Abstract
Background
Vital pulp therapy has been a widely adopted for managing pulp diseases, in which the control of pulpitis progression is critical. Although the transient receptor potential ankyrin 1 (TRPA1) channel mediates pain transduction and inflammatory responses, its specific role in pyroptosis during pulpitis remains poorly understood.
Methods
Pulp inflammation was evaluated using H&E staining for group stratification. The expression and localization of TRPA1 and pyroptosis-related markers (NLRP3, cleaved caspase-1, and IL-1β) were assessed by immunohistochemistry. Additionally, qRT‒PCR and Western blotting were performed to analyse the expression levels of TRPA1 and pyroptosis markers in vitro. Mitochondrial function was evaluated by flow cytometric analysis of the mitochondrial membrane potential (ΔΨm) and calcium influx. Simultaneously, intracellular and mitochondrial reactive oxygen species (ROS) levels were measured using fluorescence staining.
Results
TRPA1 was predominantly expressed in the fibroblast-rich zone and odontoblastic layer in the dental pulp, and its expression levels were positively correlated with pulp inflammation severity. In vitro, lipopolysaccharide (LPS) stimulation significantly increased the expression of pyroptosis-related markers and induced mitochondrial dysfunction, as evidenced by ΔΨm depolarization, intracellular Ca2+ overload, and excessive reactive oxygen species (ROS) generation. Notably, the pharmacological inhibition of the TRPA1 channel markedly attenuated these pathological changes, reducing pyroptosis-related markers responses and ameliorating mitochondrial impairment in human dental pulp cells (hDPCs).
Conclusion
During pulpitis, the expression of the TRPA1 channel was positively correlated with the severity of inflammation and pyroptosis-associated molecular signalling in dental pulp tissue. These findings suggest that TRPA1 may mediate mitochondrial damage through calcium ion influx, subsequently promoting cell pyroptosis in the context of pulpitis. These findings highlight a potential link between TRPA1 activation and mitochondrial dysfunction, warranting further investigation into the underlying mechanisms .
Supplementary Information
The online version contains supplementary material available at 10.1186/s12903-026-08006-1.
Keywords: Pulpitis, TRPA1 channel, Pyroptosis, Mitochondrial dysfunction, Calcium influx, Reactive oxygen species (ROS)
Introduction
Dental caries-induced pulpitis is a common condition that significantly affects oral health. With advances in minimally invasive dentistry, treatment strategies are shifting from traditional pulpectomy to preserving inflamed but vital pulp tissue [1]. Successful pulp preservation depends on controlling inflammation and enhancing the self-repair capacity of tissue, with inflammation inhibition being a key step.
The occurrence and development of pulp inflammation involve complex signalling networks. The TRPA1 channel, a key nonselective cation channel and cellular stress sensor, is widely distributed in dental pulp sensory neurons, odontoblasts, and fibroblasts [2], with its expression markedly upregulated in sensory neurons following pulp inflammation [3]. TRPA1 can be activated by a range of external stimuli, such as cold and bacterial products, and internal inflammatory factors, contributing to the mediation of pulp inflammatory pain [4, 5]. More importantly, activating TRPA1 in nonneuronal pulp cells may initiate the release of inflammatory cytokines, including IL-6 and IL-8, ATP, and neuropeptides, which not only directly participate in local inflammatory responses but also promote the development of neurogenic inflammation [6]. Oxidative stress can also effectively activate TRPA1 in human dental pulp, further exacerbating the inflammatory response [7]. However, the specific role and mechanism of TRPA1 in pulpitis remain unclear.
Pathogenic microbial infection [8] is the primary cause of pulpitis. Bacterial components such as lipopolysaccharide (LPS) not only trigger inflammatory responses but also induce programmed cell death in pulp cells [9]. In addition to classical apoptosis, pyroptosis, which is mediated by caspase-1 and involves inflammatory lytic cell death, is increasingly implicated in pulpitis pathophysiology. Studies have reported that the expression of key pyroptotic markers, including the NLRP3 inflammasome and activated caspase-1, are significantly upregulated in inflamed pulp tissue [10]. The NLRP3 inflammasome forms and activates caspase-1 in response to stimulation by pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs). This process culminated in the cleavage of gasdermin D (GSDMD), which forms pores in the plasma membrane, leading to the release of intracellular contents (including mature IL-1β and IL-18) and triggering a potent inflammatory cascade [11]. The increase in the severity of inflammation and tissue damage induced by pyroptosis plays a vital role in the shift from reversible inflammation to irreversible inflammation and necrosis in pulp tissue.
As a central cellular signalling platform, mitochondria are critically integral to pulpitis pathogenesis through their regulation of multiple cell death pathways [12]. Notably, mitochondrial reactive oxygen species (mtROS), which arise from mitochondrial damage, are involved in the canonical pyroptotic pathway [13]. Moreover, mitochondria are essential for orchestrating intracellular calcium homeostasis, and calcium overload can result in mitochondrial membrane depolarization and functional impairment [14]. In pulpitis models, bacterial stimulation-induced mitochondrial damage triggers a mtROS burst, which not only activates the NLRP3/caspase-1/GSDMD signalling axis but also aggravates mitochondrial membrane depolarization through a calcium overload–ROS positive feedback loop [13].
Although studies have shown that TRPA1 knockout influences macrophage polarization and pyroptosis in models of dilated cardiomyopathy, related research in the context of pulpitis remains limited [15], and whether TRPA1 is involved in mitochondrial dysfunction and pyroptosis in pulpitis remains unclear. In this study, the role of the TRPA1 channel expressed on dental pulp cell membranes in pyroptosis-associated molecular signalling during pulpitis progression and the proposed underlying mechanisms were explored.
Materials and methods
Pretreatment of human pulp tissue
All the dental pulp samples used in this study were obtained from patients who provided written informed consent. Pulp tissue was collected from orthodontically extracted teeth that were clinically diagnosed as healthy, with deep caries or with pulpitis. Teeth with apical periodontal lesions or pulp calcification were excluded. Pulp tissue was carefully extracted with forceps. All human dental pulp tissues used in this study were obtained from patients aged 8–18 years with ethical approval from the Ethics Committee for Medicine at Shenzhen Children’s Hospital (Ethical Review No. Research 202300702).
Inclusion and exclusion criteria
Inclusion criteria.
Orthodontic extracted teeth with healthy dental hard tissues;
Orthodontic extracted teeth clinically diagnosed with deep caries.
Orthodontic extracted teeth clinically diagnosed with pulpitis.
Exclusion criteria.
Orthodontic extracted teeth clinically diagnosed with periapical periodontitis;
Orthodontic extracted teeth with pulp calcification.
Histological and immunohistochemical staining
Pulp tissues from healthy teeth, teeth with deep cavities, and teeth with pulpitis were preserved in 4% paraformaldehyde, embedded in paraffin, and sliced into 5 μm-thick sections. These sections were then deparaffinized, rehydrated, and stained with HE. Inflammatory cell distribution was examined microscopically. On the basis of pathological features, the tissues were classified as healthy, initial pulpitis, or severe pulpitis.
For immunohistochemical staining, sections were microwaved at 100 °C for 5 min, cooled for another 5 min, and then incubated at low heat for 10 min in citrate and EDTA buffers (pH 9.0) for antigen retrieval. After blocking in 3% BSA(GC305010, Servicebio, China) (30 min, room temperature), the sections were incubated overnight at 4 °C with primary antibodies targeting TRPA1 (rabbit anti-human, 1:50, A17095; Cambridge, UK), NLRP3 (1:200, A9840; Cambridge, UK), cleaved caspase-1 (1:50, A36050; Cambridge, UK), and cleaved IL-1β (1:100, A94474; Cambridge, UK). Secondary antibody (1:200, GB23303; Servicebio, China) staining was performed, and expression of TRPA1, NLRP3, cleaved caspase-1, and cleaved IL-1β was visualized microscopically and quantified using ImageJ software(National Institutes of Health, Bethesda, MD, USA).
hDPCs culturing and treatment
hDPCs were obtained from patients aged 8–18 years with clinically healthy teeth requiring orthodontic treatment. The extracted pulp tissue was minced and digested with 3 mg/mL collagenase type I (Gibco, USA) and 4 mg/mL Dispase II (Roche, Switzerland) for 30 min and then cultured in modified α-MEM (BasalMedia, China) supplemented with 20% foetal bovine serum (FBS; Ausgenex, Australia) and 1% penicillin–streptomycin (BasalMedia, China) at 37 °C in a 5% CO₂ incubator. hDPCs were passaged with trypsin (BasalMedia, China) upon reaching 80% confluence, and hDPCs at passage 4 were used for subsequent experiments.
hDPCs were seeded into 6-well plates at a density of 0.3 × 106 cells per well in 10% FBS-αMEM medium and cultured for 3 days. Thereafter, the cells were treated by 1 µg/ml LPS(L4391, Merck, Germany)and 10 µM HC-030031 (TRPA1 channel inhibitor, ab120554, Abcam, UK), and divided into five groups. (1) Control group: hDPCs were cultured normally without treatment. (2) LPS 12 h group: hDPCs were stimulated with LPS for 12 h. (3) LPS 24 h group: hDPCs were stimulated with LPS for 24 h. (4) LPS + HC 12 h group : hDPCs were treated with (LPS + HC-030031) for 12 h.(5) LPS + HC 24 h group: hDPCs were treated with (LPS + HC-030031) for 24 h.
Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
The mRNA expression of TRPA1, caspase-1, IL-1β,IL-6,IL-8 and NLRP3 was assessed in pulp cells isolated from each experimental subgroup. Total RNA was extracted using Trizol (Thermo, USA) and reverse-transcribed to cDNA with a SweScript All-in-One RT SuperMix for qPCR(G3337,Servicebio, China). A total of 40 cycles of PCR were performed using a cycling protocol of 95 °C for denaturation and 60 °C for extension with fluorescence quantitative PCR Instrument(CFX Connect, Bio-rad, USA). Relative gene expression was quantified using the comparative threshold cycle Cq (2‑ΔΔCq) method. Three replicate experiments were conducted in parallel for each group. The primer sequences are provided in Table 1.
Table 1.
Primer sequences
| Gene | Primers |
|---|---|
| TRPA1 |
Forward:5’- CAATGCTGACATAGTCCTGAACAAG Reverse:5’- ACATTCATCCCATCTTTTGCTCC |
| Caspase-1 |
Forward:5’- AGAAACACTCTGAGCAAGTCCCA Reverse:5’- ATCCTTCTCTATGTGGGCTTTCTTA |
| NLRP3 |
Forward:5’-GCGATCAACAGGAGAGACCTT Reverse:5’- TCCACTCCTCTTCAATGCTGT |
| IL-1β |
Forward:5’- TACCTGTCCTGCGTGTTGAAA Reverse:5’- GGTGCTGATGTACCAGTTGGG |
| β-actin |
Forward:5’- CACCCAGCACAATGAAGATCAAGAT Reverse:5’- CCAGTTTTTAAATCCTGAGTCAAGC |
| IL-6 |
Forward:5’- TCAGCCCTGAGAAAGGAGACAT Reverse:5’- GCTCTGGCTTGTTCCTCACTACT |
| IL-8 |
Forward:5’- ACTGAGAGTGATTGAGAGTGGAC Reverse:5’- AACCCTCTGCACCCAGTTTTC |
Western blot analysis
Total protein was extracted from pulp tissue. A 5% concentrated gel was prepared with 30% acrylamide, 1.5 M Tris-HCl (pH 8.8), and 10% SDS. The samples were electrophoresed and a membrane transfer. Following blocking with 5% skim milk, the membrane was incubated overnight at 4 °C with diluted primary antibodies targeting NLRP3 (1:1000; A9840; Antibodies.com, Cambridge, UK), cleaved caspase-1 (1:1000; A36050; Antibodies.com, Cambridge, UK), and cleaved IL-1β (1:1000; A94474; Antibodies.com, Cambridge, UK) after the sealing solution was removed. After being washed with TBST, the membrane was incubated with HRP-conjugated anti-rabbit IgG (1:3000; UElandy, China) for 30 min at 37 °C and visualized using chemiluminescence with an enhanced chemiluminescence (ECL) kit (Servicebio, China). The integrated density values were determined using AIWBwell (Servicebio, China), and the relative protein intensity was quantified against that of β-actin.
Immunofluorescence
2’,7’-Dichlorofluorescin diacetate (DCFH-DA) staining (Beyotime, China) was used to evaluate the intracellular superoxide anion level and the amount of a variety of ROS. HDPCs were cultured in normal or inflammatory microenvironments induced by 1 µg/ml LPS and 10 µM HC-030031 for 24 h. The cells were loaded with DCFH-DA (1:1000) for 30 min in the dark. After being washed with PBS, Hoechst (Solarbio, China) was used for nuclear staining, and after a 20- to 30-minute incubation period, the cells were gently washed twice with PBS. The samples were visualized under a fluorescence microscope (Olympus IX51, Japan), and the relative fluorescence intensity of DCFH-DA was quantified using ImageJ software.
Mitochondrial ROS activity was assessed using MitoSOX Red (Thermofisher, USA), a redox-sensitive fluorescent probe that specifically localized to mitochondria. Cells were seeded in 96-well black plates at a density of 5 × 104/ml in each group. The cells were incubated with MitoSOX Red working solutions for 30 min at 37 °C. After being washed twice with PBS, the hDPCs were counterstained with DAPI for 20 min. Fluorescence imaging was subsequently performed to visualize and document the stained cells (Olympus, Japan).
Flow cytometry
The mitochondrial membrane potential was assessed using a JC-1 assay kit (Beyotime, China). Following the digestion and resuspension of pulp cells, 0.5 mL of JC-1 staining solution was added, followed by a 20-minute incubation at 37 °C under light-free conditions. The cells were then centrifuged at 4 °C for 5 min, after which the resulting pellet was washed and reconstituted in JC-1 staining buffer. The results were quantified using a CytoFLEX flow cytometer (Beckman, USA).
The cells were stained for calcium using the fluorescent dye Fluo-4AM (Beyotime, China). Cells were loaded with fluo-4AM (1 ml) at 37 °C for 30 min in the absence of light. After centrifugation, the cell pellet was resuspended in 0.5 mL of assay buffer and subsequently analysed using a CytoFLEX flow cytometer (Beckman, USA).
Statistical analysis
The values represent the mean ± standard deviation (SD) of at least three independent biological replicates. All the statistical analyses and graphical representations were conducted by employing GraphPad Prism V9. Student’s t-test was used for comparisons between two groups. Two-way analysis of variance was applied for comparisons involving two independent variables, with significance denoted as P < 0.05.
Results
Expression of TRPA1 in pulp tissue
HE staining revealed that the healthy pulp tissue primarily consisted of loose connective tissue with small blood vessels (Fig. 1A). The pathological characteristics of pulp tissue from teeth with deep caries included vascular dilation and mild inflammatory cell infiltration, and was classified as initial pulpitis. (Fig. 1D). Pulp tissue from teeth with pulpitis showed a significant increase in inflammatory cell density and was classified as severe pulpitis (Fig. 1G). Immunohistochemical (IHC) analysis demonstrated that TRPA1 was minimally expressed in the fibroblast-rich zone and odontoblastic layer from healthy pulp (Fig. 1B, C). Compared with that in healthy tissue, TRPA1 expression in initial pulpitis tissue was higher in perivascular regions and the fibroblast-rich zone (Fig. 1E, F). In severe pulpitis tissue, TRPA1 expression was markedly elevated in inflammatory cell-dense regions and in the odontoblastic layer (Fig. 1H, I). Quantitative analysis of IHC staining confirmed a statistically significant increase in positive TRPA1 expression (Fig S1).
Fig. 1.
Expression of TRPA1 in pulp tissue. A HE staining of healthy pulp tissue showing loose connective tissue. B, C IHC staining: TRPA1 was minimally expressed in the fibroblast-rich zone and odontoblastic layer. D HE staining of initial pulpitis tissue showing vascular dilation. E, F IHC staining revealed that TRPA1 expression increased in perivascular regions and the fibroblast-rich zone in initial pulpitis tissue. G HE staining of severe pulpitis tissue showing dense inflammatory cell infiltration. H, I IHC staining revealed that TRPA1 expression was significantly elevated in inflammatory cell-dense regions and the odontoblastic layer in severe pulpitis. Nuclear staining (blue) and positive TRPA1 expression (brown–yellow); red arrows indicate TRPA1 localization; scale bar: 50 μm
Expression of pyroptosis-related factors in pulp tissue
NLRP3, cleaved IL-1β, and cleaved caspase-1, which are key pyroptosis-related factors, were examined by IHC. In healthy pulp tissue, only minimal expression was detected in the fibroblast-rich zone and perivascular regions (Fig. 2A-C). In initial pulpitis tissue, these markers were positively expressed and were detected mainly in the fibroblast-rich zone and perivascular regions (Fig. 2D-F). In severe pulpitis tissue, the expression of these genes markedly increased and was predominantly distributed in regions with dense inflammatory cell infiltration (Fig. 2G-I). Quantitative analysis confirmed that the expression of pyroptosis-related markers significantly increased with increasing disease severity (Fig S2).
Fig. 2.
Expression of pyroptosis factors in pulp tissue. NLRP3, cleaved IL-1β, and cleaved caspase-1 are representative pyroptosis factors. A–C Healthy pulp tissue exhibiting minimal expression of pyroptosis factors. D–F Initial pulpitis exhibiting increased pyroptosis factor expression. G-I Severe pulpitis is characterized by a marked increase in the expression of pyroptosis factors. Expression colocalized with inflammatory cell infiltration. Nuclear staining (blue), NLRP3, cleaved IL-1β and cleaved caspase-1 expression (brown–yellow); blue arrows indicate pyroptosis factor localization; scale bar: 50 μm
LPS-induced upregulation of TRPA1 expression in hDPCs
Primary hDPCs were isolated from healthy pulp tissue and expanded in culture for subsequent experiments. qRT-PCR demonstrated that compared with that in the control group, TRPA1 mRNA expression in the TRPA1 inhibitor HC-030031 group was significantly upregulated at 12 and 24 h after LPS stimulation but markedly reduced following treatment with the TRPA1 inhibitor HC-030031 (P < 0.05) (Fig. 3A). Similarly, IL-6 and IL-8 mRNA levels were significantly increased by LPS stimulation but significantly decreased by TRPA1 inhibition (P < 0.05) (Fig. 3B, C).
Fig. 3.
mRNA expression levels of TRPA1, IL-6, and IL-8 in hDPCs. A Compared with the control treatment, LPS treatment increased the TRPA1 mRNA level, which was decreased by HC-030031. B Compared with the control treatment, LPS treatment increased the IL-6 mRNA level, which was decreased by HC-030031. C Compared with the control treatment, LPS treatment increased the IL-8 mRNA level, which was decreased by HC-030031. The data are presented as the mean ± SD (n = 3 represents three independent preparations of hDPCs derived from different dental pulp tissues.). *P < 0.05; ***P < 0.001;and ****P < 0.0001
HC-030031 suppresses pyroptosis-related factor expression in hDPCs.
qRT‒PCR analysis revealed that compared with the control treatment, LPS stimulation significantly upregulated NLRP3 mRNA expression (P < 0.05), whereas treatment with HC-030031 significantly attenuated its expression at 24 h (P < 0.05) (Fig. 4Aa). IL-1β mRNA expression was higher at both 12 and 24 h after LPS stimulation compared with that in the control group (P < 0.05); however, compared with LPS treatment, HC-030031 treatment did not result in significant inhibition (Fig. 4Ab). Caspase-1 mRNA expression decreased at 12 h after LPS stimulation compared with that in the control group (P < 0.05) but slightly increased at 24 h and was significantly lower in the HC-030031 treatment group than in the LPS group (P < 0.05) (Fig. 4Ac).
Fig. 4.
mRNA and protein expression levels of pyroptosis factors in hDPCs. A (a) LPS significantly increased NLRP3 expression in dental pulp cells at 12 and 24 h, whereas HC‑030031 significantly reduced NLRP3 expression at 24 h. (b) LPS elevated IL‑1β mRNA expression at 12 and 24 h, but this effect was not significantly inhibited by HC‑030031. (c) LPS decreased caspase‑1 mRNA expression at 12 h but slightly increased it at 24 h; HC‑030031 significantly reduced caspase‑1 mRNA expression at 24 h. B (a) LPS upregulated the protein expression of TRPA1 and pyroptosis‑related factors at 24 h, which was attenuated by HC‑030031. (b) Relative protein expression was quantified using ImageJ. The data are presented as the mean ± SD (n = 3 represents three independent preparations of hDPCs derived from different dental pulp tissues.). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; and ns, no significant difference
Western blot analysis revealed marked increases in the protein levels of TRPA1, NLRP3, cleaved caspase-1, and cleaved IL-1β after 24 h of LPS stimulation. The administration of the TRPA1 antagonist HC-030031 attenuated the expression of those proteins, albeit with levels remaining higher relative to those in the control group (Fig. 4B).
Effect of TRPA1 on the mitochondrial membrane potential in hDPCs.
Flow cytometry analysis using a JC-1 probe revealed a high mitochondrial membrane potential in control cells (Fig. 5A, D). Compared with the control treatment, LPS stimulation for 12 and 24 h induced significant mitochondrial depolarization (P < 0.05) (Fig. 5B, E, G), which was partially reversed by treatment with HC-030031 (P < 0.05) (Fig. 5C, F, G). Additionally, compared with the control treatment, the LPS treatment markedly increased calcium influx (P < 0.05), which was significantly attenuated by TRPA1 inhibition (P < 0.05) (Fig. 6A, B, C, D).
Fig. 5.
The mitochondrial membrane potential (ΔΨm) in hDPCs. The JC-1 probe was selected as the mitochondrial membrane potential indicator. A,D The ΔΨm of most normal hDPCs in the control group was greater at 12 and 24 h. B, E Compared with the control treatment, LPS stimulation reduced the ΔΨm in hDPCs at 12 and 24 h. C, F Compared with LPS, HC-030031 increased the ΔΨm at 12 and 24 h. G Quantitative analysis of the flow cytometry results. The data are presented as the mean ± SEM (n = 3 represents three independent preparations of hDPCs derived from different dental pulp tissues). ****P < 0.0001
Fig. 6.
The intracellular calcium ion concentration in hDPCs. A Fluo-4 AM calcium probe was selected for intracellular calcium level detection via flow cytometry analysis. A Calcium content in hDPCs. B Calcium influx in hDPCs increased after 24 h of LPS stimulation compared with that in the control group. C Compared with LPS, HC-030031 reduced calcium influx. D Quantitative analysis of the flow cytometry results. The data are presented as the mean ± SD (n = 3 represents three independent preparations of hDPCs derived from different dental pulp tissues). ****P < 0.0001
3.6 HC-030031 Reduced Mitochondrial ROS in hDPCs.
Immunofluorescence staining revealed low levels of total cellular ROS and mtROS in hDPCs (Fig. 7A, D). Compared with LPS alone, LPS stimulation significantly increased the levels of both types of ROS (P < 0.0001) (Fig. 7B, E), whereas treatment with HC-030031 effectively decreased these levels. (P < 0.001;P < 0.001) (Fig. 7C, F) (Fig S3).
Fig. 7.
Immunofluorescence analysis of ROS and mitochondrial ROS in hDPCs. Total cellular ROS exhibited green fluorescence, while mitochondrial ROS displayed red fluorescence. Immunofluorescence staining results. A Fluorescence intensity of ROS in hDPCs. B Compared with the control treatment, LPS stimulation increased the ROS fluorescence intensity in hDPCs at 24 h. C Compared with LPS, HC-030031 reduced the ROS fluorescence intensity in hDPCs at 24 h. D Fluorescence intensity of mtROS in hDPCs. E Compared with the control treatment, LPS stimulation increased mtROS fluorescence intensity in hDPCs at 24 h. F Compared with LPS, HC-030031 reduced mtROS fluorescence intensity in hDPCs at 24 h
Discussion
The pathogenesis of pulpitis is often accompanied by multiple forms of cell death, among which pyroptosis—inflammatory, caspase-mediated lytic cell death—is particularly notable; it is closely associated with inflammation and is primarily mediated through canonical and noncanonical pathways [16–18]. In this study, the involvement of the TRPA1 channel in pyroptosis-associated molecular signalling during pulpitis was explored in an in vitro inflammatory hDPC model.
Functionally, TRPA1 acts as a molecular sensor of bacterial components, such as LPS, mediating Ca²⁺ influx and thereby triggering downstream signalling pathways [19, 20]. Our findings suggest that TRPA1 acts as a dynamic sensor within the inflamed pulpal microenvironment, and the expression of TRPA1 increases as the disease progresses, from localized expression in mild pulpitis to widespread overexpression in severe cases, with pronounced enrichment in areas of inflammatory cell infiltration. Further experimental evidence indicated that TRPA1 inhibition significantly decreased the mRNA levels of proinflammatory cytokines, including IL-6 and IL-8, in inflammatory hDPCs in vitro, suggesting that TRPA1 contributes to the amplification of inflammatory responses in pulpitis.
In the present study, pyroptotic markers, including cleaved IL-1β, cleaved caspase-1, and NLRP3, were constitutively expressed at low physiological levels in healthy pulp tissues. The expression of cleaved IL-1β, cleaved caspase-1, and NLRP3 was significantly upregulated in pulpitis tissues, which was correlated with increasing pathological severity, particularly in fibroblast-rich areas and regions of inflammatory cell infiltration, suggesting that pyroptosis might be triggered in pulpitis tissues. NLRP3 is constitutively expressed in odontoblasts, fibroblasts, and vascular endothelial cells within healthy dental pulp; however, basal expression does not indicate activation, the detection of cleaved caspase-1 confirms NLRP3 activation [21, 22]. Consistent with the findings of Jiang et al. [10], who reported the downregulation of caspase-1 expression in reversible pulpitis, the present study revealed a reduction in caspase-1 mRNA expression following 12 h of LPS stimulation. In contrast, 24 h of stimulation induced a slight increase in caspase-1 mRNA expression, suggesting that the regulatory mechanisms of caspase-1 might differ between the early and advanced stages of pulpitis. Although the mRNA level of caspase-1 increased only slightly, the abundance of cleaved caspase-1 protein was significantly elevated. This discrepancy suggests that pyroptotic activation in an in vitro pulpitis model may rely predominantly on the post translational cleavage of the pro-enzyme, rather than the transcriptional upregulation of caspase-1. Such uncoupling between gene transcription and protein activation might highlight the critical role of post-translational regulatory events in the execution of pyroptosis within inflammatory dental pulp conditions.
TRPA1 has been reported to be involved in pyroptosis through diverse mechanisms. In airway inflammatory diseases, TRPA1 has been shown to activate NLRP3 through a redox-sensitive mechanism, leading to caspase-1 cleavage, GSDMD pore formation, and subsequent maturation and release of IL-1β and IL-18. Moreover, IL-1β may further activate TRPA1 via autocrine/paracrine signalling, establishing a “TRPA1–NLRP3–inflammatory mediators–TRPA1” positive feedback loop [23]. These findings suggest that a similar mechanism might underlie TRPA1-mediated pyroptosis in pulpitis. In this study, both the mRNA and protein expression of the pyroptotic factor NLRP3 increased following 24 h of LPS stimulation of hDPCs, and congruent expression patterns were observed for TRPA1 and NLRP3. HC-030031 decreased the increase in pyroptotic factor levels in LPS-treated hDPCs, suggesting that upregulation of TRPA1 expression may promote pyroptosis-associated molecular signalling in hDPCs. Notably, TRPA1 inhibition reduced the level of the cleaved IL-1β protein despite a mild increase in the level of the IL-1β mRNA, suggesting that TRPA1 primarily modulates the function of IL-1β through protein cleavage rather than transcriptional activation. In summary, these findings suggest that TRPA1 may facilitate pyroptosis-associated molecular signalling in inflamed hDPCs by positively regulating inflammatory responses.
Biological stimuli can reduce the ΔΨm and compromise mitochondrial integrity, leading to the release of DAMPs that activate inflammatory pathways. In the present study, the LPS stimulation of pulpal cells induced mitochondrial depolarization, as evidenced by decreased ΔΨm and increased total intracellular ROS and mtROS levels, indicating a state of oxidative stress. In inflamed pulpal tissues, elevated levels of ROS, an oxidative stress marker, are positively correlated with upregulated TRPA1 expression in hDPCs [24], suggesting that the ROS–TRPA1–inflammasome axis may contribute to the pathogenesis of pulpitis. Furthermore, dysregulated intracellular calcium homeostasis has been identified as a key driver of mitochondrial damage [25]. TRPA1 exhibits high Ca²⁺ selectivity, and its Ca²⁺-dependent regulatory mode has been validated in various models of tissue injury [20], suggesting that TRPA1, as a receptor-operated channel, may function through Ca²⁺ release from intracellular stores. In the present study, the treatment of LPS-induced inflamed hDPCs with 10 µM HC-030031 reduced Ca²⁺ influx and alleviated mitochondrial depolarization, suggesting that TRPA1 inhibition may protect against mitochondrial damage by limiting Ca²⁺ entry. Consistent with these findings, a recent study by Kunka et al. [24] reported that both TRPA1 gene silencing and pharmacological inhibition attenuated mitochondrial damage in inflamed pulp, supporting the results observed in the current study.
This study had several limitations. Samples from patients aged 8–18 years were included, and only three independent biological replicates were used for in vitro experiments. In addition, in vivo studies were not performed in the study. Future studies employing TRPA1 gene knockdown and in vivo pulpitis models are therefore warranted to confirm the specific role and translational potential of TRPA1 in pulpitis.
Conclusion
In summary, the results of the present study suggested that TRPA1 might contribute to pyroptosis-associated molecular signalling in inflamed hDPCs by modulating inflammatory responses and mitochondrial function. TRPA1 inhibition attenuated caspase-1 activation, IL-1β maturation, and mitochondrial depolarization, indicating a potential role for TRPA1 in regulating pulpitis-associated inflammatory processes. However, the precise mechanisms underlying TRPA1-mediated pyroptosis remain to be further elucidated and warrant additional investigation.
Supplementary Information
Acknowledgements
Not applicable.
Abbreviations
- TRPA1
Transient receptor potential ankyrin 1
- ΔΨm
Mitochondrial membrane potential
- ROS
Reactive oxygen species
- LPS
Lipopolysaccharide
- hDPCs
Human dental pulp cells
- PAMPs
Pathogen-associated molecular patterns
- DAMPs
Damage-associated molecular patterns
- mtROS
Mitochondrial reactive oxygen specie
Authors’ contributions
SH, HC and CC conceptualize the project. SH and HC performed the experiments. SH, HC, QZ, XL, GY, GD and CC evaluated data. SH and HC wrote this article. QZ, XL and CC confirm and organize data. SH, HC, QZ, XL, GY, GD and CC edited the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by National Science Foundation of Shenzhen, grant number JCYJ20220530155816038 and Guangdong High-level Hospital Construction Fund (Phase II Project, Science and Education Department of Shenzhen Children′s Hospital [2023] No.7).
Data availability
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
This experiment was approved from the Medical Ethics Committee of Shenzhen Children’s Hospital (Ethical Review No. Research 202300702) and the conduct of this study complied with the Declaration of Helsinki. All dental pulp samples used in this study were obtained from patients who provided written informed consent .
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Sixue Huang and Huihui Chang contributed equally to this work.
References
- 1.Ather A, Patel B, Gelfond JAL, Ruparel NB. Outcome of pulpotomy in permanent teeth with irreversible pulpitis: a systematic review and meta-analysis. Sci Rep. 2022;12(1):19664. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Morii A, Miyamura Y, Sago MI, Mizuhara M, Shikayama T, Naniwa M, Hitomi S, Ujihara I, Kuroishi KN, Gunjigake KK, et al. Orthodontic force-induced oxidative stress in the periodontal tissue and dental pulp elicits nociception via activation/sensitization of TRPA1 on nociceptive fibers. Free Radic Biol Med. 2020;147:175–86. [DOI] [PubMed] [Google Scholar]
- 3.Shi L, Lin Y, Jiao Y, Herr SA, Tang J, Rogers E, Chen Z, Shi R. Acrolein scavenger dimercaprol offers neuroprotection in an animal model of Parkinson’s disease: implication of acrolein and TRPA1. Translational neurodegeneration. 2021;10(1):13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Liu J, Que K, Liu Y, Zang C, Wen J. Tumor Necrosis Factor-α Regulates the TRPA1 Expression in Human Odontoblast-Like Cells. J Pain Res. 2020;13:1655–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Takayama Y, Tominaga M. Interaction between TRP channels and anoctamins. Cell Calcium. 2024;121:102912. [DOI] [PubMed] [Google Scholar]
- 6.Kiss F, Kormos V, Szőke É, Kecskés A, Tóth N, Steib A, Szállási Á, Scheich B, Gaszner B, Kun J et al. Functional Transient Receptor Potential Ankyrin 1 and Vanilloid 1 Ion Channels Are Overexpressed in Human Oral Squamous Cell Carcinoma. Int J Mol Sci. 2022;23(3):1921. [DOI] [PMC free article] [PubMed]
- 7.Orimoto A, Kitamura C, Ono K. 2-hydroxyethyl methacrylate-derived reactive oxygen species stimulate ATP release via TRPA1 in human dental pulp cells. Sci Rep. 2022;12(1):12343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ning Y, Ramachandra SS, Bennett N, Ivanovski S, Han P. Salivary large extracellular vesicle associated bacterial DNA reflects periodontal disease status and non-surgical periodontal therapy response. Dent Res. 2026;1(1):100006. [Google Scholar]
- 9.Galler KM, Weber M, Korkmaz Y, Widbiller M, Feuerer M. Inflammatory Response Mechanisms of the Dentine-Pulp Complex and the Periapical Tissues. Int J Mol Sci. 2021;22(3):1480. [DOI] [PMC free article] [PubMed]
- 10.Jiang W, Lv H, Wang H, Wang D, Sun S, Jia Q, Wang P, Song B, Ni L. Activation of the NLRP3/caspase-1 inflammasome in human dental pulp tissue and human dental pulp fibroblasts. Cell Tissue Res. 2015;361(2):541–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Akther M, Haque ME, Park J, Kang TB, Lee KH. NLRP3 Ubiquitination-A New Approach to Target NLRP3 Inflammasome Activation. Int J Mol Sci. 2021;22(16):8780. [DOI] [PMC free article] [PubMed]
- 12.Picca A, Calvani R, Coelho-Junior HJ, Marzetti E. Cell Death and Inflammation: The Role of Mitochondria in Health and Disease. Cells. 2021;10(3):537. [DOI] [PMC free article] [PubMed]
- 13.Wang M, Zhao M, Zheng Z, Pan W, Zhang J, Yin Z, Wei C, Xu Y, Wan J. TRPA1 deficiency aggravates dilated cardiomyopathy by promoting S100A8 expression to induce M1 macrophage polarization in rats. FASEB journal: official publication Federation Am Soc Experimental Biology. 2023;37(6):e22982. [DOI] [PubMed] [Google Scholar]
- 14.Zargar N, Ashraf H, Marashi SMA, Sabeti M, Aziz A. Identification of microorganisms in irreversible pulpitis and primary endodontic infections with respect to clinical and radiographic findings. Clin Oral Invest. 2020;24(6):2099–108. [DOI] [PubMed] [Google Scholar]
- 15.Wang J, Qiao J, Ma L, Li X, Wei C, Tian X, Liu K. Identification of the characteristics of infiltrating immune cells in pulpitis and its potential molecular regulation mechanism by bioinformatics method. BMC Oral Health. 2023;23(1):287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chen KW, Demarco B, Heilig R, Shkarina K, Boettcher A, Farady CJ, Pelczar P, Broz P. Extrinsic and intrinsic apoptosis activate pannexin-1 to drive NLRP3 inflammasome assembly. EMBO J. 2019;38(10):e101638. [DOI] [PMC free article] [PubMed]
- 17.Angosto D, López-Castejón G, López-Muñoz A, Sepulcre MP, Arizcun M, Meseguer J, Mulero V. Evolution of inflammasome functions in vertebrates: Inflammasome and caspase-1 trigger fish macrophage cell death but are dispensable for the processing of IL-1β. Innate Immun. 2012;18(6):815–24. [DOI] [PubMed] [Google Scholar]
- 18.Pezuk P JA. Pyroptosis in combinatorial treatment to improve cancer patients’ outcome, is that what we want? EBioMedicine. 2019;41:17–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kim YS, Jung HK, Kwon TK, Kim CS, Cho JH, Ahn DK, Bae YC. Expression of transient receptor potential ankyrin 1 in human dental pulp. J Endod. 2012;38(8):1087–92. [DOI] [PubMed] [Google Scholar]
- 20.Zhao J, Lin King JV, Paulsen CE, Cheng Y, Julius D. Irritant-evoked activation and calcium modulation of the TRPA1 receptor. Nature. 2020;585(7823):141–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Bauernfeind FG, Horvath G, Stutz A, Alnemri ES, MacDonald K, Speert D, Fernandes-Alnemri T, Wu J, Monks BG, Fitzgerald KA, et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J Immunol (Baltimore Md: 1950). 2009;183(2):787–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lee SI, Kang SK, Jung HJ, Chun YH, Kwon YD, Kim EC. Muramyl dipeptide activates human beta defensin 2 and pro-inflammatory mediators through Toll-like receptors and NLRP3 inflammasomes in human dental pulp cells. Clin Oral Invest. 2015;19(6):1419–28. [DOI] [PubMed] [Google Scholar]
- 23.Wang M, Zhang Y, Xu M, Zhang H, Chen Y, Chung KF, Adcock IM, Li F. Roles of TRPA1 and TRPV1 in cigarette smoke -induced airway epithelial cell injury model. Free Radic Biol Med. 2019;134:229–38. [DOI] [PubMed] [Google Scholar]
- 24.Kunka Á, Lisztes E, Bohács J, Racskó M, Kelemen B, Kovalecz G, Tóth ED, Hegedűs C, Bágyi K, Marincsák R, et al. TRPA1 up-regulation mediates oxidative stress in a pulpitis model in vitro. Br J Pharmacol. 2024;181(17):3246–62. [DOI] [PubMed] [Google Scholar]
- 25.Bravo-Sagua R, Parra V, López-Crisosto C, Díaz P, Quest AF, Lavandero S. Calcium Transport and Signaling in Mitochondria. Compr Physiol. 2017;7(2):623–34. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.