Abstract
Vector control is a cornerstone for malaria management in Sub-Saharan Africa. Understanding the distribution dynamics and ecology of major malaria vectors is important for strengthening the current control efforts of national malaria control programmes. This project monitored the spatiotemporal distribution of Anopheles mosquitoes across different ecological zones of Ghana from 2017 to 2025. Anopheles mosquitoes were sampled from twelve sites across the three ecological zones of Ghana (Coastal, Forest and Sahel Savannah zones) using human landing catches and Prokopack aspirators. Mosquitoes were subjected to morphological and molecular species identification. Sporozoite infection rates and blood meal sources of collected blood fed female mosquitoes were both assessed using PCR. A total of 47,771 Anopheline mosquitoes (An. gambiae s.l, An. funestus, An. pharoensis and An. rufipes) were collected across the three ecological zones. Anopheles gambiae s.l, and particularly An. coluzzii and An. gambiae s.s were the predominant species across the study sites and ecological zones. Sporozoite infections were higher in the forest and sahel zones compared to the coastal zone, and the overall human blood index was 40.46%. Our findings provide relevant data for improving current vector control for malaria in Ghana.
Data description
Background and context
Malaria remains a major public health issue in Sub-Saharan Africa (SSA), accounting for over 251 million cases and over 500,000 deaths [1]. Over 94% of all malaria cases are reported in the WHO Africa Region [2]. Ghana is one of the 11 African countries contributing approximately two-thirds of all global malaria cases [3]. Despite other malaria control efforts, vector control remains the mainstay for malaria control and elimination in Ghana and across SSA. Over the last two decades, vector control tools like long-lasting insecticide treated nets (LLINs) and indoor residual spraying (IRS) have played a key role in the reduction of malaria transmission in SSA [4, 5]. However, increasing insecticide resistance in malaria vectors threatens the effectiveness of current control efforts [6–8].
There is a need for new vector interventions for malaria control and elimination. New frontiers in vector control are emerging with innovative tools in the pipeline such as attractive sugar baits, spatial repellents, endectocides and gene drive [9–11]. However, the success of current and emerging innovations in vector control has largely hinged on our deep understanding of the malaria vector distribution and ecology [12, 13]. In Ghana, Anopheles gambiae complex and Anopheles funestus complex are the main malaria vectors [14–17]. These complexes all have a diverse distribution, behaviour and ecology [15, 17, 18], and furthermore ecological shifts in vector composition and shifts in vector behaviour have been reported [19, 20]. This suggests that the distribution and ecology of local malaria vectors may vary from one geographical area to another due to different environmental factors [13, 21].
Understanding the distribution and ecology of local malaria vectors will therefore be useful in the development of targeted vector interventions for malaria control in Ghana. This study details the spatiotemporal distribution of Anopheles gambiae s.l across different ecological zones of Ghana. These ecological zones differing in climatic and environmental conditions which may affect the ecology and distribution of local malaria vectors.
Methods
Study sites
This study was conducted in twelve sites across the three main ecological zones of Ghana (Coastal, Forest and Sahel Savannah zone) during the dry season (February–March) and the rainy season (May–July) from 2017 to 2025. These sites are Anyakpor, Dodowa, Aflao, Takoradi, Elubo, Tuanikorpe, Pediatorkope, Allorkpem, Dwease, Kpalsogu, Pagaza and Libga (Figure 1).
Figure 1.
Map of study sites across the three ecological zones of Ghana.
Anyakpor (5° 46′ 51.96″ N, 0° 35′ 12.84″ E), Tuanikorpe (05°50.029′ N, 000°38.778′ E), Pediatorkope (5° 48′ 52.6″ N 0° 37′ 66.00″ E), Allorkpem (05°47.960N, 000°39.180W) are located in the coastal zone of Ghana. These sites are characterized by dry climates with temperatures within 23 °C to 28 °C and a bimodal rainfall pattern with a long rainy season and a short rainy season [22]. Anyakpor is a farming community located in the Ada East District. Irrigated farming is practiced all year round in that site, leading to the creation of numerous mosquito breeding sites, and hence high densities of mosquitoes [15]. Tuanikope, Pediatorkope, and Allorkpem are island communities along the Volta Lake in the Dagme East district of Greater Accra where the main occupation is fishing. These sites have been difficult to access, hence they have not received vector interventions such as IRS and LLINs for several years [23].
Dwease (06°32.383N, 001°14.368W) is a village located in the Asante-Akim Central municipality and characterized by a wet-semi equatorial climate and a bimodal rainfall pattern. Dwease has a semi-deciduous forest vegetation and their main occupation is farming. Kpalsogu (09°34.019N, 001°01.975W), Pagaza (9° 22′ 33″ N, 0° 42′ 30″ W) and Libga (09°35.567N, 000°50.743W) are rural communities in the Kumbungu and Tamale municipalities in the Sahel savannah zone of Ghana. These sites have annual temperatures, ranging from 28 °C to 42 °C and a unimodal rainfall pattern (from May to November). Irrigated farming is practiced throughout the year creating many swamps which are suitable breeding habitats for Anopheles mosquitoes. Malaria interventions such as SMCs and IRS are carried out in Kpalsogu [5], and insecticide-treated nets are distributed in Libga and Pagaza.
Mosquito collections
Adult mosquitoes were collected using human landing catches (HLCs) and Prokopack aspirators and CDC light traps. Anopheles mosquitoes were collected using HLC from 18:00 to 06:00 hours for four consecutive days in 16 randomly selected houses per site and season using well -described protocols [18, 22]. CDC light traps were also set up in indoor and outdoor of houses to collect adult mosquitoes from 18:00 to 06:00. For fair representation, each site was split into four sections and one-day sampling was conducted in each section. Collectors were rotated hourly as a quality control measure to reduce collection bias. Furthermore, mechanical Prokopack aspirators were used to collect adult mosquitoes from up to 20 houses (at least 50 m apart from each other) from each study site from 06:00 and 08:00. Indoor and outdoor collectors were done simultaneously in each house. Collected mosquitoes were stored in eppendorf tubes with silica gel, placed in a cooler box containing ice and transported to the insectary.
Morphological and molecular species identification of Anopheles mosquitoes
Collected mosquitoes were morphologically identified using morphological keys by Gillies and Coetzee [24]. DNA was extracted from the legs of mosquitoes using the QIAGEN DNeasy Blood and Tissue Kits according to the manufacturer’s instructions. Members of the Anopheles gambiae s.l complex were further distinguished molecularly using PCR. Species-specific primers for Anopheles gambiae, An. arabiensis, An. melas and a universal primer were used for the PCR reactions following protocols by Scott et al. [25]. Anopheles gambiae s.s and An. coluzzii were further distinguished by PCR-RFLP using the method by Fanello et al. [26].
Sporozoites infectivity of adult Anopheles gambiae s.l mosquitoes
DNA was extracted from the head and thorax of adult An. gambiae s.l mosquitoes were used for the detection of Plasmodium falciparum sporozoites using PCR using well-described protocols by Echeverry et al. [27]. Species-specific primers targeting the cytochrome oxidase I (COX-I) of P. falciparum sporozoites were used for the PCR assays.
Blood meal analysis of blood fed resting Anopheles mosquitoes
DNA was extracted from the abdomens of bloodfed An. gambiae s.l mosquitoes using QIAGEN DNeasy Blood and Tissue Kits according to the manufacturer’s instructions. The blood meals of engorged female mosquitoes were determined using PCR with well-described protocols from Kent and Norris [28]. Host-specific primers (human, cow, goat, pig and dog) were used for the PCR amplifications (Table 1). Positive controls were included for each host in the PCR analyses, and laboratory-reared unfed An. gambiae were used as the negative control.
Table 1.
Primer sequences used for PCR analysis.
| Primer name | Sequence (5ʹ-3ʹ) | |
|---|---|---|
| Species identification | Reference | |
| UN | GTGTGCCGCTTCCTCGATGT | |
| AG | CTGGTTTGGTCGGCACGTTT | |
| AR | AAGTGTCCTTCTCCATCCTA | |
| AM | GTGACCAACCCACTCCCTTGA | |
| F6.1a | TCGCCTTAGACCTTGCGTTA | |
| R6.1b | CGCTTCAAGAATTCGAGATAC | [26] |
| Sporozoites | ||
| COX-IF | AGAACGAACGCTTTTAACGCCTG | |
| COX-IR | ACTTAATGGTGGATATAAAGTCCATCCwGT | [27] |
| Blood meals | ||
| Goat | CCTAATCTTAGTACTTGTACCCTTCCTC | |
| Human | GGCTTACTTCTCTTCATTCTCTCCT | |
| Pig | CCTCGCAGCCGTACATCTC | |
| Dog | GGAATTGTACTATTATTCGCAACCAT | |
| Cow | CATCGGCACAAATTTAGTCG | |
| UNFOR403 | TGAGGACAAATATCATTCTGAGG | |
| UNREV1025 | GGTTGTCCTCCAATTCATGTTA | [28] |
Data analysis
Chi-square tests/fisher exact tests were used to assess differences in seasonal abundance and species composition of malaria vectors collected by location, study site and season. Sporozoite infection rates were calculated as the proportion of mosquitoes testing positive for Plasmodium sporozoites, obtained by dividing the number of sporozoite-positive mosquitoes by the total number examined. Human blood index (HBI) was calculated as the proportion of blood-fed mosquitoes that had fed on humans relative to the total number analyzed for blood meal origin.
Results
Abundance and seasonal distribution of Anopheline vectors
Overall, a total of 47,771 Anopheline mosquitoes (An. gambiae s.l, An. funestus, An. pharoensis and An. rufipes) were collected from all the study during the dry and rainy seasons. More mosquitoes were collected in the rainy (31,611/47,771, 66.17%) season compared to the dry season (16,160/47,771, 33.83%). Anopheles gambiae s.l was predominant across both rainy and dry seasons (45,068/47,771, 94.34%) followed by An. pharoensis (1610/47,771, 3.37%), An. funestus (720/47,771, 1.51%) and An. rufipes (373/47,771, 0.78%) (Table 2).
Table 2.
Abundance and seasonal distribution of Anopheline vectors across the study sites.
| Anophelines species | ||||||
|---|---|---|---|---|---|---|
| Ecozone | Sites | An. gambiae s.l | An. funestus | An. pharoensis | An. rufipes | Total |
| Dry season | ||||||
| Coastal | Anyakpor Dodowa Aflao Elubo Tuanikorpe Pediatorkope Allorkpem |
3247 832 10 0 446 162 271 |
0 0 0 0 0 0 0 |
46 0 0 0 45 0 2 |
3 1 0 0 39 72 40 |
3296 833 10 0 530 234 313 |
| Forest | Dwease | 1443 | 0 | 1 | 0 | 1444 |
| Sahel zone | Kpalsogu Pagaza Libga |
8583 532 32 |
1 0 0 |
182 0 0 |
170 0 0 |
8936 532 32 |
| Total | 15,558 | 1 | 276 | 325 | 16,160 | |
| Wet season | ||||||
| Coastal | Anyakpor Dodowa Aflao Takoradi Elubo Tuanikorpe Pediatorkope Allorkpem |
2055 6985 44 35 37 128 71 145 |
0 1 0 0 0 0 0 0 |
491 19 0 0 0 11 7 0 |
2 2 0 0 0 6 4 10 |
2548 7007 44 35 37 145 82 155 |
| Forest | Dwease Abetifi |
2262 17 |
62 0 |
1 0 |
0 0 |
2325 17 |
| Sahel zone | Kpalsogu Pagaza Libga Total |
8174 7653 1904 29,510 |
80 572 4 719 |
769 36 0 1334 |
21 3 0 48 |
9044 8264 1908 31,611 |
| Grand total | 45,068 (94.34%) | 720 (1.51%) | 1610 (3.37%) | 373 (0.78%) | 47,771 (100) | |
Indoor and outdoor distribution of An. gambiae s.l vectors
More An. gambiae s.l were collected in the rainy season (65.5%, 29,510/45,068) compared to the dry season (34.5%, 15,558/45,068). Anopheles gambiae s.l mosquitoes were predominantly collected outdoors in both the dry season (61.3%, 9,540/15,558) and rainy season (55.8%, 16,476/29,510). In Anyakpor (from the coastal zone), more An. gambiae s.l mosquitoes were collected indoors in both the dry season (58.8%, 1909/3247) and the rainy season (56.2%, 1154/2055). However, in Kpalsogu (Sahel zone), more An. gambiae s.l mosquitoes were collected outdoors in both the dry season (73.9%, 6347/8583) and rainy seasons (62.7%, 5125/8174) (Table 3).
Table 3.
Indoor and outdoor distribution of An. gambiae s.l across the study sites.
| Dry season N (%) | Wet season N (%) | ||||||
|---|---|---|---|---|---|---|---|
| Eco-zones | Sites | Total | Indoor | Outdoor | Total | Indoor | Outdoor |
| Coastal zone | Anyakpor Dodowa Elubo Aflao Takoradi Tuanikorpe Pediatorkope Allorkpem |
3247 (100) 832 (100) 0 10 (100) 0 446 (100) 162 (100) 271 (100) |
1909 (58.8) 392 (47.1) 0 0 0 223 (50) 112 (69.1) 178 (65.7) |
1338 (41.2) 440 (52.9) 0 10 (100) 0 223 (50) 50 (30.9) 93 (34.3) |
2055 (100) 6985 (100) 37 (100) 44 (100) 35 (100) 128 (100) 71 (100) 145 (100) |
1154 (56.2) 3125 (44.7) 19 (51.4) 12 (27.3) 8 (22.9) 64 (50) 55 (77.5) 88 (60.7) |
901 (43.8) 3860 (55.3) 18 (48.6) 32 (72.7) 27 (77.1) 64 (50) 16 (22.5) 57 (39.3) |
| Forest | Dwease Abetifi |
1443 (100) 0 |
748 (51.8) 0 |
695 (48.2) 0 |
2262 (100) 17 (100) |
1244 (55) 0 |
1018 (45) 17 (100) |
| Sahel zone | Kpalsogu Pagaza Libga |
8583 (100) 532 (100) 32 (100) |
2236 (26.1) 210 (39.5) 10 (31.3) |
6347 (73.9) 322 (60.5) 22 (68.8) |
8174 (100) 7653 (100) 1904 (100) |
3049 (37.3) 3812 (49.8) 404 (21.2) |
5125 (62.7) 3841 (50.2) 1500 (78.8) |
| Overall total | 15,558 (100) | 6018 (38.7) | 9540 (61.3) | 29,510 (100) | 13,034 (44.2) | 16,476 (55.8) | |
Species composition of Anopheles gambiae s.l mosquitoes across the study sites
A subset of 2,730 An. gambiae s.l were morphologically identified, out of which An. coluzzii (53.33%, 1456/2730) was the predominant species, followed by Anopheles gambiae s.s (43.7%, 1193/2730), An. arabiensis (1.45%, 39/2730), An. melas (1.35%, 37/2730) and An. gambiae/An. coluzzii hybrids (0.18%, 5/2730). In the coastal sites, An. coluzzii was the predominant sites in Anyakpor (83.5%) and Pediatorkope (77.39%). However, An. gambiae s.s was the predominant species in Dodowa (87.02%), Tuanikorpe (63.74%) and Allorkpem (78.95%). For the forest and sahel zone sites, An. coluzzii was the most common species (>80%) in all the sites except in Pagaza, where An. gambiae s.s was most predominant (72.43%) (Figure 2). Significant differences in the distribution of An. gambiae s.l was observed across the study sites (χ2 = 301.06, df = 8, P < 0.001).
Figure 2.
Species discrimination of Anopheles gambiae s.l across the study sites.
Indoor and outdoor distribution of An. gambiae s.l from different ecological zones
In the coastal zone, a the greatest number of indoor collected mosquitoes were An. coluzzii (52.8%, 480/909) while a majority of outdoor collected mosquitoes were identified as An. gambiae s.s (52.4%, 393/750). For the forest and Sahel savannah zones, An. coluzzii was the predominant species collected both indoors and outdoors (P < 0.05) (Table 4). Anopheles melas was detected only in the coastal zone (0.3%) and An. arabiensis were more predominant outdoors (6.3%) compared to indoors (3.3%) and was only detected in the sahel zone (Table 4).
Table 4.
Indoor and outdoor distribution of An. gambiae s.l. across the ecological zones of Ghana.
|
An. gambiae s.l N (%) |
|||||||
|---|---|---|---|---|---|---|---|
| Ecozones | Location | An. coluzzii | An. gambiae s.s | An. melas | An. arabiensis | Hybrids | |
| Coastal | Indoor Outdoor Total |
909 (100) 750 (100) 1659 (100) |
480 (52.8) 332 (44.3) 812 (49) |
412 (45.3) 393 (52.4) 805 (48.5) |
12 (1.3) 25 (3.3) 37 (2.2) |
0 0 0 |
5 (0.6) 0 5 (0.3) |
| Forest | Indoor Outdoor Total |
131 (100) 134 (100) 265 (100) |
115 (87.8) 103 (77) 218 (82.3) |
16 (12.2) 31 (23) 47 (17.7) |
0 0 0 |
0 0 0 |
0 0 0 |
| Sahel | Indoor Outdoor Total |
395 (100) 411 (100) 806 (100) |
199 (50.4) 218 (53.1) 417 (51.8) |
183 (46.3) 167 (40.6) 350 (43.42) |
0 0 0 |
13 (3.3) 26 (6.3) 39 (4.8) |
0 0 0 |
N = total number of samples tested, % = percentage, Hybrids = An. coluzzii/An. gambiae s.s.
Sporozoites infectivity rates of An. gambiae s.l mosquitoes
A total of 1,062 An. gambiae s.l. mosquitoes were tested for the presence of P. falciparum circumsporozoite protein (CSP), of which 3.11% (33/1062) tested positive. Significantly higher sporozoite rates were detected in An. gambiae s.l collected during the wet season (4.46%, 19/426) compared to the dry season (2.2%, 14/636) (Fishers exact, P < 0.05). Sporozoite infection rates were higher in indoor mosquitoes (3.45%, 16/448) compared to outdoor An. gambiae s.l. mosquitoes (2.84%, 17/598) (P > 0.05) (Table 5). Higher sporozoite infection rates were detected in Anopheles gambiae s.l from the forest (7.69%, 1/13) and Sahel Savannah zone (4.11%, 6/146) compared to the coastal zone (2.88%, 26/903) (P > 0.05). Significantly higher sporozoite rates were detected in An. coluzzii (4.6%, 24/522) compared to An. gambiae s.s. mosquitoes (1.68%, 9/535) (Fishers exact, P < 0.05). The highest sporozoite infection rates in indoor collected mosquitoes were detected in Dwease (12.5%) and Libga (5%). However, for outdoor collected mosquitoes, sporozoite infections were only observed in Tuanikorpe (5.33%), Allorkpem (2.44%), Kpalsogu (4.55%) and Libga (4%) (Table 5).
Table 5.
Sporozoite infection rates detected in An. gambiae s.l. from the study sites.
| Indoor | Outdoor | |||||
|---|---|---|---|---|---|---|
| Study site | N | Pf CSP positives | SR (%) | N | Pf CSP positives | SR (%) |
| Anyakpor | 61 | 0 | 0 | 50 | 0 | 0.00 |
| Tuanikorpe | 173 | 6 | 3.47 | 169 | 9 | 5.33 |
| Pediatorkope | 127 | 4 | 3.15 | 19 | 0 | 0.00 |
| Allorkpem | 181 | 4 | 2.21 | 123 | 3 | 2.44 |
| Dwease | 8 | 1 | 12.5 | 5 | 0 | 0.00 |
| Kpalsogu | 27 | 1 | 3.70 | 66 | 3 | 4.55 |
| Pagaza | 1 | 0 | 0.00 | 7 | 0 | 0.00 |
| Libga | 20 | 1 | 5.00 | 25 | 1 | 4.00 |
| Total | 598 | 17 | 2.84 | 464 | 16 | 3.45 |
SR = Sporozoite rate, N = total number of samples tested, % = percentage, Pf CSP = P. falciparum circumsporozoite protein (CSP).
Blood meal sources of An. gambiae s.l mosquitoes
A total of 173 blood-fed female An. gambiae s.l. mosquitoes were tested for their blood meal sources. Overall, the Animal Blood Index (ABI) was higher (41.04%, 71/173) than Human Blood Index (HBI) (40.46%, 70/173). In the coastal zone, all blood fed mosquitoes were An. coluzzii, with a higher HBI in indoor (63.64%) compared to outdoor An. coluzzii mosquitoes (50%). In the forest zone, all indoor and 60% of outdoor blood-fed An. coluzzii tested had human blood meals. In the Sahel zone, a higher HBI and ABI was observed in indoor collected An. coluzzii mosquitoes (HBI and ABI = 47.22) compared to outdoor collected mosquitoes (HBI = 26.51, ABI = 42.17). This was similar for indoor blood-fed An. gambiae s.s. mosquitoes from the Sahel zone, however ABI was higher outdoors (50%) compared to indoors (33.33) (Table 6).
Table 6.
Blood meal sources of blood fed An. gambiae s.l across different ecological zones in Ghana.
| An. coluzzii N (%) | An. gambiae s.s N (%) | ||||
|---|---|---|---|---|---|
| Ecological zones | Blood-meal origins | Indoor | Outdoor (%) | Indoor (%) | Outdoor (%) |
| Coastal zone | Number tested Human Goat Human + Goat Human + Pig Unidentified HBI ABI |
11 (100) 5 (45.45) 3 (27.27) 1 (9.09) 1 (9.09) 1 (9.09) 63.64 45.45 |
4 (100) 1 (25) 2 (50) 0 1 (25) 0 50 75 |
0 0 0 0 0 0 0 0 |
0 0 0 0 0 0 0 0 |
| Forest zone | Number tested Human Unidentified HBI ABI |
8 (100) 8 (100) 0 100 0 |
5 (100) 3 (60) 2 (40) 60 0 |
0 0 0 0 0 |
0 0 0 0 0 |
| Sahel zone | Number tested Human Cow Goat Dog Human + Cow Dog + Goat Cow + Goat Unidentified HBI ABI |
36 (100) 17 (47.22) 8 (22.22) 4 (11.22) 0 0 1 (2.77) 4 (11.22) 2 (5.55) 47.22 47.22 |
83 (100) 20 (24.10) 25 (30.12) 5 (6.02) 2 (2.41) 2 (2.41) 0 1 (1.20) 28 (33.73) 26.51 42.17 |
12 (100) 6 (50) 2 (16.67) 2 (16.67) 0 0 0 0 2 (16.67) 50.00 33.33 |
14 (100) 5 (35.71) 3 (21.43) 3 (21.43) 1 (7.14) 0 0 0 2 (14.29) 35.71 50.00 |
N = total number of samples tested, % = percentage, HBI = Human Blood Index, ABI = Animal Blood Index.
Re-use potential
Understanding the distribution of the major malaria vector, An. gambiae s.l. is of key relevance for malaria control and elimination [12]. Our study identified four Anophelines species (An. gambiae s.l, An. funestus, An. pharoensis and An. rufipes) at varying abundance across different sites in the three major ecological zones of Ghana. Anopheles gambiae s.l, particularly An. coluzzii and An. gambiae s.s were predominant across the study sites. These species are very predominant across Ghana and are known to have very wide geographical spread and diverse habitats [15–18]. Other species such as Anopheles melas and Anopheles arabiensis are localised to particular parts of Ghana [15, 29]. Anopheles melas is mostly found in the coastal areas because it breeds in brackish water while An. arabiensis is found exclusively in the Sahel zone of Ghana due to the drier arid environment [15, 18, 22]. The dynamics of vector distribution varied in An. coluzzii and An. gambiae s.s in the Coastal zone with a higher abundance of An. gambiae s.s found only in the dry season compared to the rainy season.
Sporozoite infection rates were higher in the wet season compared to the dry season, in line with several studies across Ghana and Africa [30, 31]. Sporozoite infection rates were high in the Sahel and Forest zones compared to the coastal zone. Malaria prevalence was high in the Sahel Savannah zone, with a seasonal pattern peaking during the rainy season from July to November [32]. HBI was higher indoors compared to outdoors mosquitoes in An. coluzzii, which is in line with another study in Ghana that reported higher HBI in indoor compared to outdoor mosquitoes [18]. The observation of An. gambiae s.s in the sahel zone, where more outdoor mosquitoes fed on humans, may suggest potential shifts in biting behaviour in Anopheles gambiae mosquitoes, as reported in other studies [19, 20, 33]. These shifts may be due to changes in human behaviour or the high coverage of indoor based chemical vector interventions like LLINs and IRS [20, 34, 35].
This data provides key insights on An. gambiae s.l distribution, sporozoite infection rates and blood meal sources across Ghana and can be used for optimize current vector control strategies implemented by the National Malaria Elimination Programme to adapt targeted approaches for malaria control.
Data validation and quality control
All mosquito collections were supervised by well experienced entomologists. Measures such as rotations and quadrant sampling of each site was done to avoid bias. All mosquitoes were morphologically and molecularly identified by well experienced personnel using standard techniques. The final dataset was validated in the Integrated Publishing Toolkit (IPT) of the Global Biodiversity Information Facility (GBIF) [36]. The IPT validated the data through its network and the metadata can be found in GBIF [37].
Acknowledgements
Special thanks to the residents and community leaders of our study sites for giving us access to sample mosquitoes in their communities. We are also grateful to all the community field assistants for helping in the sampling and the entire team of the Centre for Vector-Borne Disease Research, Department of Medical Microbiology, University of Ghana Medical School.
Funding Statement
This study was supported by grants from the National Institute of Health (https://www.nih.gov/) received by YAA (Grant numbers: R01 A1123074 and D43 TW 011513).
Data availability
All supporting data for this article are published through the Integrated Publishing Toolkit of GBIF and are available under a CC0 waiver from GBIF [37].
Editor’s note
This paper is part of a series of Data Release articles working with GBIF and supported by TDR, the Special Program for Research and Training in Tropical Diseases, hosted at the World Health Organization [38].
Abbreviations
ABI: Animal Blood Index; CDC: Center for Disease Control; CSP: Circumsporozoite Protein; GBIF: Global Biodiversity Information Facility; HLC: Human Landing Catch; HBI: Human Blood Index; IPT: Integrated Publishing Toolkit; IRS: Indoor Residual Spraying; LLINs: Long-Lasting Insecticide Treated Nets; PCR: Polymerase Chain Reaction; SMCs: Seasonal Malaria Chemoprevention; SSA: Sub-Saharan Africa.
Declarations
Ethics approval and consent to participate
Ethical Approval was obtained from the Ghana Health Service ethics and Review Committee (GHS-ERC number: GHS-ERC: 051/03/23). Prior to the start of the study, meetings were held at each site with chiefs, community leaders, and residents to introduce the project. Approval to conduct the research within the communities was obtained from the respective leaders. Written informed consent was secured from all adult volunteers participating in the HLC study before training and mosquito collection activities. In addition, verbal consent was obtained from household heads for mosquito sampling within their homes and compounds.
Competing interests
The authors declare no competing interests.
Authors’ contributions
AAE, LEA, AA, AOF and YAA were responsible for the study design, supervised the data collection, and contributed to the writing of the manuscript. AA, AAE, LEA, CMO-A, ARMS, IKS, RTD, ENB, GAD, SBS, GA-B, CM-APZ, DKH, OKA and YAB performed the data collection and laboratory work. AA, CMO-A, AAE, LEA contributed to the analysis of the data. AA drafted the manuscript. All the authors read and approved the final manuscript.
Funding
This study was supported by grants from the National Institute of Health (https://www.nih.gov/) received by YAA (Grant numbers: R01 A1123074 and D43 TW 011513).
References
- 1.WHO . World Malaria Report 2024. Addressing Inequality in the Global Malaria Response. World Health Organization, 2024. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2024. [Google Scholar]
- 2.WHO . World Malaria Report 2023. Geneva: WHO Press, 2023. https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2023 [Google Scholar]
- 3.WHO . Ghana Intensifies Efforts towards Malaria Elimination. WHO, Regional Office for Africa, 2024. https://www.afro.who.int/countries/ghana/news/ghana-intensifies-efforts-towards-malaria-elimination. [Google Scholar]
- 4.Bhatt S, Weiss DJ, Cameron E et al. The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. Nature, 2015; 526(7572): 207–211. doi: 10.1038/nature15535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Coleman S, Dadzie SK, Seyoum A et al. A reduction in malaria transmission intensity in Northern Ghana after 7 years of indoor residual spraying. Malar. J., 2017; 16(1): 324. doi: 10.1186/s12936-017-1971-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Moyes CL, Athinya DK, Seethaler T et al. Evaluating insecticide resistance across African districts to aid malaria control decisions. Proc. Natl. Acad. Sci. USA, 2020; 117(36): 22042–22050. doi: 10.1073/pnas.2006781117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hancock PA, Hendriks CJM, Tangena JA et al. Mapping trends in insecticide resistance phenotypes in African malaria vectors. PLoS Biol., 2020; 18(6): e3000633. doi: 10.1371/journal.pbio.3000633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Moyes CL, Lees RS, Yunta C et al. Assessing cross-resistance within the pyrethroids in terms of their interactions with key cytochrome P450 enzymes and resistance in vector populations. Parasit. Vectors, 2021; 14(1): 115. doi: 10.1186/s13071-021-04609-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Killeen GF, Tatarsky A, Diabate A et al. Developing an expanded vector control toolbox for malaria elimination. BMJ Glob. Health, 2017; 2(2): e000211. doi: 10.1136/bmjgh-2016-000211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Achee NL, Bangs MJ, Farlow R et al. Spatial repellents: from discovery and development to evidence-based validation. Malar. J., 2012; 11: 164. doi: 10.1186/1475-2875-11-164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.WHO . New Frontiers in Vector Control. Geneva: WHO, 2022. https://www.who.int/news-room/feature-stories/detail/new-frontiers-in-vector-control [Google Scholar]
- 12.Ferguson HM, Dornhaus A, Beeche A et al. Ecology: a prerequisite for malaria elimination and eradication. PLoS Med., 2010; 7(8): e1000303. doi: 10.1371/journal.pmed.1000303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Foley DH, Klein TA, Chul KIMH et al. Geographic distribution and ecology of potential malaria vectors in the Republic of Korea. J. Med. Entomol., 2009; 46(3): 680–692. doi: 10.1603/033.046.0336. [DOI] [PubMed] [Google Scholar]
- 14.Forson AO, Hinne IA, Sraku IK et al. Larval habitat stability and productivity in two sites in Southern Ghana. Malar. J., 2023; 22(1): 74. doi: 10.1186/s12936-023-04498-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hinne IA, Attah SK, Mensah BA et al. Larval habitat diversity and Anopheles mosquito species distribution in different ecological zones in Ghana. Parasit. Vectors, 2021; 14(1): 193. doi: 10.1186/s13071-021-04701-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Akuamoah-Boateng Y, Brenyah R, Abankwa Kwarteng S et al. Malaria transmission, vector diversity, and insecticide resistance at a peri-urban site in the forest zone of Ghana. Front. Trop. Dis., 2021; 2: 739771. doi: 10.3389/fitd.2021.739771. [DOI] [Google Scholar]
- 17.Appawu MA, Baffoe-Wilmot A, Afari EA et al. Malaria vector studies in two ecological zones in southern Ghana. Afr. Entomol., 2001; 9(1): 59–65. https://hdl.handle.net/10520/EJC29847 [Google Scholar]
- 18.Forson AO, Hinne IA, Dhikrullahi SB et al. The resting behavior of malaria vectors in different ecological zones of Ghana and its implications for vector control. Parasit. Vectors, 2022; 15(1): 246. doi: 10.1186/s13071-022-05355-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Russell TL, Govella NJ, Azizi S et al. Increased proportions of outdoor feeding among residual malaria vector populations following increased use of insecticide-treated nets in rural Tanzania. Malar. J., 2011; 10(1): 1–10. doi: 10.1186/1475-2875-10-80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Mwangangi JM, Mbogo CM, Orindi BO et al. Shifts in malaria vector species composition and transmission dynamics along the Kenyan coast over the past 20 years. Malar. J., 2013; 12(1): 1–9. doi: 10.1186/1475-2875-12-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kelly-Hope LA, Hemingway J, McKenzie FE. Environmental factors associated with the malaria vectors Anopheles gambiae and Anopheles funestus in Kenya. Malar. J., 2009; 8: 268. doi: 10.1186/1475-2875-8-268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Akuoko OK, Dhikrullahi SB, Hinne IA et al. Biting behaviour, spatio-temporal dynamics, and the insecticide resistance status of malaria vectors in different ecological zones in Ghana. Parasit. Vectors, 2024; 17(1): 16. doi: 10.1186/s13071-023-06065-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Akosah-Brempong G, Attah SK, Hinne IA et al. Infection of Plasmodium falciparum and helminths among school children in communities in Southern and Northern Ghana. BMC Infect. Dis., 2021; 21(1): 1259. doi: 10.1186/s12879-021-06972-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gillies MT, De Meillon B. The Anophelinae of Africa South of the Sahara (Ethiopian Zoogeographical Region). Johannesburg: South African Institute for Medical Research, 1968; https://www.cabidigitallibrary.org/doi/full/10.5555/19692900946. [Google Scholar]
- 25.Scott JA, Brogdon WG, Collins FH. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. Am. J. Trop. Med. Hyg., 1993; 49(4): 520–529. doi: 10.4269/ajtmh.1993.49.520. [DOI] [PubMed] [Google Scholar]
- 26.Fanello C, Santolamazza F, Della Torre A. Simultaneous identification of species and molecular forms of the Anopheles gambiae complex by PCR‐RFLP. Med. Vet. Entomol., 2002; 16(4): 461–464. doi: 10.1046/j.1365-2915.2002.00393.x. [DOI] [PubMed] [Google Scholar]
- 27.Echeverry DF, Deason NA, Makuru V et al. Fast and robust single PCR for Plasmodium sporozoite detection in mosquitoes using the cytochrome oxidase I gene. Malar. J., 2017; 16(1): 230. doi: 10.1186/s12936-017-1881-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kent R, Norris D. Identification of mammalian blood meals in mosquitoes by a multiplexed Polymerase Chain Reaction targeting Cytochrome B. Am. J. Trop. Med. Hyg., 2005; 73: 336–342. [PMC free article] [PubMed] [Google Scholar]
- 29.Hamid-Adiamoh M, Amambua-Ngwa A, Nwakanma D et al. Insecticide resistance in indoor and outdoor-resting Anopheles gambiae in Northern Ghana. Malar. J., 2020; 19(1): 314. doi: 10.1186/s12936-020-03388-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Sabtiu ARM, Sraku IK, Owusu-Asenso CM et al. Urban malaria in Accra, Ghana: transmission risk and influence of irrigated vegetable farms. BMC Infect. Dis., 2025; 25(1): 1–13. doi: 10.1186/s12879-025-11403-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kasasa S, Asoala V, Gosoniu L et al. Spatio-temporal malaria transmission patterns in Navrongo demographic surveillance site, northern Ghana. Malar. J., 2013; 12(1): 1–10. doi: 10.1186/1475-2875-12-63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Peprah NY, Mohammed W, Adu GA et al. Patient socio-demographics and clinical factors associated with malaria mortality: a case control study in the northern region of Ghana. Malar. J., 2024; 23(1): 230. doi: 10.1186/s12936-024-05038-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Nzioki I, Machani MG, Onyango SA et al. Differences in malaria vector biting behavior and changing vulnerability to malaria transmission in contrasting ecosystems of western Kenya. Parasit. Vectors, 2023; 16(1): 376. doi: 10.1186/s13071-023-05944-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Moiroux N, Gomez MB, Pennetier C et al. Changes in Anopheles funestus biting behavior following universal coverage of long-lasting insecticidal nets in Benin. J. Infect. Dis., 2012; 206(10): 1622–1629. doi: 10.1093/infdis/jis565. [DOI] [PubMed] [Google Scholar]
- 35.Kreppel KS, Viana M, Main BJ et al. Emergence of behavioural avoidance strategies of malaria vectors in areas of high LLIN coverage in Tanzania. Sci. Rep., 2020; 10(1): 14527. doi: 10.1038/s41598-020-71187-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Global Biodiversity Information Facility (GBIF) . IPT. The Integrated Publishing Toolkit. https://www.gbif.org/en/ipt
- 37.Afrane YA, Owusu-Asenso CM, Akuamoah-Boateng Y et al. Anopheles mosquitoes in different ecological zones in Ghana. Version 1.2. University of Ghana Medical School. Occurrence dataset. 2026; 10.15468/bbbncf. accessed via GBIF.org on 2026-03-04. [DOI]
- 38.Vectors of human disease series. GigaByte, 2022; doi: 10.46471/GIGABYTE_SERIES_0002. [DOI] [Google Scholar]