Skip to main content
BMC Cardiovascular Disorders logoLink to BMC Cardiovascular Disorders
. 2026 Mar 31;26:301. doi: 10.1186/s12872-026-05732-w

Secretory products from regulatory macrophages modulate senescence in human endothelial cells: implications for cardiovascular aging and diseases

Katharina Delfs 1,#, Rouven Berndt 2, Katharina Hess 3, Christine Eimer 1, Fred Fändrich 4, Markus Steinfath 1, Karina Zitta 1,#, Martin Albrecht 1,✉,#
PMCID: PMC13063746  PMID: 41917842

Abstract

Background

Cardiovascular diseases (CVDs) are the leading cause of mortality worldwide and primarily affect older individuals, making CVDs a central concern in age-related and geriatric medicine. Senescent endothelial cells contribute to a pro-inflammatory environment that exacerbates cardiovascular pathology. Therapies targeting senescent cells, hold promise for treating/preventing CVDs and anti-inflammatory regulatory macrophages (Mreg) may represent a novel cell-based therapeutic approach. Here we investigated the impact of Mreg secretory products (SPMreg) on the early and late passage phenotype of human endothelial cells (HUVEC, human umbilical vein endothelial cells), with implications for cardiovascular aging and diseases.

Methods

HUVEC were classified as early passage (HUVECep, passages 4–6) or late passage (HUVEClp, passages 10–13) and cultured for 10 days with or without SPMreg. Parameters associated with endothelial aging, including cell morphology, size and volume, β-galactosidase activity, CD105 expression, reactive oxygen species (ROS), and senescence-associated secretory phenotype (SASP) factor release, were analyzed.

Results

HUVECep exhibited a typical cobblestone-like morphology, whereas HUVEClp displayed a spindle-shaped appearance. Both cell types showed an elongated, fibroblast-like cell type after incubation with SPMreg. In HUVEClp, treatment with SPMreg significantly reduced cell size and volume at all time points (P < 0.05). In HUVECep, SPMreg increased β-galactosidase activity and the proportion of ROS-positive cells, while reducing secretion of the SASP factor PAI-1 (P < 0.05 for all). In HUVEClp SPMreg increased β-galactosidase activity, attenuated the time-dependent increase of ROS levels and secretion of SASP factor Activin A (P < 0.05 for all).

Conclusion

Our findings demonstrate that SPMreg modulate several factors associated with endothelial senescence, highlighting a potential role for Mreg in processes related to cardiovascular aging.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12872-026-05732-w.

Keywords: Cardiovascular diseases, Endothelial cells, Regulatory macrophages, Senescence

Introduction

Cardiovascular diseases (CVDs) are the main cause of morbidity and mortality worldwide and represent a heterogeneous group of chronic diseases affecting heart and blood vessels [1]. Due to demographic changes, the prevention and treatment of CVDs, as well as the development of novel therapeutic strategies, have gained increasing attention over recent decades [2, 3].

Cardiovascular aging and premature senescence of endothelial cells play a central role in the development of CVDs [2, 4]. Endothelial cells forming the inner lining of blood vessels constitute the first barrier between the blood stream and the surrounding tissue. Under physiological conditions, endothelial cells contribute to the prevention of plaque formation and vasoconstriction [5]. When endothelial cells become senescent upregulation of adhesion molecules, increased vascular permeability and vasoconstriction can be the consequences. These effects are caused among other things by the induction of a chronic inflammation promoting the CVD development in aged individuals [6, 7].

Targeting cardiovascular aging (i.e. senescent endothelial cells) could be a potential therapeutic approach in preventing and treating CVDs. Cellular senescence is defined as stable, irreversible cell cycle arrest caused by different stimuli such as telomere shortening, oxidative stress, mitochondrial damage or radiation [8]. Senescence can have positive and negative effects on the surrounding tissue, referred to as the pleiotropy of senescence [9]. Firstly, senescence is a potential tumor suppressing mechanism by limiting the proliferation of damaged cells, has important roles during the physiological development and in the regulation of the tissue homeostasis [10, 11]. But the accumulation of senescent cells can also induce a proinflammatory environment which can cause a chronic sterile inflammation resulting in the development of many age-related diseases like atherosclerosis, Alzheimer disease or diabetes mellitus [12, 13]. Because of the lack of one specific senescence marker a combination of senescence markers selected specifically for cell type and senescence induction method must be applied to identify senescent cells in-vitro and in-vivo. Commonly used markers for the identification of senescent endothelial cells are β-galactosidase, CD105, reactive oxygen species (ROS) and specific senescence associated secretory phenotype (SASP) factors [13, 14].

Identifying senescent cells and understanding their specific markers is essential for developing targeted therapeutic approaches. Building on these insights, innovative strategies such as cell-based therapeutics may represent promising avenues for the treatment and prevention of CVDs [3, 15]. In the last years regulatory macrophages (Mreg) gained attention by the identification of their immunosuppressive and anti-inflammatory effects as well as their positive effects on angiogenesis [16, 17]. Mreg are originated from peripheral blood monocytes and can be generated by incubation with M-CSF, human serum and an additional short-term stimulation with IFN-gamma in-vitro [18]. It has been shown that high levels of Mreg in blood vessels reduce the development of atherosclerotic lesions by increasing IL-10 production [19]. Whether Mreg also play a role in the context of cardiovascular aging and senescence-associated processes is currently unknown.

In the present study, we show that secretory products from regulatory macrophages modulate several senescence-related parameters in human endothelial cells, suggesting a possible therapeutic potential of Mreg in cardiovascular aging and associated diseases.

Methods

Isolation and cultivation of HUVEC (human umbilical vein endothelial cells)

The study was approved by the local Ethics Committee of the University Medical Center Schleswig–Holstein, Kiel, Germany (protocol identification: D519/18 and D518/13). In this study a HUVEC based cell culture model was employed. HUVEC are of fetal origin and derived from venous tissue. Although they do not fully reflect the phenotype and biology of adult arterial endothelial cells, HUVEC are among the best-characterized primary endothelial cell types and offer high reproducibility, broad availability, and well-defined stress and activation responses. These features make them a widely accepted model for mechanistic in vitro studies, despite their inherent developmental and vascular-bed–specific limitations [20]. HUVEC were isolated from umbilical cords from healthy women in accordance with the ethics guidelines approved by the local Ethics Committee of the University Medical Center Schleswig–Holstein, Kiel, Germany (protocol identification: D518/13) as described further [21]. Cells (seeding density: 20.000—30.000 cells per cm2) were cultured in endothelial cell growth medium ECGM (PromoCell, Heidelberg, Germany) supplemented with 4 μL/mL of endothelial cell growth supplement, 0.1 ng/mL epidermal growth factor, 1 ng/mL basic fibroblast growth factor, 90 μg/mL heparin, 1 μg/mL hydrocortisone (all from PromoCell) and 10% fetal bovine serum (Thermo Fisher, Waltham, USA). The cells were maintained in a humidified atmosphere (5% carbon dioxide/95% air) at 37 °C. HUVEC were continuously cultured until passage numbers P ≥ 10 (late passage, HUVEClp, P ≥ 10). HUVEC with passages P < 10 were referred to as early-passage HUVEC (early passage, HUVECep, P < 10). HUVECep cultures were utilized at passages four to six, while HUVEClp cultures were used at passages ten to thirteen.

HUVECep and HUVEClp were cultured with and without the addition of Mreg-derived secretory products (SPMreg) for 10 days. SPMreg medium consisted of 50% conditioned Mreg culture medium (RPMI 1640 containing Mreg secretory products) and 50% HUVEC culture mediun (ECGM). The control medium (Co) consisted of 50% non-conditioned Mreg culture medium (RPMI 1640 without Mreg secretory products) and 50% HUVEC culture mediun (ECGM). A detailed overview of the HUVEC passages used and the corresponding SPMreg batches is provided in the Supplementary Tables 1 and 2. On day 10 cells were harvested by using Accutase for detachment (Innovative Cell Technologies, San Diego, USA) and separated from culture medium by centrifugation (300 × g for 10 min at room temperature). The cells and the conditioned culture media were used for analysis of senescence related parameters (Fig. 1).

Fig. 1.

Fig. 1

Schematic representation of the manufacturing process of Mreg and experimental setting. A Monocytes were obtained from peripheral blood mononuclear cells (PBMC) of healthy donors through density centrifugation and CD14 Magnetic Bead Sorting and cultured for 7 days in cell cultivation bags with the addition of M-CSF for 7 days and IFNγ for 24 h on day 6 to obtain Mreg and SPMreg. B HUVECep and HUVEClp from umbilical cords of healthy women were cultured with and without the addition of Mreg supernatants (SPMreg) for 10 days, followed by the analysis of senescence associated factors

Production of Mreg-derived secretory products (SPMreg)

Monocytes were isolated from eight different leukocyte reduction system (LRS) chambers (labeled Kxxx) provided by the Department of Transfusion Medicine (University Hospital of Schleswig–Holstein, Kiel, Germany) by Ficoll-Paque PLUS gradient centrifugation (GE Healthcare, Chicago, USA) and CD14 positive cell sorting (Miltenyi, Bergisch Gladbach, Germany). Monocyte to Mreg differentiation was achieved by cultivation in differentiation bags (Miltenyi) with RPMI 1640 medium (Gibco, Billings, USA) supplemented with 10% human AB-Serum (Access Biological, Vista, USA) and 4200 IU/ml human M-CSF (R&D Systems, Minneapolis, USA). The culture bags were placed in an incubator under standard culture conditions (humidified atmosphere with 5% carbon dioxide/95% air) at 37 °C. After a 6-day culturing period, 500 IU/ml of human interferon (IFN)γ (R&D Systems, Minneapolis, USA) was added to the cultures and cells were incubated for additional 24 h. On day 7 Mreg were harvested and separated from culture medium (SPMreg) by centrifugation (300 × g for 10 min at room temperature). SPMreg were stored at – 20 °C until use (Fig. 1).

Measurement of cell morphology, size and volume

Cell morphology of HUVEC was determined by brightfield microcopy (Leica Microsystems, Wetzlar, Germany). On day 3, 5, 7 and 10 cells were harvested and separated from culture medium by centrifugation (300 × g for 10 min at room temperature) for analysis of cell size and volume by using an automated cell counter (Moxi, Orflo, Ketchum, USA).

Flow cytometric analysis

Flow cytometric analyses were conducted on day 10 of the cultivation period using the MACS Q10 cytometer from Miltenyi. The specific antibody and the corresponding isotype were directly conjugated with allophycocyanin (APC) for CD105. For evaluation of β-galactosidase positive cells the CellEvent Senescence Green Flow Cytometry Assay Kit was used following the manufacturer’s protocol (Thermo Fisher). For the evaluation of ROS positive cells, a specific cell permeable non-fluorescent probe (Sigma-Aldrich, St. Louis, USA) was applied directly after cell harvesting. For data analyses the MACS-Quantify software for Windows by Miltenyi was used (v2.13.3). The gating strategy consisted of (i) identification of HUVEC based on their size and granularity forward scatter (FSC)/side scatter (SSC) profiles, (ii) exclusion of doublets and non-viable cells (7-AAD nuclear staining, BD Biosciences, #559,925), (iii) identification of HUVEC positive for β-galactosidase, CD105 and ROS.

Quantitative evaluation of intracellular ROS levels

For the evaluation of the relative intracellular ROS levels a fluorometric assay was performed. HUVEC were seeded in black 96-well plates (5.000 cells/well for HUVECep and 10.000 cells/well for HUVEClp) and cultivated with and without the addition of SPMreg for 10 days. On day 10 a working solution containing 1 mM H2DCFDA was added, and excitation (λ = 485 nm) and emission (λ = 535 nm) were measured using the Genios FL Reader (Tecan, Männedorf, Switzerland) every 15 min at 37 °C for 90 min. The increase of fluorescence was calculated using the following formula: Inline graphic  

PCR-Analysis of CD105

After 10 days of culture HUVEC were harvested and RNA was isolated using the Qiagen RNeasy Mini Kit, following the manufacturer’s protocol (Qiagen, Hilden, Germany) and RNA was transcribed into cDNA as described earlier [16]. The following primers (Metabion, Martinsried, Germany) were synthesized and used to amplify specific fragments of the human transcripts: forward 5’ – GAATTCTGGTACATCTACTCGC – 3’ and reverse 5’—GGCTATGCCATGCTGCTGGTGG – 3’ for CD105, forward 5’ – GTTGGTGGAGCGATTTGTCTGG – 3’ and reverse 5’ – AGGGCAGGGACTTAATCAACGC – 3’ for 18sRNA. All PCR products were separated on 2.5% agarose gels containing 0.005% Roti®-Safe GelStain (Carl Roth, Karlsruhe, Germany) and UV-transillumination was detected using the Vilber Fusion X Spectra reader (Vilber Lourmat, Eberhardzell, Germany). Images of the bands were taken and analyzed with the software ImageJ (v1.41, NIH, Maryland, USA).

Analysis of SASP associated factors

On day 10 HUVEC were harvested using Accutase and separated from culture medium by centrifugation (300 × g for 10 min at room temperature). Supernatants were aliquoted and stored at −80 °C. Quantification of the SASP factors Activin A, GDF-15, IL-8, PAI-1 and TNF-⍺ were performed by RayBiotec (Georgia, USA) using Multiplex ELISA assays.

Statistics

The statistics software GraphPad Prism 10.3.1 for windows (GraphPad Software, San Diego, USA) was used for data analyses. Values are expressed as the mean ± standard error of mean (SEM). All data were tested for normality using the Kolmogorov–Smirnov test. In cases normality was not obtained, the data were transformed (CD105 flow cytometry: × 100, log(x); ROS flow cytometry: × 100, log(x), ROS-Assay and SASP Multiplex: 1e, square root of x, arcsin(x)) and analyzed using one-way or two-way ANOVA, or one-sample T-Test. A P-value < 0.05 was considered significant.

Results

Effects of Mreg-derived secretory products on the morphology of early passage and late passage endothelial cells

HUVECep, cultured with control medium, showed a cobblestone like appearance typical for endothelial cells whereas HUVEClp appeared elongated and more spindle-shaped. HUVEClp also tended to grow in clusters and did not reach confluence within the defined time period. Under incubation with SPMreg HUVECep as well as HUVEClp exhibited an elongated and fibroblast-like cell type. Moreover, a comparable confluence of HUVECep and HUVEClp was observed under incubation with SPMreg (Fig. 2A + B). The area under curve (AUC) for cell size and cell volume was determined for HUVECep ± SPMreg and HUVEClp ± SPMreg and showed a significant reduction of cell size and volume especially in HUVEClp + SPMreg (AUC cell size: HUVECep + Co: 133.8 ± 4.309 µm x days; P < 0.05 vs. HUVECep + SPMreg: 122.8 ± 3.289 µm x days; HUVEClp + Co: 149.9 ± 1.786 µm x days; P < 0.001 vs. HUVEClp + SPMreg: 140.0 ± 1.985 µm x days; AUC cell volume: HUVECep + Co: 16.56 ± 1.474 pl x days; P = 0.05 vs. HUVECep + SPMreg: 12.97 ± 0.944 pl x days; HUVEClp + Co: 17.55 ± 0.6421 pl x days; P < 0.01 vs. HUVEClp + SPMreg: 14.40 ± 0.572 pl x days; Fig. 2 A + B).

Fig. 2.

Fig. 2

Phenotypic characterization of HUVEC with (+ SPMreg) and without SPMreg (+ Co). A Phenotypic characterization of HUVECep by brightfield microscopy images and determination of the area under the curve for cell size and volume. B Phenotypic characterization of HUVEClp by brightfield microscopy images and determination of the area under the curve for cells size and volume. Results are presented as mean ± standard error mean (SEM). * P < 0.05; ** P < 0.01; *** P < 0.001. Unpaired T-Test for AUC, 2-way-ANOVA for cell size and volume; HUVECep N = 7 (P4, P5, P6; HUVEC IX, HUVEC XIII), SPMreg N = 5 (K281, K282, K325, K326, K327); HUVEClp N = 8 (P10, P11, P12, P13; HUVEC IX, HUVEC XIII); SPMreg N = 6 (K277, K279, K281, K282, K289, K326)

Effects of Mreg-derived secretory products on CD105 expression by early passage and late passage endothelial cells

To evaluate the effect of SPMreg on CD105 gene expression semiquantitative analysis was performed. CD105 expression did not differ in qPCR analysis between cultures of HUVECep nor HUVEClp with and without the addition of SPMreg (HUVECep + Co: 0.350 ± 0.002; P > 0.05 vs. HUVECep + SPMreg 0.390 ± 0.013; HUVEClp + Co: 0.386 ± 0.047; P > 0.05 vs. HUVEClp + SPMreg: 0.353 ± 0.040; Fig. 3A + B). For evaluation of the number of CD105 positive cells flow cytometric analysis was performed. Although the number of CD105 positive HUVECep and HUVEClp tended to increase upon addition of SPMreg, the differences did not reach statistical significance (HUVECep + Co: 39.55 ± 11.49%; P > 0.05 vs. HUVECep + SPMreg: 49.62 ± 11.35%; HUVEClp + Co: 43.76 ± 6.838%; P > 0.05 vs. HUVEClp + SPMreg: 56.32 ± 6.153%; Fig. 3A - D).

Fig. 3.

Fig. 3

Characterization of CD105 expression in HUVECep and HUVEClp after the 10-day cultivation period with (+ SPMreg) and without SPMreg (+ Co). A + B qPCR analysis of HUVECep and HUVEClp. C + D Flow cytometric analysis of HUVECep and HUVEClp. Results are presented as mean ± standard error mean (SEM). One-sample T-Test, transformation of CD105 flow cytometric analysis: log(x); HUVECep N = 7 for flow cytometric analysis (P4, P5, P6; HUVEC IX, HUVEC XIII), SPMreg N = 5 (K281, K282, K325, K326, K327) and N = 3 for PCR of CD105 (P4, P5; HUVEC XIII), SPMreg N = 3 (K325, K326, K327); HUVEClp N = 8 for flow cytometric analysis (P10, P11, P12, P13; HUVEC IX, HUVEC XIII); SPMreg N = 6 (K277, K279, K281, K282, K289, K326) and N = 3 for PCR of CD105 (P10; HUVEC XIII), SPMreg N = 2 (K289, K326)

Effects of Mreg-derived secretory products on β-galactosidase and reactive oxygen species (ROS) in early passage and late passage endothelial cells

Flow cytometric analysis of senescence related factors showed a significant increase of β-galactosidase and ROS positive HUVECep under SPMreg treatment (β-Galactosidase: HUVECep + Co: 47.30 ± 6.670%; P < 0.05 vs. HUVECep + SPMreg: 74.21 ± 7.225%; ROS: HUVECep + Co: 64.20 ± 7.399%; P < 0.05 vs. HUVECep + SPMreg: 77.11 ± 4.512%; Fig. 4A). SPMreg also caused a significant increase in the number of β-galactosidase positive cells in HUVEClp (HUVEClp + Co: 52.97 ± 7.421%; P < 0.05 vs. HUVEClp + SPMreg: 78.85 ± 1.163%; Fig. 4B), but did not alter the number of ROS positive cells (HUVEClp + Co: 69.77 ± 4.536%; P > 0.05 vs. HUVEClp + SPMreg 76.39 ± 5.001%; Fig. 4B).

Fig. 4.

Fig. 4

Analysis of the percentage of β-galactosidase and ROS positive HUVECep and HUVEClp after the 10-day cultivation period with (+ SPMreg) and without SPMreg (+ Co). A Flow cytometric analysis of β-galactosidase and ROS positive HUVECep. B Flow cytometric analysis of β-galactosidase and ROS positive HUVEClp. Results are presented as mean ± standard error mean (SEM). * P < 0.05. One-sample T-Test, transformation of ROS flow cytometric analysis: log(x); HUVECep N = 7 (P4, P5, P6; HUVEC IX, HUVEC XIII), SPMreg N = 5 (K281, K282, K325, K326, K327); HUVEClp N = 8 (P10, P11, P12, P13; HUVEC IX, HUVEC XIII); SPMreg N = 6 (K277, K279, K281, K282, K289, K326)

HUVEC were incubated with H2DCFDA to evaluate the oxidative status of the cells. In HUVECep addition of SPMreg did not change the increase of intracellular ROS levels over the time period of 45 min (HUVECep + Co: 4.773 ± 0.111; P > 0.05 vs. HUVECep + SPMreg: 3.753 ± 0.751; Fig. 5A). However, applying SPMreg significantly attenuated the intracellular increase of ROS in HUVEClp (HUVEClp + Co: 9.42 ± 6.241; P < 0.05 vs. HUVEClp + SPMreg: 3.45 ± 3.061; Fig. 5B).

Fig. 5.

Fig. 5

Characterization of relative intracellular changes of ROS levels in HUVECep and HUVEClp after the 10-day cultivation period with (+ SPMreg) and without SPMreg (+ Co). A HUVECep. B HUVEClp. Results are presented as mean ± standard error mean (SEM). * P < 0.05. One-sample T-Test, transformation: square root of x, arcsin(x); HUVECep N = 3 (P4, P5; HUVEC XIII), SPMreg N = 3 (K325, K326, K327); HUVEClp N = 3 (P10; HUVEC XIII), SPMreg N = 2 (K289, K326)

Effects of Mreg-derived secretory products on SASP factor secretion in cultures of early passage and late passage endothelial cells

To analyze the effects of SPMreg on SASP (senescence associated secretory phenotype) factor secretion of HUVECep and HUVEClp, multiplex ELISAs were performed. In HUVECep cultures, SPMreg resulted in significantly lower PAI-1 protein secretion (HUVECep + Co: 4686 ± 413.8 pg/ml; P < 0.05 vs. HUVECep + SPMreg: 3808 ± 103.3 pg/ml; Fig. 6A), but did not have a significant effect on the secretion of the SASP factors Activin A, GDF-15, IL-8 and TNF-⍺ (Supplementary Table 3). In contrast, cultivation with SPMreg led to a significant decrease of Activin A protein secretion in HUVEClp (HUVEClp + Co: 1487.10 ± 628.97 pg/ml; P < 0.05 vs. HUVEClp + SPMreg: 47.93 ± 39.14 pg/ml; Fig. 6B) while no significant differences in protein secretion of GDF-15, IL-8, PAI-1 and TNF-⍺ were observed (Supplementary Table 3).

Fig. 6.

Fig. 6

Senescence associated secretory phenotype (SASP) factor protein secretion in HUVECep and HUVEClp after the 10-day cultivation period with (+ SPMreg) and without SPMreg (+ Co). A HUVECep. B HUVEClp. Results are presented as mean ± standard error mean (SEM). * P < 0.05; One-sample T-Test, transformation: square root of x, arcsin(x); HUVECepN = 3 (P5, P6; HUVEC IX), SPMregN = 2 (K281, K282); HUVEClpN = 3 (P11, P12, P13; HUVEC IX), SPMregN = 2(K289, K326)

Statistical comparisons between HUVECep and HUVEClp with respect to all analyzed parameters under basal conditions, as well as with and without SPMreg are presented in Supplementary Figs. 1–4.

Discussion

Cardiovascular diseases (CVDs) are the leading cause of mortality worldwide and within the demographic change a constant search for new preventive and therapeutic strategies started in the last decades [1]. Cardiovascular aging and cellular senescence, especially of endothelial cells, plays a pivotal role in the onset and progression of CVDs by the induction of a chronic, sterile inflammation [6]. Macrophages are essential regulators of tissue homeostasis, immune defense and inflammation but their effects on surrounding tissues strongly depend on their in-vivo polarization [22, 23]. To simplify, inflammatory M1 and anti-inflammatory M2 macrophages can be distinguished, but the in-vivo phenotypes are more complex and dynamically regulated by the surrounding micro-environment [24]. In recent years different research groups have shown that in-vitro generated regulatory macrophages (Mreg) possess anti-inflammatory and immunosuppressive effects on surrounding tissues [17, 25]. Mreg are considered to present a M2-subtype of macrophages that might also be able to positively influence endothelial cell senescence by limiting the induction of a chronic, sterile inflammation [19, 26].

The present study investigates the effects of secretory products derived from IFN-γ (day 6) induced Mreg (SPMreg) on cellular senescence markers in early-passage (HUVECep) and late-passage (HUVEClp) of human endothelial cells, serving as a model for the aging endothelium associated with the development of cardiovascular diseases (CVDs). In previous work, we showed that Mreg generated using a slightly different protocol with an early IFN-γ stimulation at day 0 (MregIFNγ0) differ substantially from classical late IFN-γ induced Mreg, exhibiting a more M1-like and pro-inflammatory phenotype as well as marked alterations in their secretome [27]. Given that classical late IFN-γ induced Mreg are predominantly anti-inflammatory, whereas MregIFNγ0 display a more inflammatory profile—and that variations in IFN-γ timing or omission are likely to generate additional Mreg subtypes – we chose to focus primarily on the effects of SPMreg from well-characterized classical IFN-γ-induced Mreg in the present study.

For induction of cellular aging, HUVEC were passaged until a critical passage number (P ≥ 10), resulting in cessation of proliferative capacity [28]. The resulting HUVEClp exhibited morphological characteristics typical for aged endothelial cells, including a heterogeneous appearance and an elongated, flattened cell body [29].

When cultured with SPMreg, both HUVECep and HUVEClp adopted an elongated, fibroblast-like morphology, in contrast to the typical cobblestone appearance of HUVECep in control medium. Additionally, SPMreg treatment led to a significant reduction in cell size and volume especially in HUVEClp. Changes in endothelial cell morphology are not only linked to cellular aging but also affect their secretory profile [30]. Spindle-shaped endothelial cells are considered anti-inflammatory in the development of atherosclerotic lesions by inhibiting monocyte secretion [31]. Furthermore, increased cell size and volume are hallmark features of cellular senescence and linked to shifts in protein concentration as well as metabolic activity that drive the onset of the senescent phenotype [32]. Our findings that SPMreg treatment led to a significant reduction in cell size and volume, particularly in late passage HUVEClp highlight the potential of SPMreg to counteract senescence-associated morphological changes and suggest that the premature induction and progression of senescence, especially in aging endothelial cells, may be influenced by the Mreg secretory factors.

Regarding the endothelial senescence marker CD105, no statistically significant differences were observed in either HUVECep or HUVEClp following SPMreg treatment, although there was a slight trend towards increased CD105 positivity in both cell types. CD105 is a component of the TGF-β receptor complex and plays a key role in regulating cell growth, migration, angiogenesis, vascular tone and extracellular matrix production [33, 34]. Elevated CD105 levels are associated not only with cellular senescence but also with endothelial cell activation, immune cell adhesion to the endothelium, chronic inflammation and ultimately the development and progression of atherosclerotic lesions [34, 35]. By maintaining CD105 at a steady level the addition of Mreg secretory factors may exert a beneficial effect on the endothelium, potentially limiting inflammation and plaque formation.

SPMreg treatment resulted in a significant increase in β-galactosidase activity in both HUVECep and HUVEClp. β-galactosidase is considered as a marker of cellular senescence in-vitro and is therefore referred to as senescence associated β-galactosidase (SA-β-galactosidase) [36]. SA-β-galactosidase is produced in lysosomes and its expression is correlated with lysosomal abundance [37]. However, recent studies have demonstrated that the in-vitro expression of β-galactosidase can also be induced by alternative conditions, such as contact inhibition or the absence of growth factors, and that β-galactosidase is not strictly required for the induction or maintenance of senescence [37, 38]. In summary, the finding that β-galactosidase is upregulated in HUVECep and HUVEClp following SPMreg treatment is somewhat unexpected. It remains unclear whether this reflects a specific senescence-associated effect or if other culture conditions, as previously discussed, contribute to this observation.

Treatment with SPMreg also led to a significant increase in the percentage of ROS-positive cells in HUVECep cultures. In contrast, the increase of intracellular ROS levels over time in HUVEClp was significantly lower under SPMreg treatment. Reactive oxygen species are highly reactive molecules physiologically generated during aerobic metabolism. Their production is tightly regulated to prevent oxidative stress and cellular damage [39]. In senescent cells mitochondrial dysfunction can lead to excessive ROS accumulation triggering senescence associated secretory phenotype (SASP) factor production and promoting senescence in neighboring cells [40]. Moreover, elevated ROS levels are linked to endothelial dysfunction and promote the development of atherosclerosis, hypertension and severe cardiovascular events by inhibiting nitric oxide (NO) production, inducing vasoconstriction and activating the coagulation cascade [41, 42]. The finding that HUVEClp cultured with Mreg secretory products exhibit a significantly lower increase in intracellular ROS levels over time compared to those cultured with control medium supports the hypothesis that Mreg derived supernatants may exert protective effects on the aging endothelium.

To investigate whether Mreg secretory products also modulate SASP factor realease in endothelial cells, conditioned culture media were characterized using Multiplex assays. In HUVECep SPMreg treatment significantly reduced the secretion of Plasminogen activator inhibitor 1 (PAI-1) but had no significant impact on other SASP factors. In HUVEClp, treatment with SPMreg significantly decreased Activin A release, whereas no significant changes were observed on other SASP components. Elevated PAI-1 levels are associated with pro-fibrotic and pro-thrombotic phenotypes by reducing fibrinolytic activity, a phenomenon commonly seen in aging individuals [43, 44]. By lowering PAI-1 levels in young endothelial cells Mreg secretory products may act as a protector of the vascular endothelium, potentially reducing age-related vascular dysfunction. Activin A, a member of the TGF-β superfamily, regulates cell growth, differentiation, apoptosis and angiogenesis in endothelial cells and other cell types [45]. Elevated levels of Activin A have been linked to endothelial senescence in-vitro and endothelial dysfunction, aging and age-associated CVDs in-vivo. The detrimental effects of Activin A are primarily mediated through the induction of oxidative stress and upregulation of adhesion molecule expression in endothelial cells [46, 47]. By suppressing Activin A production Mreg secretory products could exert vasoprotective effects on the aging endothelium.

While this study offers important insights into the effects of regulatory macrophage secretory products on cardiovascular aging and endothelial cell aging (Fig. 7), several limitations should be acknowledged. First, HUVEC with replicative senescence serve as a practical in-vitro model but may not fully reflect the complexity of vascular aging in living organisms. Future studies including adult arterial endothelial cells to validate the generalizability of our findings or in-vivo approaches would enhance translational relevance. Second, the passage number difference between HUVECep and HUVEClp was relatively narrow (4–9 passages), which may explain why some senescence-associated parameters did not differ significantly despite established indicators of replicative senescence such as increased Activin A secretion and altered cell morphology. Third, in this study, senescence was characterized using multiple markers, including cell morphology and size, β-galactosidase activity, CD105 expression, reactive oxygen species (ROS), and specific components of the senescence-associated secretory phenotype (SASP). Given the complexity of cellular senescence, the inclusion of additional markers such as p16INK4a or p21CIP1/WAF1 in future studies could further strengthen the characterization and provide a more comprehensive understanding of the senescent phenotype of endothelial cells. Forth, while the study demonstrates significant senescence relevant effects of Mreg secretory products on endothelial cells, the specific bioactive components responsible for these effects have yet to be identified. Further characterization of the Mreg secretome, along with mechanistic and in vivo experiments, will be essential to deepen our understanding of the underlying pathways and to optimize potential therapeutic applications. As an initial basis for future studies aimed at identifying the responsible factors, previous work from our group characterizing the Mreg secretome may provide valuable preliminary insights [27, 48, 49].

Fig. 7.

Fig. 7

Key outcomes of this study at a glance. Comparison of late passage HUVEC (HUVEClp) cultured without (+ Co) (A) and with (B) the addition of SPMreg

In summary, our findings suggest that Mreg secretory products can modulate endothelial cell morphology as well as key markers associated with cellular senescence and cardiovascular aging, which may have important implications for vascular health during aging. These results underscore the potential of Mreg and their secretome as potential candidates for preventive or therapeutic strategies in cardiovascular aging and cardiovascular diseases. Nonetheless, further research is needed to elucidate the underlying mechanisms, identify the active components within the Mreg secretome, and compare their effects with other macrophage subtypes.

Supplementary Information

Supplementary Material 2. (13.6KB, docx)
Supplementary Material 3. (19.1KB, docx)

Acknowledgements

We thank Kerstin Parczany, Kerstin Marx and Christopher Schnoor for excellent technical assistance.

Authors’ contribution

Study concept and design: MA, RB, KZ and KD; Practical implementation of experiments: KD and KZ; Data analysis and statistical analysis: MA, KZ and KD; Writing of the manuscript: MA, KZ and KD; Critical revision of the manuscript: RB, CE, KH, FF and MS. All authors have approved the submitted version (and any substantially modified version that involves the author's contribution to the study) and have agreed both to be personally accountable for the author's own contributions and to ensure that questions related to the accuracy or integrity of any part of the work, even ones in which the author was not personally involved, are appropriately investigated, resolved, and the resolution documented in the literature.

Funding

Open Access funding enabled and organized by Projekt DEAL. This work was supported by a grant from Ferring Ventures GmbH.

Data availability

The datasets analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethical approval and consent to participate

Ethical approval for this study was obtained from the Ethics Committee of the University Medical Center Schleswig–Holstein, Kiel, Germany (protocol identification: D519/18 and D518/13). All procedures involving human participants were performed in accordance with the ethical standards of the institutional research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Written informed consent to participate in the study was obtained from all individual participants prior to inclusion.

Consent for publication

Not applicable.

Competing interests

The authors (MA, RB, KZ, FF, KD) are involved in a pending patent ("Regulatory Macrophages for the Modulation of Senescence in Human Endothelial Cells"). The authors (MA, RB, FF) have provided consultancy services to Ferring Ventures.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Karina Zitta and Martin Albrecht contributed equally to this work.

References

  • 1.Amini M, Zayeri F, Salehi M. Trend analysis of cardiovascular disease mortality, incidence, and mortality-to-incidence ratio: results from global burden of disease study 2017. BMC Public Health. 2021;21:401. 10.1186/s12889-021-10429-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sweeney M, Cook SA, Gil J. Therapeutic opportunities for senolysis in cardiovascular disease. FEBS J. 2023;290:1235–55. 10.1111/febs.16351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Berndt R, Albrecht M, Rusch R. Strategies to overcome the barrier of ischemic microenvironment in cell therapy of cardiovascular disease. Int J Mol Sci. 2021;22:2312. 10.3390/ijms22052312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tombor LS, Dimmeler S. Why is endothelial resilience key to maintain cardiac health? Basic Res Cardiol. 2022;117:35. 10.1007/s00395-022-00941-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Mussbacher M, Schossleitner K, Kral-Pointner JB, Salzmann M, Schrammel A, Schmid JA. More than just a monolayer: the multifaceted role of endothelial cells in the pathophysiology of atherosclerosis. Curr Atheroscler Rep. 2022;24:483–92. 10.1007/s11883-022-01023-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Han Y, Kim SY. Endothelial senescence in vascular diseases: current understanding and future opportunities in senotherapeutics. Exp Mol Med. 2023;55:1–12. 10.1038/s12276-022-00906-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sun Y, Wang X, Liu T, Zhu X, Pan X. The multifaceted role of the SASP in atherosclerosis: from mechanisms to therapeutic opportunities. Cell Biosci. 2022;12:74. 10.1186/s13578-022-00815-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hernandez-Segura A, Nehme J, Demaria M. Hallmarks of cellular senescence. Trends Cell Biol. 2018;28:436–53. 10.1016/j.tcb.2018.02.001. [DOI] [PubMed] [Google Scholar]
  • 9.Zhang L, Pitcher LE, Yousefzadeh MJ, Niedernhofer LJ, Robbins PD, Zhu Y. Cellular senescence: a key therapeutic target in aging and diseases. J Clin Invest. 2022;132. 10.1172/JCI158450. [DOI] [PMC free article] [PubMed]
  • 10.Huang W, Hickson LJ, Eirin A, Kirkland JL, Lerman LO. Cellular senescence: the good, the bad and the unknown. Nat Rev Nephrol. 2022;18:611–27. 10.1038/s41581-022-00601-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.McHugh D, Gil J. Senescence and aging: causes, consequences, and therapeutic avenues. J Cell Biol. 2017;217:65–77. 10.1083/jcb.201708092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kumari R, Jat P. Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory Phenotype. Frontiers in Cell and Developmental Biology. 2021;9. 10.3389/fcell.2021.645593. [DOI] [PMC free article] [PubMed]
  • 13.Dodig S, Čepelak I, Pavić I. Hallmarks of senescence and aging. Biochem Med. 2019;29:0–0. 10.11613/BM.2019.030501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Blanco FJ, Grande MT, Langa C, Oujo B, Velasco S, Rodriguez-Barbero A, et al. S-endoglin expression is induced in senescent endothelial cells and contributes to vascular pathology. Circ Res. 2008;103:1383–92. 10.1161/CIRCRESAHA.108.176552. [DOI] [PubMed] [Google Scholar]
  • 15.Xu M, Zhang K, Song J. Targeted therapy in cardiovascular disease: a precision therapy era. Front Pharmacol. 2021. 10.3389/fphar.2021.623674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hummitzsch L, Zitta K, Rusch R, Cremer J, Steinfath M, Gross J, et al. Characterization of the angiogenic potential of human regulatory macrophages (Mreg) after ischemia/reperfusion injury in vitro. Stem Cells Int. 2019;2019:1–10. 10.1155/2019/3725863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang F, Zhang J, Cao P, Sun Z, Wang W. The characteristics of regulatory macrophages and their roles in transplantation. Int Immunopharmacol. 2021;91:107322. 10.1016/j.intimp.2020.107322. [DOI] [PubMed] [Google Scholar]
  • 18.Hutchinson JA, Riquelme P, Geissler EK, Fändrich F. Human Regulatory Macrophages. In: Cuturi MC, Anegon I, editors. Suppression and Regulation of Immune Responses: Methods and Protocols. Totowa, NJ: Humana Press; 2011. p. 181–92. 10.1007/978-1-60761-869-0_13.
  • 19.Frodermann V, van Duijn J, van Puijvelde GHM, van Santbrink PJ, Lagraauw HM, de Vries MR, et al. Heat-killed Staphylococcus aureus reduces atherosclerosis by inducing anti-inflammatory macrophages. J Intern Med. 2016;279:592–605. 10.1111/joim.12484. [DOI] [PubMed] [Google Scholar]
  • 20.Medina-Leyte DJ, Domínguez-Pérez M, Mercado I, Villarreal-Molina MT, Jacobo-Albavera L. Use of human umbilical vein endothelial cells (HUVEC) as a model to study cardiovascular disease: a review. Appl Sci. 2020;10:938. 10.3390/app10030938. [Google Scholar]
  • 21.Berndt R, Hummitzsch L, Heß K, Albrecht M, Zitta K, Rusch R, et al. Allogeneic transplantation of programmable cells of monocytic origin (PCMO) improves angiogenesis and tissue recovery in critical limb ischemia (CLI): a translational approach. Stem Cell Res Ther. 2018;9:117. 10.1186/s13287-018-0871-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sansonetti M, Al Soodi B, Thum T, Jung M. Macrophage-based therapeutic approaches for cardiovascular diseases. Basic Res Cardiol. 2024;119:1–33. 10.1007/s00395-023-01027-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Viola A, Munari F, Sánchez-Rodríguez R, Scolaro T, Castegna A. The metabolic signature of macrophage responses. Front Immunol. 2019. 10.3389/fimmu.2019.01462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang L, Zhang S, Wu H, Rong X, Guo J. M2b macrophage polarization and its roles in diseases. J Leukoc Biol. 2019;106:345–58. 10.1002/JLB.3RU1018-378RR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Yang S, Yuan H-Q, Hao Y-M, Ren Z, Qu S-L, Liu L-S, et al. Macrophage polarization in atherosclerosis. Clin Chim Acta. 2020;501:142–6. 10.1016/j.cca.2019.10.034. [DOI] [PubMed] [Google Scholar]
  • 26.Huang S, Yue Y, Feng K, Huang X, Li H, Hou J, et al. Conditioned medium from M2b macrophages modulates the proliferation, migration, and apoptosis of pulmonary artery smooth muscle cells by deregulating the PI3K/Akt/FoxO3a pathway. PeerJ. 2020;8:e9110. 10.7717/peerj.9110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zitta K, Hummitzsch L, Lichte F, Fändrich F, Steinfath M, Eimer C, et al. Effects of temporal IFNγ exposure on macrophage phenotype and secretory profile: exploring GMP-compliant production of a novel subtype of regulatory macrophages (MregIFNγ0) for potential cell therapeutic applications. J Transl Med. 2024;22:534. 10.1186/s12967-024-05336-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Yi S, Lin K, Jiang T, Shao W, Huang C, Jiang B, et al. NMR-based metabonomic analysis of HUVEC cells during replicative senescence. Aging Albany NY. 2020;12:3626–46. 10.18632/aging.102834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Beck J, Horikawa I, Harris C. Cellular senescence: mechanisms, morphology, and mouse models. Vet Pathol. 2020;57:747–57. 10.1177/0300985820943841. [DOI] [PubMed] [Google Scholar]
  • 30.Cho KA, Ryu SJ, Oh YS, Park JH, Lee JW, Kim H-P, et al. Morphological adjustment of senescent cells by modulating Caveolin-1 status. J Biol Chem. 2004;279:42270–8. 10.1074/jbc.M402352200. [DOI] [PubMed] [Google Scholar]
  • 31.Liang J, Gu S, Mao X, Tan Y, Wang H, Li S, et al. Endothelial cell morphology regulates inflammatory cells through microRNA transferred by extracellular vesicles. Front Bioeng Biotechnol. 2020. 10.3389/fbioe.2020.00369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lanz MC, Zatulovskiy E, Swaffer MP, Zhang L, Ilerten I, Zhang S, et al. Increasing cell size remodels the proteome and promotes senescence. Mol Cell. 2022;82:3255-3269.e8. 10.1016/j.molcel.2022.07.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kopczyńska E, Makarewicz R. Endoglin – a marker of vascular endothelial cell proliferation in cancer. Contemp Oncol (Pozn). 2012;16:68–71. 10.5114/wo.2012.27340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.López-Novoa JM, Bernabeu C. The physiological role of endoglin in the cardiovascular system. Am J Physiol Heart Circ Physiol. 2010;299:H959–74. 10.1152/ajpheart.01251.2009. [DOI] [PubMed] [Google Scholar]
  • 35.Rossi E, Sanz-Rodriguez F, Eleno N, Düwell A, Blanco FJ, Langa C, et al. Endothelial endoglin is involved in inflammation: role in leukocyte adhesion and transmigration. Blood. 2013;121:403–15. 10.1182/blood-2012-06-435347. [DOI] [PubMed] [Google Scholar]
  • 36.Lee BY, Han JA, Im JS, Morrone A, Johung K, Goodwin EC, et al. Senescence-associated β-galactosidase is lysosomal β-galactosidase. Aging Cell. 2006;5:187–95. 10.1111/j.1474-9726.2006.00199.x. [DOI] [PubMed] [Google Scholar]
  • 37.Ashraf HM, Fernandez B, Spencer SL. The intensities of canonical senescence biomarkers integrate the duration of cell-cycle withdrawal. Nat Commun. 2023;14:4527. 10.1038/s41467-023-40132-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Leontieva OV, Demidenko ZN, Blagosklonny MV. Contact inhibition and high cell density deactivate the mammalian target of rapamycin pathway, thus suppressing the senescence program. Proc Natl Acad Sci U S A. 2014;111:8832–7. 10.1073/pnas.1405723111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Davalli P, Mitic T, Caporali A, Lauriola A, D’Arca D. ROS, cell senescence, and novel molecular mechanisms in aging and age-related diseases. Oxid Med Cell Longev. 2016. 10.1155/2016/3565127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Nelson G, Kucheryavenko O, Wordsworth J, von Zglinicki T. The senescent bystander effect is caused by ROS-activated NF-κB signalling. Mech Ageing Dev. 2018;170:30–6. 10.1016/j.mad.2017.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Schulz E, Gori T, Münzel T. Oxidative stress and endothelial dysfunction in hypertension. Hypertens Res. 2011;34:665–73. 10.1038/hr.2011.39. [DOI] [PubMed] [Google Scholar]
  • 42.Incalza MA, D’Oria R, Natalicchio A, Perrini S, Laviola L, Giorgino F. Oxidative stress and reactive oxygen species in endothelial dysfunction associated with cardiovascular and metabolic diseases. Vasc Pharmacol. 2018;100:1–19. 10.1016/j.vph.2017.05.005. [DOI] [PubMed] [Google Scholar]
  • 43.Eren M, Boe AE, Klyachko EA, Vaughan DE. Role of plasminogen activator inhibitor-1 in senescence and aging. Semin Thromb Hemost. 2014;40:645–51. 10.1055/s-0034-1387883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sillen M, Declerck PJ. Targeting PAI-1 in cardiovascular disease: structural insights into PAI-1 functionality and inhibition. Front Cardiovasc Med. 2020;7:622473. 10.3389/fcvm.2020.622473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yong HEJ, Murthi P, Wong MH, Kalionis B, Cartwright JE, Brennecke SP, et al. Effects of normal and high circulating concentrations of activin A on vascular endothelial cell functions and vasoactive factor production. Pregnancy Hypertension: An International Journal of Women’s Cardiovascular Health. 2015;5:346–53. 10.1016/j.preghy.2015.09.006. [DOI] [PubMed] [Google Scholar]
  • 46.Schafer MJ, Zhang X, Kumar A, Atkinson EJ, Zhu Y, Jachim S, et al. The senescence-associated secretome as an indicator of age and medical risk. JCI Insight. 2020;5:e133668. 10.1172/jci.insight.133668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ueland T, Aukrust P, Aakhus S, Smith C, Endresen K, Birkeland KI, et al. Activin A and cardiovascular disease in type 2 diabetes mellitus. Diabetes Vasc Dis Res. 2012;9:234–7. 10.1177/1479164111431171. [DOI] [PubMed] [Google Scholar]
  • 48.Albrecht M, Hummitzsch L, Rusch R, Eimer C, Rusch M, Heß K, et al. Large extracellular vesicles derived from human regulatory macrophages (L-EVMreg) attenuate CD3/CD28-induced T-cell activation in vitro. J Mol Med. 2023;101:1437–48. 10.1007/s00109-023-02374-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Albrecht M, Hummitzsch L, Rusch R, Heß K, Steinfath M, Cremer J, et al. Characterization of large extracellular vesicles (L-EV) derived from human regulatory macrophages (Mreg): novel mediators in wound healing and angiogenesis? J Transl Med. 2023;21:61. 10.1186/s12967-023-03900-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 2. (13.6KB, docx)
Supplementary Material 3. (19.1KB, docx)

Data Availability Statement

The datasets analyzed during the current study are available from the corresponding author on reasonable request.


Articles from BMC Cardiovascular Disorders are provided here courtesy of BMC

RESOURCES