. Minimal EPS production would be insufficient for structural stability; however, S. mutans colonies remained aggregated. AFM was employed to quantify the surface adhesion force of S. mutans under normoxic MVs treatment. Compared to hypoxic MVs and PBS, normoxic MVs enhanced the surface adhesion force by approximately 5-fold, thereby promoting the aggregation and stability of S. mutans colonies mediated by MVs (Figure 5c; P < 0.05).

A three panel diagram shows S. mutans co-localization with M V s, S E M images of biofilms, and adhesion force. The three panel diagram shows S. mutans co-localization with M V s, S E M images of biofilms, and adhesion force. Panel a, located at the top left, presents confocal laser scanning microscopy images showing S. mutans co-localized with two types of M V s in B H I. The panel is arranged in three rows and four columns. The first column is labeled S. mutans, the second M V s, the third Merged, and the fourth Magnified view. The rows are labeled Normoxic M V s, Hypoxic M V s, and P B S. The images were taken at 100 times magnification. The scale bar represents 20 micrometers. White arrows indicate the localization of M V s within the central region of the microcolonies in the magnified view. Panel b, located at the bottom left, displays S E M images of early biofilms formed by co-incubation of S. mutans with two types of M V s. This panel is arranged in three rows and three columns. The columns are labeled 2,000 times, 5,000 times, and 10,000 times magnification. The rows are labeled Normoxic M V s, Hypoxic M V s, and P B S. Scale bars are 10 micrometers, 5 micrometers, and 1 micrometer respectively. Panel c, located at the right, is a bar graph showing the surface adhesion force of S. mutans with M V s treatment, determined by A F M. The vertical axis is labeled Adhesion force in p N, ranging from 0 to 400. — Normoxic MVs mediate the self-aggregation of *S. mutans*. (a) CLSM images showing *S. mutans* co-localized with two types of MVs in BHI. Images were taken at 100× magnification. The scale bar represents 20 μm. The white arrows indicate the localization of MVs within the central region of the microcolonies. (b) SEM images of early biofilms formed by co-incubation of *S. mutans* with two types of MVs. Images were taken at 2,000×, 5,000× and 10,000× magnifications. (c) The surface adhesion force of *S. mutans* with MVs treatment was determined by AFM, and the data are presented as means ± SD from three independent fields (^∗∗P < 0.01).

Proteomic analysis of S. mutans under normoxic conditions

The enrichment of GtfC and SpaP in S. mutans normoxic MVs is unlikely to be a random event. We conducted proteomic analyses on parental bacteria cultured under normoxic and hypoxic conditions. Compared with hypoxic conditions, S. mutans grown under normoxic conditions exhibited 95 enriched and 336 reduced proteins. However, the abundance of cell-associated GtfC was elevated only 1.51-fold, and the SpaP abundance showed no statistically significant difference (data not shown). Therefore, the high levels of GtfC and SpaP in normoxic MVs (133.87-fold and 22.52-fold, respectively) likely reflect a selective enrichment process. In addition, the enrichment profile of differentially expressed proteins in parental bacteria resembled that in MVs, with significant enrichment in SpaP domains (Figure 6a), protein binding molecular function (Figure 6b), as well as the ABC transporter pathway and the glycolysis pathway (Figure 6c).

A 3 panel bar graph shows protein and gene enrichment analyses for S. mutans under normoxic conditions. The 3 panel bar graph arranged in a horizontal sequence shows enrichment analyses of differentially expressed proteins in S. mutans under normoxic conditions. Panel a, positioned leftmost, is titled I P R underscore description and shows domain enrichment analysis. The vertical axis is labeled Protein Number, ranging from 0 to 20 in increments of 5. The horizontal axis lists protein domains. The tallest bar, at 17, is for L P X T G cell wall anchor domain. The next tallest, at 12, is for Surface antigen I slash I I, V-domain. The remaining bars decrease in height from 11 to 7 for A B C transporter like, A T P binding domain, A B C transporter like, conserved site, Adhesin isopeptide forming adherence domain, Surface antigen I slash I I, C-terminal, and Surface antigen I slash I I, N-terminal. Panel b, positioned in the middle, is titled G O Term and shows G O enrichment analysis. The vertical axis is labeled Gene Number, ranging from 0 to 40 in increments of 10. The horizontal axis is divided into three sections: Biological Process, Cellular Component, and Molecular Function. Under Biological Process, the tallest bar, at 31, is for biological underscore process. — Enrichment analysis of differentially expressed proteins in *S. mutans* under normoxic conditions. (a) Domain enrichment analysis. (b) GO enrichment analysis. (c) KEGG enrichment analysis.

Discussion

This research suggests that under normoxic conditions, the crucial environmental stress encountered by S. mutans during initial adhesion, induce the secretion of MVs with a smaller size, higher particle concentration, and enrichment of the adhesins GtfC and SpaP. Normoxic MVs promote initial adhesion and early biofilm formation by enhancing self-aggregation, glucan synthesis, and surface adhesion forces of S. mutans, aiding the colonization of parental bacteria under normoxic stress. These findings highlight the crucial role of MVs in adaptation to environmental stresses and the pathogenicity of S. mutans, providing a theoretical foundation for understanding the earliest stage of cariogenic biofilm formation.

For pathogenic bacteria, the hostile host environment represents a major challenge to overcome during the establishment of infection. This study revealed that the secretion of S. mutans MVs increases approximately 100-fold under normoxic conditions, suggesting that S. mutans may adapt to this environmental stress through enhanced MVs production. S. mutans MVs facilitate bacterial colonization of oral epithelial cells, enhance biofilm formation, and suppress macrophage phagocytosis, all of which promote the survival of S. mutans in the oral cavity [62]. Under acidic stress (pH = 5.5), S. mutans produces a greater number of smaller MVs compared to neutral conditions, and these MVs exhibit high levels of proteins associated with carbohydrate metabolism and adhesion, significantly enhancing biofilm formation [48]. We also monitored the pH of the culture systems under normoxic and hypoxic conditions, revealing no significant differences (data not shown). It should be noted that this study focused exclusively on MVs isolated from S. mutans at the late-logarithmic growth phase. Gene expression and MVs cargo composition across other growth stages under normoxic stress remain uncharacterized. Given that the bacterial growth phase is a well-established determinant of these characteristics, this constitutes a limitation of the present work [63,64]. Consistent with our findings, environmental stresses induce MVs secretion in various Gram-positive bacteria. During antibiotic stress, MVs confer protection to Listeria monocytogenes (L. monocytogenes) against trimethoprim and streptomycin in a dose-dependent manner [65]. Exposure to cathelicidin LL-37 leads to increased MVs on the surface of Streptococcus pyogenes, and both the SpeB and M1-protein within these MVs exhibit inhibitory activity against LL-37 [66].

Gram-positive bacteria can release MVs through blebbing of the plasma membrane, which traverses the peptidoglycan layer of the cell wall [40]. The mechanism of enhanced MVs secretion is likely mediated by normoxic stress activating autolysin expression, thereby promoting peptidoglycan degradation. Previous studies have demonstrated that oxygen regulates the expression and maturation of autolysin in S. mutans [20]. Recently, another study has shown that S. mutans releases MVs through lysis mediated by autolysin encoded by lytF [67]. Our proteomics analysis results further revealed that AtlA is among the most abundant proteins in both normoxic and hypoxic MVs. Autolysis has also been established as the pathway of MVs biogenesis in Bacillus subtilis and Staphylococcus aureus (S. aureus) [68,69]. However, we did not detect significant changes of autolysin expression in cells or MVs under normoxic stress.

One of the most significant findings of this study is that although the magnitude of expression changes of GtfC and SpaP was modest at the cellular level under normoxic stress, these proteins were markedly enriched in normoxic MVs (133.87-fold and 22.52-fold, respectively). Nevertheless, the current data do not definitively establish that the enhanced early biofilm formation and initial adhesion observed with normoxic MVs treatment are attributable exclusively to the enriched GtfC and SpaP, as MVs isolated by ultracentrifugation may contain trace amounts of co-precipitated non-vesicular contaminants. Despite this limitation, the enrichment of GtfC and SpaP in normoxic MVs revealed a potential MV-pathway for delivering key adhesion factors. Among the ten most abundant proteins identified in S. aureus MVs, nine of which are cell surface proteins such as GtfC and SpaP. The most abundant protein is SpsB, which mediates the adhesion and biofilm formation of parental bacteria [70]. This type of ‘virulence factor-first’ packaging strategy allows S. mutans adapt to environmental stress rapidly, reflecting the dynamic adaptation of MVs to the colonization and pathogenicity demands of the parental bacteria. Similar phenomena have been observed in other Gram-positive bacteria. MVs secreted by L. monocytogenes under osmotic stress contain multiple compatible solute transporter proteins, including OpuCA, OpuCB, OpuCC, and OpuCD [71]. MVs secreted by S. aureus under physiological pyrexia temperature are enriched in virulence factors and exhibit enhanced hemolytic activity [72]. However, the mechanism of the selective exclusion or packaging of MVs cargo under environmental stress has not been fully elucidated. The relationship between MVs composition and bacterial pathogenicity needs further investigation.

The effects of bacterial MVs on biofilm formation have been comprehensively reviewed in multiple authoritative studies [38,41–43,73]. We found that normoxic MVs serve as carriers of adhesin, promoting initial adhesion and early biofilm formation in S. mutans by enhancing self-aggregation, glucan synthesis, and surface adhesion force, partially restoring the impaired biofilm-forming capacity of S. mutans under normoxic stress. Compared with hypoxic MVs, normoxic MVs exhibit a one-third reduction in diameter. We speculate that the smaller particle size may facilitate faster diffusion of MVs onto AEP. The higher concentration and smaller size of normoxic MVs may enable them to compete for binding sites on the tooth surface, facilitating S. mutans colonization. Our previous study showed that hypoxic MVs of S. mutans inhibit mature biofilm formation by the initial colonizers Streptococcus gordonii and Streptococcus sanguinis under hypoxic conditions [74]. This discrepancy indicating that the effects of MVs on biofilm formation may not only depend on the composition of MVs, but also be related to the development stage of biofilms, the culture conditions, and the interspecies relationships between the MVs’ target organisms and the MVs’ parental bacteria. The influence of S. mutans normoxic MVs on the initial adhesion of other early colonizers, and their biological effects on interspecies relationships deserve further investigation.

Conclusions

This research suggests that normoxic stress enhances the secretion of MVs, which promote the initial adhesion and early biofilm formation of S. mutans. These findings indicate the critical role of MVs in the successful adhesion of S. mutans. Inhibiting MVs secretion, disrupting virulence factors packaging, accelerating MVs degradation, and blocking their diffusion represent promising strategies for targeting the initial adhesion of S. mutans to prevent cariogenic biofilm development.

Supplementary Material

Supplementary_Materials.docx

ZJOM_A_2648321_SM3928.docx^{(31.1KB, docx)}

Acknowledgements

We are grateful to LC Biotechnology Co., Ltd., for assisting in mass spectrometry detection and bioinformatics analysis. We are grateful to the Analytical and Testing Center of Sun Yat-sen University for assisting in the AFM and TEM tests.

GC and HL conceived the research. GC and YZ (Yang Zhou) designed the research. GC executed the experiments and analyzed the data. YT, YZ (Yan Zhou) and HL provided theoretical support. GC and HL co-wrote and revised the manuscript. All authors read and approved the submitted versions.

Funding Statement

This study was funded by the National Natural Science Foundation of China (No. 81970928).

Disclosure statement

The authors have no competing interest to declare.

Data availability statement

The datasets generated and analysed during the current study are available from the corresponding author upon reasonable request.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Supplemental material

Supplemental data for this article can be accessed at https://doi.org/10.1080/20002297.2026.2648321.

References

[1].Collaborators GBDOD, Bernabe E, Marcenes W, et al. Global, regional, and national levels and trends in burden of oral conditions from 1990 to 2017: a systematic analysis for the global burden of disease 2017 study. J Dent Res. 2020;99:362–373. doi: 10.1177/0022034520908533 [DOI] [PMC free article] [PubMed] [Google Scholar]
[2].Peres MA, Macpherson LMD, Weyant RJ, et al. Oral diseases: a global public health challenge. Lancet. 2019;394:249–260. doi: 10.1016/S0140-6736(19)31146-8 [DOI] [PubMed] [Google Scholar]
[3].Lemos JA, Palmer S, Zeng L, et al. The biology of Streptococcus mutans. Microbiol Spectr. 2019;7:GPP3-0051-2018. doi: 10.1128/microbiolspec.GPP3-0051-2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
[4].Liu Y, Daniel SG, Kim H, et al. Addition of cariogenic pathogens to complex oral microflora drives significant changes in biofilm compositions and functionalities. Microbiome. 2023;11:123. doi: 10.1186/s40168-023-01561-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
[5].Sauer K, Stoodley P, Goeres DM, et al. The biofilm life cycle: expanding the conceptual model of biofilm formation. Nat Rev Microbiol. 2022;20:608–620. doi: 10.1038/s41579-022-00767-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
[6].Carniello V, Peterson BW, van der Mei HC, et al. Physico-chemistry from initial bacterial adhesion to surface-programmed biofilm growth. Adv Colloid Interface Sci. 2018;261:1–14. doi: 10.1016/j.cis.2018.10.005 [DOI] [PubMed] [Google Scholar]
[7].Ruhal R, Kataria R. Biofilm patterns in gram-positive and gram-negative bacteria. Microbiol Res. 2021;251:126829. doi: 10.1016/j.micres.2021.126829 [DOI] [PubMed] [Google Scholar]
[8].Moon J, Seo K, Kwon JS. Novel two-stage expansion of Streptococcus mutans biofilm supports EPS-targeted prevention strategies for early childhood caries. npj Biofilms Microbiomes. 2025;11:65. doi: 10.1038/s41522-025-00699-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
[9].Krsmanovic M, Biswas D, Ali H, et al. Hydrodynamics and surface properties influence biofilm proliferation. Adv Colloid Interface Sci. 2021;288:102336. doi: 10.1016/j.cis.2020.102336 [DOI] [PubMed] [Google Scholar]
[10].Jakubovics NS, Goodman SD, Mashburn-Warren L, et al. The dental plaque biofilm matrix. Periodontol 2000. 2021;86:32–56. doi: 10.1111/prd.12361 [DOI] [PMC free article] [PubMed] [Google Scholar]
[11].Scharnow AM, Solinski AE, Wuest WMTS. Mutans biofilms: a perspective on preventing dental caries. MedChemComm. 2019;10:1057–1067. doi: 10.1039/C9MD00015A [DOI] [PMC free article] [PubMed] [Google Scholar]
[12].Ciofu O, Moser C, Jensen PO, et al. Tolerance and resistance of microbial biofilms. Nat Rev Microbiol. 2022;20:621–635. doi: 10.1038/s41579-022-00682-4 [DOI] [PubMed] [Google Scholar]
[13].Ahn SJ, Wen ZT, Burne RA. Effects of oxygen on virulence traits of Streptococcus mutans. J Bacteriol. 2007;189:8519–8527. doi: 10.1128/JB.01180-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
[14].Ahn SJ, Ahn SJ, Browngardt CM, et al. Changes in biochemical and phenotypic properties of Streptococcus mutans during growth with aeration. Appl Environ Microbiol. 2009;75:2517–2527. doi: 10.1128/AEM.02367-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
[15].Heller D, Helmerhorst EJ, Gower AC, et al. Microbial diversity in the early in vivo-formed dental biofilm. Appl Environ Microbiol. 2016;82:1881–1888. doi: 10.1128/AEM.03984-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
[16].von Ohle C, Gieseke A, Nistico L, et al. Real-time microsensor measurement of local metabolic activities in ex vivo dental biofilms exposed to sucrose and treated with chlorhexidine. Appl Environ Microbiol. 2010;76:2326–2334. doi: 10.1128/AEM.02090-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
[17].Mark Welch JL, Rossetti BJ, Rieken CW, et al. Biogeography of a human oral microbiome at the micron scale. Proc Natl Acad Sci U S A. 2016;113:E791–800. [DOI] [PMC free article] [PubMed] [Google Scholar]
[18].Spatafora G, Li Y, He X, et al. The evolving microbiome of dental caries. Microorganisms. 2024;12:121. doi: 10.3390/microorganisms12010121 [DOI] [PMC free article] [PubMed] [Google Scholar]
[19].Hao T, Xie Z, Wang M, et al. An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters. Nat Commun. 2019;10:3665. doi: 10.1038/s41467-019-11673-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
[20].Ahn SJ, Burne RA. Effects of oxygen on biofilm formation and the AtlA autolysin of Streptococcus mutans. J Bacteriol. 2007;189:6293–6302. doi: 10.1128/JB.00546-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
[21].Nobbs AH, Lamont RJ, Jenkinson HF. Streptococcus adherence and colonization. Microbiol Mol Biol Rev. 2009;73:407–450. Table of Contents. doi: 10.1128/MMBR.00014-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
[22].Yadav P, Verma S, Bauer R, et al. Deciphering streptococcal biofilms. Microorganisms. 2020;8:1835. doi: 10.3390/microorganisms8111835 [DOI] [PMC free article] [PubMed] [Google Scholar]
[23].Matsumoto-Nakano M. Role of Streptococcus mutans surface proteins for biofilm formation. Jpn Dent Sci Rev. 2018;54:22–29. doi: 10.1016/j.jdsr.2017.08.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
[24].Mieher JL, Larson MR, Schormann N, et al. Glucan binding protein C of Streptococcus mutans mediates both sucrose-independent and sucrose-dependent adherence. Infect Immun. 2018;86. doi: 10.1128/IAI.00146-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
[25].Zhang Q, Ma Q, Wang Y, et al. Molecular mechanisms of inhibiting glucosyltransferases for biofilm formation in Streptococcus mutans. Int J Oral Sci. 2021;13:30. doi: 10.1038/s41368-021-00137-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
[26].Atta L, Mushtaq M, Siddiqui AR, et al. Targeting glucosyltransferases to combat dental caries: current perspectives and future prospects. Int J Biol Macromol. 2024;278:134645. doi: 10.1016/j.ijbiomac.2024.134645 [DOI] [PubMed] [Google Scholar]
[27].Flemming HC, van Hullebusch ED, Neu TR, et al. The biofilm matrix: multitasking in a shared space. Nat Rev Microbiol. 2023;21:70–86. doi: 10.1038/s41579-022-00791-0 [DOI] [PubMed] [Google Scholar]
[28].Vacca-Smith AM, Bowen WH. Binding properties of streptococcal glucosyltransferases for hydroxyapatite, saliva-coated hydroxyapatite, and bacterial surfaces. Arch Oral Biol. 1998;43:103–110. doi: 10.1016/S0003-9969(97)00111-8 [DOI] [PubMed] [Google Scholar]
[29].Fitri DK, Tuygunov N, Wan Harun WHA, et al. Key virulence genes associated with Streptococcus mutans biofilm formation: a systematic review. Front Oral Health. 2025;6:1654428. doi: 10.3389/froh.2025.1654428 [DOI] [PMC free article] [PubMed] [Google Scholar]
[30].Larson MR, Rajashankar KR, Crowley PJ, et al. Crystal structure of the C-terminal region of Streptococcus mutans antigen I/II and characterization of salivary agglutinin adherence domains. J Biol Chem. 2011;286:21657–21666. doi: 10.1074/jbc.M111.231100 [DOI] [PMC free article] [PubMed] [Google Scholar]
[31].Esberg A, Sheng N, Mårell L, et al. Streptococcus mutans adhesin biotypes that match and predict individual caries development. EBioMedicine. 2017;24:205–215. doi: 10.1016/j.ebiom.2017.09.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
[32].Yang J, Deng D, Brandt BW, et al. Diversity of SpaP in genetic and salivary agglutinin mediated adherence among Streptococcus mutans strains. Sci Rep. 2019;9:19943. doi: 10.1038/s41598-019-56486-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
[33].Yang C, Scoffield J, Wu R, et al. Antigen I/II mediates interactions between Streptococcus mutans and Candida albicans. Mol Oral Microbiol. 2018;33:283–291. doi: 10.1111/omi.12223 [DOI] [PMC free article] [PubMed] [Google Scholar]
[34].Guo L, Shokeen B, He X, et al. Streptococcus mutans SpaP binds to RadD of fusobacterium nucleatum ssp. Polymorphum. Mol Oral Microbiol. 2017;32:355–364. doi: 10.1111/omi.12177 [DOI] [PMC free article] [PubMed] [Google Scholar]
[35].Zhou Y, Huang F, Lin H. Berberine chloride hydrate impairs Streptococcus mutans biofilm formation via inhibiting sortase A activity. NPJ Biofilms Microbiomes. 2025;11:120. doi: 10.1038/s41522-025-00756-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
[36].Chen Z, Zhao X, Zheng H, et al. Advances and challenges in drug design against dental caries: application of in silico approaches. J Pharm Anal. 2025;15:101161. doi: 10.1016/j.jpha.2024.101161 [DOI] [PMC free article] [PubMed] [Google Scholar]
[37].Rivera-Quiroga RE, Cardona N, Padilla L, et al. In silico selection and in vitro evaluation of new molecules that inhibit the adhesion of streptococcus mutants through antigen I/II. Int J Mol Sci. 2020;22:377. doi: 10.3390/ijms22010377 [DOI] [PMC free article] [PubMed] [Google Scholar]
[38].Liu Y, Defourny KAY, Smid EJ, et al. Gram-positive bacterial extracellular vesicles and their impact on health and disease. Front Microbiol. 2018;9:1502. doi: 10.3389/fmicb.2018.01502 [DOI] [PMC free article] [PubMed] [Google Scholar]
[39].Moghaddam ZS, Dehghan A, Halimi S, et al. Bacterial extracellular vesicles: bridging pathogen biology and therapeutic innovation. Acta Biomater. 2025;200:1–20. doi: 10.1016/j.actbio.2025.05.028 [DOI] [PubMed] [Google Scholar]
[40].Toyofuku M, Nomura N, Eberl L. Types and origins of bacterial membrane vesicles. Nat Rev Microbiol. 2019;17:13–24. doi: 10.1038/s41579-018-0112-2 [DOI] [PubMed] [Google Scholar]
[41].Jeong GJ, Khan F, Tabassum N, et al. Bacterial extracellular vesicles: modulation of biofilm and virulence properties. Acta Biomater. 2024;178:13–23. doi: 10.1016/j.actbio.2024.02.029 [DOI] [PubMed] [Google Scholar]
[42].Toyofuku M, Schild S, Kaparakis-Liaskos M, et al. Composition and functions of bacterial membrane vesicles. Nat Rev Microbiol. 2023;21:415–430. doi: 10.1038/s41579-023-00875-5 [DOI] [PubMed] [Google Scholar]
[43].Cao Y, Lin H. Characterization and function of membrane vesicles in gram-positive bacteria. Appl Microbiol Biotechnol. 2021;105:1795–1801. doi: 10.1007/s00253-021-11140-1 [DOI] [PubMed] [Google Scholar]
[44].Wu R, Cui G, Cao Y, et al. Streptococcus mutans membrane vesicles enhance Candida albicans pathogenicity and carbohydrate metabolism. Front Cell Infect Microbiol. 2022;12:940602. doi: 10.3389/fcimb.2022.940602 [DOI] [PMC free article] [PubMed] [Google Scholar]
[45].Liao S, Klein MI, Heim KP, et al. Streptococcus mutans extracellular DNA is upregulated during growth in biofilms, actively released via membrane vesicles, and influenced by components of the protein secretion machinery. J Bacteriol. 2014;196:2355–2366. doi: 10.1128/JB.01493-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
[46].Senpuku H, Nakamura T, Iwabuchi Y, et al. Effects of complex DNA and MVs with GTF extracted from Streptococcus mutans on the oral biofilm. Molecules. 2019;24:3131. doi: 10.3390/molecules24173131 [DOI] [PMC free article] [PubMed] [Google Scholar]
[47].Qiu L, Chen Q, Zheng G, et al. A brief review of membrane vesicles from Streptococcus mutans. Front Microbiol. 2025;16:1656926. doi: 10.3389/fmicb.2025.1656926 [DOI] [PMC free article] [PubMed] [Google Scholar]
[48].Cao Y, Zhou Y, Chen D, et al. Proteomic and metabolic characterization of membrane vesicles derived from Streptococcus mutans at different pH values. Appl Microbiol Biotechnol. 2020;104:9733–9748. doi: 10.1007/s00253-020-10563-6 [DOI] [PubMed] [Google Scholar]
[49].Gong T, Tang B, Zhou X, et al. Genome editing in Streptococcus mutans through self-targeting CRISPR arrays. Mol Oral Microbiol. 2018;33:440–449. doi: 10.1111/omi.12247 [DOI] [PubMed] [Google Scholar]
[50].Matsumoto A, Oogai Y, Kurashige H, et al. Functional characteristics of membrane vesicles produced by streptococcus mitis. J Oral Microbiol. 2025;17:2557962. doi: 10.1080/20002297.2025.2557962 [DOI] [PMC free article] [PubMed] [Google Scholar]
[51].Jiang S, Zha Y, Zhao T, et al. Temporin-derived peptides disrupt the exopolysaccharide matrix of Streptococcus mutans to prevent related dental caries. J Agric Food Chem. 2024;72:26236–26247. doi: 10.1021/acs.jafc.4c09488 [DOI] [PubMed] [Google Scholar]
[52].Kim ES, Park BI, Kim YH, et al. The inhibitory effect of agastache rugosa essential oil on the dental biofilm. Molecules. 2024;29:4907. doi: 10.3390/molecules29204907 [DOI] [PMC free article] [PubMed] [Google Scholar]
[53].Chau NP, Pandit S, Jung JE, et al. Evaluation of Streptococcus mutans adhesion to fluoride varnishes and subsequent change in biofilm accumulation and acidogenicity. J Dent. 2014;42:726–734. doi: 10.1016/j.jdent.2014.03.009 [DOI] [PubMed] [Google Scholar]
[54].Li ZR, Sun J, Du Y, et al. Mutanofactin promotes adhesion and biofilm formation of cariogenic Streptococcus mutans. Nat Chem Biol. 2021;17:576–584. doi: 10.1038/s41589-021-00745-2 [DOI] [PubMed] [Google Scholar]
[55].Wu R, Tao Y, Cao Y, et al. Streptococcus mutans membrane vesicles harboring glucosyltransferases augment Candida albicans biofilm development. Front Microbiol. 2020;11:581184. doi: 10.3389/fmicb.2020.581184 [DOI] [PMC free article] [PubMed] [Google Scholar]
[56].Ahn SJ, Burne RA. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis. J Bacteriol. 2006;188:6877–6888. doi: 10.1128/JB.00536-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
[57].Ganguly T, Kajfasz JK, Abranches J, et al. Regulatory circuits controlling spx levels in Streptococcus mutans. Mol Microbiol. 2020;114:109–126. doi: 10.1111/mmi.14499 [DOI] [PMC free article] [PubMed] [Google Scholar]
[58].Kajfasz JK, Ganguly T, Hardin EL, et al. Transcriptome responses of Streptococcus mutans to peroxide stress: identification of novel antioxidant pathways regulated by spx. Sci Rep. 2017;7:16018. doi: 10.1038/s41598-017-16367-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
[59].Galvao LC, Galvão LCC, Miller JH, et al. Transcriptional and phenotypic characterization of novel spx-regulated genes in Streptococcus mutans. PLoS One. 2015;10:e0124969. doi: 10.1371/journal.pone.0124969 [DOI] [PMC free article] [PubMed] [Google Scholar]
[60].Liu C, Niu Y, Zhou X, et al. Streptococcus mutans copes with heat stress by multiple transcriptional regulons modulating virulence and energy metabolism. Sci Rep. 2015;5:12929. doi: 10.1038/srep12929 [DOI] [PMC free article] [PubMed] [Google Scholar]
[61].Larson MR, Rajashankar KR, Patel MH, et al. Elongated fibrillar structure of a streptococcal adhesin assembled by the high-affinity association of alpha- and PPII-helices. Proc Natl Acad Sci U S A. 2010;107:5983–5988. doi: 10.1073/pnas.0912293107 [DOI] [PMC free article] [PubMed] [Google Scholar]
[62].Song G, Li M, Zhou B, et al. Streptococcus mutans outer membrane vesicles affect inflammasome activation and the glycolysis of macrophages. Microb Pathog. 2024;196:106994. doi: 10.1016/j.micpath.2024.106994 [DOI] [PubMed] [Google Scholar]
[63].Zavan L, Bitto NJ, Johnston EL, et al. Helicobacter pylori growth stage determines the size, protein composition, and preferential cargo packaging of outer membrane vesicles. Proteomics. 2019;19:e1800209. doi: 10.1002/pmic.201800209 [DOI] [PubMed] [Google Scholar]
[64].Welsh JA, Goberdhan D, O'Driscoll L, et al. Minimal information for studies of extracellular vesicles (MISEV2023): from basic to advanced approaches. J Extracell Vesicles. 2024;13:e12404. doi: 10.1002/jev2.12451 [DOI] [PMC free article] [PubMed] [Google Scholar]
[65].Karthikeyan R, Gayathri P, Gunasekaran P, et al. Functional analysis of membrane vesicles of listeria monocytogenes suggests a possible role in virulence and physiological stress response. Microb Pathog. 2020;142:104076. doi: 10.1016/j.micpath.2020.104076 [DOI] [PubMed] [Google Scholar]
[66].Uhlmann J, Rohde M, Siemens N, et al. LL-37 triggers formation of Streptococcus pyogenes extracellular vesicle-like structures with immune stimulatory properties. J Innate Immun. 2016;8:243–257. doi: 10.1159/000441896 [DOI] [PMC free article] [PubMed] [Google Scholar]
[67].Nagasawa R, Ito T, Yamamoto C, et al. Membrane vesicle production via cell-to-cell communication-induced autolysis in Streptococcus mutans. Microbiol Spectr. 2025;13:e0033425. doi: 10.1128/spectrum.00334-25 [DOI] [PMC free article] [PubMed] [Google Scholar]
[68].Abe K, Toyofuku M, Nomura N, et al. Autolysis-mediated membrane vesicle formation in Bacillus subtilis. Environ Microbiol. 2021;23:2632–2647. doi: 10.1111/1462-2920.15502 [DOI] [PubMed] [Google Scholar]
[69].Wang X, Lee JC. Staphylococcus aureus membrane vesicles: an evolving story. Trends Microbiol. 2024;32:1096–1105. doi: 10.1016/j.tim.2024.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
[70].Uppu DS, Wang X, Lee JC. Contribution of extracellular membrane vesicles to the secretome of Staphylococcus aureus. mBio. 2023;14:e0357122. doi: 10.1128/mbio.03571-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
[71].Lee T, Jun SH, Choi CW, et al. Salt stress affects global protein expression profiles of extracellular membrane-derived vesicles of listeria monocytogenes. Microb Pathog. 2018;115:272–279. doi: 10.1016/j.micpath.2017.12.071 [DOI] [PubMed] [Google Scholar]
[72].Briaud P, Frey A, Marino EC, et al. Temperature influences the composition and cytotoxicity of extracellular vesicles in Staphylococcus aureus. mSphere. 2021;6:e0067621. doi: 10.1128/mSphere.00676-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
[73].Puca V, Marinacci B, Pellegrini B, et al. Biofilm and bacterial membrane vesicles: recent advances. Expert Opin Ther Pat. 2024;34:475–491. doi: 10.1080/13543776.2024.2338101 [DOI] [PubMed] [Google Scholar]
[74].Cui G, Li P, Wu R, et al. Streptococcus mutans membrane vesicles inhibit the biofilm formation of Streptococcus gordonii and Streptococcus sanguinis. AMB Express. 2022;12:154. doi: 10.1186/s13568-022-01499-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary_Materials.docx

ZJOM_A_2648321_SM3928.docx^{(31.1KB, docx)}

Data Availability Statement

The datasets generated and analysed during the current study are available from the corresponding author upon reasonable request.

[cit0001] [1].Collaborators GBDOD, Bernabe E, Marcenes W, et al. Global, regional, and national levels and trends in burden of oral conditions from 1990 to 2017: a systematic analysis for the global burden of disease 2017 study. J Dent Res. 2020;99:362–373. doi: 10.1177/0022034520908533 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0002] [2].Peres MA, Macpherson LMD, Weyant RJ, et al. Oral diseases: a global public health challenge. Lancet. 2019;394:249–260. doi: 10.1016/S0140-6736(19)31146-8 [DOI] [PubMed] [Google Scholar]

[cit0003] [3].Lemos JA, Palmer S, Zeng L, et al. The biology of Streptococcus mutans. Microbiol Spectr. 2019;7:GPP3-0051-2018. doi: 10.1128/microbiolspec.GPP3-0051-2018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0004] [4].Liu Y, Daniel SG, Kim H, et al. Addition of cariogenic pathogens to complex oral microflora drives significant changes in biofilm compositions and functionalities. Microbiome. 2023;11:123. doi: 10.1186/s40168-023-01561-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0005] [5].Sauer K, Stoodley P, Goeres DM, et al. The biofilm life cycle: expanding the conceptual model of biofilm formation. Nat Rev Microbiol. 2022;20:608–620. doi: 10.1038/s41579-022-00767-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0006] [6].Carniello V, Peterson BW, van der Mei HC, et al. Physico-chemistry from initial bacterial adhesion to surface-programmed biofilm growth. Adv Colloid Interface Sci. 2018;261:1–14. doi: 10.1016/j.cis.2018.10.005 [DOI] [PubMed] [Google Scholar]

[cit0007] [7].Ruhal R, Kataria R. Biofilm patterns in gram-positive and gram-negative bacteria. Microbiol Res. 2021;251:126829. doi: 10.1016/j.micres.2021.126829 [DOI] [PubMed] [Google Scholar]

[cit0008] [8].Moon J, Seo K, Kwon JS. Novel two-stage expansion of Streptococcus mutans biofilm supports EPS-targeted prevention strategies for early childhood caries. npj Biofilms Microbiomes. 2025;11:65. doi: 10.1038/s41522-025-00699-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0009] [9].Krsmanovic M, Biswas D, Ali H, et al. Hydrodynamics and surface properties influence biofilm proliferation. Adv Colloid Interface Sci. 2021;288:102336. doi: 10.1016/j.cis.2020.102336 [DOI] [PubMed] [Google Scholar]

[cit0010] [10].Jakubovics NS, Goodman SD, Mashburn-Warren L, et al. The dental plaque biofilm matrix. Periodontol 2000. 2021;86:32–56. doi: 10.1111/prd.12361 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0011] [11].Scharnow AM, Solinski AE, Wuest WMTS. Mutans biofilms: a perspective on preventing dental caries. MedChemComm. 2019;10:1057–1067. doi: 10.1039/C9MD00015A [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0012] [12].Ciofu O, Moser C, Jensen PO, et al. Tolerance and resistance of microbial biofilms. Nat Rev Microbiol. 2022;20:621–635. doi: 10.1038/s41579-022-00682-4 [DOI] [PubMed] [Google Scholar]

[cit0013] [13].Ahn SJ, Wen ZT, Burne RA. Effects of oxygen on virulence traits of Streptococcus mutans. J Bacteriol. 2007;189:8519–8527. doi: 10.1128/JB.01180-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0014] [14].Ahn SJ, Ahn SJ, Browngardt CM, et al. Changes in biochemical and phenotypic properties of Streptococcus mutans during growth with aeration. Appl Environ Microbiol. 2009;75:2517–2527. doi: 10.1128/AEM.02367-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0015] [15].Heller D, Helmerhorst EJ, Gower AC, et al. Microbial diversity in the early in vivo-formed dental biofilm. Appl Environ Microbiol. 2016;82:1881–1888. doi: 10.1128/AEM.03984-15 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0016] [16].von Ohle C, Gieseke A, Nistico L, et al. Real-time microsensor measurement of local metabolic activities in ex vivo dental biofilms exposed to sucrose and treated with chlorhexidine. Appl Environ Microbiol. 2010;76:2326–2334. doi: 10.1128/AEM.02090-09 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0017] [17].Mark Welch JL, Rossetti BJ, Rieken CW, et al. Biogeography of a human oral microbiome at the micron scale. Proc Natl Acad Sci U S A. 2016;113:E791–800. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0018] [18].Spatafora G, Li Y, He X, et al. The evolving microbiome of dental caries. Microorganisms. 2024;12:121. doi: 10.3390/microorganisms12010121 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0019] [19].Hao T, Xie Z, Wang M, et al. An anaerobic bacterium host system for heterologous expression of natural product biosynthetic gene clusters. Nat Commun. 2019;10:3665. doi: 10.1038/s41467-019-11673-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0020] [20].Ahn SJ, Burne RA. Effects of oxygen on biofilm formation and the AtlA autolysin of Streptococcus mutans. J Bacteriol. 2007;189:6293–6302. doi: 10.1128/JB.00546-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0021] [21].Nobbs AH, Lamont RJ, Jenkinson HF. Streptococcus adherence and colonization. Microbiol Mol Biol Rev. 2009;73:407–450. Table of Contents. doi: 10.1128/MMBR.00014-09 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0022] [22].Yadav P, Verma S, Bauer R, et al. Deciphering streptococcal biofilms. Microorganisms. 2020;8:1835. doi: 10.3390/microorganisms8111835 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0023] [23].Matsumoto-Nakano M. Role of Streptococcus mutans surface proteins for biofilm formation. Jpn Dent Sci Rev. 2018;54:22–29. doi: 10.1016/j.jdsr.2017.08.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0024] [24].Mieher JL, Larson MR, Schormann N, et al. Glucan binding protein C of Streptococcus mutans mediates both sucrose-independent and sucrose-dependent adherence. Infect Immun. 2018;86. doi: 10.1128/IAI.00146-18 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0025] [25].Zhang Q, Ma Q, Wang Y, et al. Molecular mechanisms of inhibiting glucosyltransferases for biofilm formation in Streptococcus mutans. Int J Oral Sci. 2021;13:30. doi: 10.1038/s41368-021-00137-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0026] [26].Atta L, Mushtaq M, Siddiqui AR, et al. Targeting glucosyltransferases to combat dental caries: current perspectives and future prospects. Int J Biol Macromol. 2024;278:134645. doi: 10.1016/j.ijbiomac.2024.134645 [DOI] [PubMed] [Google Scholar]

[cit0027] [27].Flemming HC, van Hullebusch ED, Neu TR, et al. The biofilm matrix: multitasking in a shared space. Nat Rev Microbiol. 2023;21:70–86. doi: 10.1038/s41579-022-00791-0 [DOI] [PubMed] [Google Scholar]

[cit0028] [28].Vacca-Smith AM, Bowen WH. Binding properties of streptococcal glucosyltransferases for hydroxyapatite, saliva-coated hydroxyapatite, and bacterial surfaces. Arch Oral Biol. 1998;43:103–110. doi: 10.1016/S0003-9969(97)00111-8 [DOI] [PubMed] [Google Scholar]

[cit0029] [29].Fitri DK, Tuygunov N, Wan Harun WHA, et al. Key virulence genes associated with Streptococcus mutans biofilm formation: a systematic review. Front Oral Health. 2025;6:1654428. doi: 10.3389/froh.2025.1654428 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0030] [30].Larson MR, Rajashankar KR, Crowley PJ, et al. Crystal structure of the C-terminal region of Streptococcus mutans antigen I/II and characterization of salivary agglutinin adherence domains. J Biol Chem. 2011;286:21657–21666. doi: 10.1074/jbc.M111.231100 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0031] [31].Esberg A, Sheng N, Mårell L, et al. Streptococcus mutans adhesin biotypes that match and predict individual caries development. EBioMedicine. 2017;24:205–215. doi: 10.1016/j.ebiom.2017.09.027 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0032] [32].Yang J, Deng D, Brandt BW, et al. Diversity of SpaP in genetic and salivary agglutinin mediated adherence among Streptococcus mutans strains. Sci Rep. 2019;9:19943. doi: 10.1038/s41598-019-56486-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0033] [33].Yang C, Scoffield J, Wu R, et al. Antigen I/II mediates interactions between Streptococcus mutans and Candida albicans. Mol Oral Microbiol. 2018;33:283–291. doi: 10.1111/omi.12223 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0034] [34].Guo L, Shokeen B, He X, et al. Streptococcus mutans SpaP binds to RadD of fusobacterium nucleatum ssp. Polymorphum. Mol Oral Microbiol. 2017;32:355–364. doi: 10.1111/omi.12177 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0035] [35].Zhou Y, Huang F, Lin H. Berberine chloride hydrate impairs Streptococcus mutans biofilm formation via inhibiting sortase A activity. NPJ Biofilms Microbiomes. 2025;11:120. doi: 10.1038/s41522-025-00756-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0036] [36].Chen Z, Zhao X, Zheng H, et al. Advances and challenges in drug design against dental caries: application of in silico approaches. J Pharm Anal. 2025;15:101161. doi: 10.1016/j.jpha.2024.101161 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0037] [37].Rivera-Quiroga RE, Cardona N, Padilla L, et al. In silico selection and in vitro evaluation of new molecules that inhibit the adhesion of streptococcus mutants through antigen I/II. Int J Mol Sci. 2020;22:377. doi: 10.3390/ijms22010377 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0038] [38].Liu Y, Defourny KAY, Smid EJ, et al. Gram-positive bacterial extracellular vesicles and their impact on health and disease. Front Microbiol. 2018;9:1502. doi: 10.3389/fmicb.2018.01502 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0039] [39].Moghaddam ZS, Dehghan A, Halimi S, et al. Bacterial extracellular vesicles: bridging pathogen biology and therapeutic innovation. Acta Biomater. 2025;200:1–20. doi: 10.1016/j.actbio.2025.05.028 [DOI] [PubMed] [Google Scholar]

[cit0040] [40].Toyofuku M, Nomura N, Eberl L. Types and origins of bacterial membrane vesicles. Nat Rev Microbiol. 2019;17:13–24. doi: 10.1038/s41579-018-0112-2 [DOI] [PubMed] [Google Scholar]

[cit0041] [41].Jeong GJ, Khan F, Tabassum N, et al. Bacterial extracellular vesicles: modulation of biofilm and virulence properties. Acta Biomater. 2024;178:13–23. doi: 10.1016/j.actbio.2024.02.029 [DOI] [PubMed] [Google Scholar]

[cit0042] [42].Toyofuku M, Schild S, Kaparakis-Liaskos M, et al. Composition and functions of bacterial membrane vesicles. Nat Rev Microbiol. 2023;21:415–430. doi: 10.1038/s41579-023-00875-5 [DOI] [PubMed] [Google Scholar]

[cit0043] [43].Cao Y, Lin H. Characterization and function of membrane vesicles in gram-positive bacteria. Appl Microbiol Biotechnol. 2021;105:1795–1801. doi: 10.1007/s00253-021-11140-1 [DOI] [PubMed] [Google Scholar]

[cit0044] [44].Wu R, Cui G, Cao Y, et al. Streptococcus mutans membrane vesicles enhance Candida albicans pathogenicity and carbohydrate metabolism. Front Cell Infect Microbiol. 2022;12:940602. doi: 10.3389/fcimb.2022.940602 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0045] [45].Liao S, Klein MI, Heim KP, et al. Streptococcus mutans extracellular DNA is upregulated during growth in biofilms, actively released via membrane vesicles, and influenced by components of the protein secretion machinery. J Bacteriol. 2014;196:2355–2366. doi: 10.1128/JB.01493-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0046] [46].Senpuku H, Nakamura T, Iwabuchi Y, et al. Effects of complex DNA and MVs with GTF extracted from Streptococcus mutans on the oral biofilm. Molecules. 2019;24:3131. doi: 10.3390/molecules24173131 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0047] [47].Qiu L, Chen Q, Zheng G, et al. A brief review of membrane vesicles from Streptococcus mutans. Front Microbiol. 2025;16:1656926. doi: 10.3389/fmicb.2025.1656926 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0048] [48].Cao Y, Zhou Y, Chen D, et al. Proteomic and metabolic characterization of membrane vesicles derived from Streptococcus mutans at different pH values. Appl Microbiol Biotechnol. 2020;104:9733–9748. doi: 10.1007/s00253-020-10563-6 [DOI] [PubMed] [Google Scholar]

[cit0049] [49].Gong T, Tang B, Zhou X, et al. Genome editing in Streptococcus mutans through self-targeting CRISPR arrays. Mol Oral Microbiol. 2018;33:440–449. doi: 10.1111/omi.12247 [DOI] [PubMed] [Google Scholar]

[cit0050] [50].Matsumoto A, Oogai Y, Kurashige H, et al. Functional characteristics of membrane vesicles produced by streptococcus mitis. J Oral Microbiol. 2025;17:2557962. doi: 10.1080/20002297.2025.2557962 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0051] [51].Jiang S, Zha Y, Zhao T, et al. Temporin-derived peptides disrupt the exopolysaccharide matrix of Streptococcus mutans to prevent related dental caries. J Agric Food Chem. 2024;72:26236–26247. doi: 10.1021/acs.jafc.4c09488 [DOI] [PubMed] [Google Scholar]

[cit0052] [52].Kim ES, Park BI, Kim YH, et al. The inhibitory effect of agastache rugosa essential oil on the dental biofilm. Molecules. 2024;29:4907. doi: 10.3390/molecules29204907 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0053] [53].Chau NP, Pandit S, Jung JE, et al. Evaluation of Streptococcus mutans adhesion to fluoride varnishes and subsequent change in biofilm accumulation and acidogenicity. J Dent. 2014;42:726–734. doi: 10.1016/j.jdent.2014.03.009 [DOI] [PubMed] [Google Scholar]

[cit0054] [54].Li ZR, Sun J, Du Y, et al. Mutanofactin promotes adhesion and biofilm formation of cariogenic Streptococcus mutans. Nat Chem Biol. 2021;17:576–584. doi: 10.1038/s41589-021-00745-2 [DOI] [PubMed] [Google Scholar]

[cit0055] [55].Wu R, Tao Y, Cao Y, et al. Streptococcus mutans membrane vesicles harboring glucosyltransferases augment Candida albicans biofilm development. Front Microbiol. 2020;11:581184. doi: 10.3389/fmicb.2020.581184 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0056] [56].Ahn SJ, Burne RA. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis. J Bacteriol. 2006;188:6877–6888. doi: 10.1128/JB.00536-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0057] [57].Ganguly T, Kajfasz JK, Abranches J, et al. Regulatory circuits controlling spx levels in Streptococcus mutans. Mol Microbiol. 2020;114:109–126. doi: 10.1111/mmi.14499 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0058] [58].Kajfasz JK, Ganguly T, Hardin EL, et al. Transcriptome responses of Streptococcus mutans to peroxide stress: identification of novel antioxidant pathways regulated by spx. Sci Rep. 2017;7:16018. doi: 10.1038/s41598-017-16367-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0059] [59].Galvao LC, Galvão LCC, Miller JH, et al. Transcriptional and phenotypic characterization of novel spx-regulated genes in Streptococcus mutans. PLoS One. 2015;10:e0124969. doi: 10.1371/journal.pone.0124969 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0060] [60].Liu C, Niu Y, Zhou X, et al. Streptococcus mutans copes with heat stress by multiple transcriptional regulons modulating virulence and energy metabolism. Sci Rep. 2015;5:12929. doi: 10.1038/srep12929 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0061] [61].Larson MR, Rajashankar KR, Patel MH, et al. Elongated fibrillar structure of a streptococcal adhesin assembled by the high-affinity association of alpha- and PPII-helices. Proc Natl Acad Sci U S A. 2010;107:5983–5988. doi: 10.1073/pnas.0912293107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0062] [62].Song G, Li M, Zhou B, et al. Streptococcus mutans outer membrane vesicles affect inflammasome activation and the glycolysis of macrophages. Microb Pathog. 2024;196:106994. doi: 10.1016/j.micpath.2024.106994 [DOI] [PubMed] [Google Scholar]

[cit0063] [63].Zavan L, Bitto NJ, Johnston EL, et al. Helicobacter pylori growth stage determines the size, protein composition, and preferential cargo packaging of outer membrane vesicles. Proteomics. 2019;19:e1800209. doi: 10.1002/pmic.201800209 [DOI] [PubMed] [Google Scholar]

[cit0064] [64].Welsh JA, Goberdhan D, O'Driscoll L, et al. Minimal information for studies of extracellular vesicles (MISEV2023): from basic to advanced approaches. J Extracell Vesicles. 2024;13:e12404. doi: 10.1002/jev2.12451 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0065] [65].Karthikeyan R, Gayathri P, Gunasekaran P, et al. Functional analysis of membrane vesicles of listeria monocytogenes suggests a possible role in virulence and physiological stress response. Microb Pathog. 2020;142:104076. doi: 10.1016/j.micpath.2020.104076 [DOI] [PubMed] [Google Scholar]

[cit0066] [66].Uhlmann J, Rohde M, Siemens N, et al. LL-37 triggers formation of Streptococcus pyogenes extracellular vesicle-like structures with immune stimulatory properties. J Innate Immun. 2016;8:243–257. doi: 10.1159/000441896 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0067] [67].Nagasawa R, Ito T, Yamamoto C, et al. Membrane vesicle production via cell-to-cell communication-induced autolysis in Streptococcus mutans. Microbiol Spectr. 2025;13:e0033425. doi: 10.1128/spectrum.00334-25 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0068] [68].Abe K, Toyofuku M, Nomura N, et al. Autolysis-mediated membrane vesicle formation in Bacillus subtilis. Environ Microbiol. 2021;23:2632–2647. doi: 10.1111/1462-2920.15502 [DOI] [PubMed] [Google Scholar]

[cit0069] [69].Wang X, Lee JC. Staphylococcus aureus membrane vesicles: an evolving story. Trends Microbiol. 2024;32:1096–1105. doi: 10.1016/j.tim.2024.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0070] [70].Uppu DS, Wang X, Lee JC. Contribution of extracellular membrane vesicles to the secretome of Staphylococcus aureus. mBio. 2023;14:e0357122. doi: 10.1128/mbio.03571-22 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0071] [71].Lee T, Jun SH, Choi CW, et al. Salt stress affects global protein expression profiles of extracellular membrane-derived vesicles of listeria monocytogenes. Microb Pathog. 2018;115:272–279. doi: 10.1016/j.micpath.2017.12.071 [DOI] [PubMed] [Google Scholar]

[cit0072] [72].Briaud P, Frey A, Marino EC, et al. Temperature influences the composition and cytotoxicity of extracellular vesicles in Staphylococcus aureus. mSphere. 2021;6:e0067621. doi: 10.1128/mSphere.00676-21 [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0073] [73].Puca V, Marinacci B, Pellegrini B, et al. Biofilm and bacterial membrane vesicles: recent advances. Expert Opin Ther Pat. 2024;34:475–491. doi: 10.1080/13543776.2024.2338101 [DOI] [PubMed] [Google Scholar]

[cit0074] [74].Cui G, Li P, Wu R, et al. Streptococcus mutans membrane vesicles inhibit the biofilm formation of Streptococcus gordonii and Streptococcus sanguinis. AMB Express. 2022;12:154. doi: 10.1186/s13568-022-01499-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Normoxic stress enhance the secretion of adhesion-promoting membrane vesicles by Streptococcus mutans

Guxin Cui

Ye Tao

Yang Zhou

Yan Zhou

Huancai Lin

Roles

ABSTRACT

Background

Materials and methods

Results

Conclusion

Key messages

Introduction

Materials and methods

Bacterial strains and culture conditions

Growth curves

CFU counts

Preparation of MVs

Characterized MVs

Proteomics and metabolomics analyses

Gene expression

Table 1.

Atomic force microscope (AFM)

Crystal violet staining

Confocal laser scanning microscopy (CLSM)

Scanning electron microscope (SEM)

Statistical analysis

Results

Physical characteristics of MVs

Figure 1.

Proteomic and metabolomic analyses of MVs

Figure 2.

Figure 3.

Effects of normoxic MVs on early biofilm formation and initial adhesion by S. mutans

Figure 4.

Normoxic MVs mediate the self-aggregation of S. mutans

Figure 5.

Proteomic analysis of S. mutans under normoxic conditions

Figure 6.

Discussion

Conclusions

Supplementary Material

Acknowledgements

Funding Statement

Disclosure statement

Data availability statement

Consent for publication

Ethics approval and consent to participate

Supplemental material

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases