Rapid Identification of Penicillium marneffei by PCR-Based Detection of Specific Sequences on the rRNA Gene

Abstract

An emerging pathogenic dimorphic fungus, Penicillium marneffei, is one of the major causes of morbidity in patients with human immunodeficiency virus infection in Southeast Asia. A PCR-hybridization assay has been developed to identify this pathogen. This study describes the use of single and nested PCR methods for the rapid identification of P. marneffei. Two sets of oligonucleotide primers were derived from the sequence of 18S rRNA genes of P. marneffei. The outer primers (RRF1 and RRH1) were fungus specific. The inner primers (Pm1 and Pm2) were specific for P. marneffei and were used in nested or single PCR. The specific fragment of approximately 400-bp was amplified from both mold and yeast forms of 13 P. marneffei human isolates, 12 bamboo rat isolates, and 1 soil isolate, but not from other fungi, bacteria, and human DNA. The amplified products were analyzed by agarose gel electrophoresis followed by ethidium bromide staining. The sensitivities of the single PCR and nested PCR were 1.0 pg/μl and 1.8 fg/μl, respectively. The assay is useful for rapid identification of P. marneffei cultures. Very young culture of P. marneffei (2-day-old filamentous colony, 2 mm in diameter) could be performed by this assay. The species was identified within 7 h (single PCR) or 10 h (nested PCR), compared to 4 to 7 days for confirmation of dimorphism. The application of these PCR methods for early diagnosis of the disease needs to be studied further.

Penicillium marneffei is an emerging pathogenic fungus that can cause a fatal systemic mycosis in patients infected with human immunodeficiency virus (HIV). This mycosis is endemic in tropical Asia, especially in northern Thailand (20, 22), China (9), Hong Kong (28; D. N. C. Tsang, P. K. C. Li, M. S. Tsui, Y. T. Lau, K. F. Ma, and E. K. Yeoh, Letter, Rev. Infect. Dis. 13:766-767, 1991), and Taiwan (5). Many cases have been reported among visitors to the areas of endemicity (11, 17, 18, 21, 26; P. D. Jones and J. See, Letter, Clin. Infect. Dis. 15:744, 1992). Major manifestations of this mycosis in HIV-infected patients are fever, anemia, weight loss, and skin lesions (6, 22), features that are not specific for P. marneffei infection. Most patients who do not receive the appropriate antifungal treatment have a poor prognosis (22).

P. marneffei has been isolated from the internal organs of four species of rodents, Rhizomys sinensis, Rhizomys pruinosus, Rhizomys sumatrensis, and Cannomys badius (1, 4, 8), and soil samples collected from bamboo rat burrows (4, 9). P. marneffei can be cultured from human and environmental sources. The culture method requires 10 to 14 days. The identification is based on the colony and microscopic morphology and mold-to-yeast conversion (19). A specific indirect fluorescent antibody test can be used for the identification of P. marneffei in histological sections (13). Also, tests have been developed for detection of P. marneffei antigens by an immunodiffusion test, latex agglutination test (14), and enzyme-linked immunosorbent assay (ELISA) (2, 10). In addition, this mycosis can potentially be diagnosed by the detection of immunoglobulin G antibodies in the sera of patients by using the indirect immunofluorescent antibody test (29), the immunoblot assay (7, 12, 24), and ELISA (3). However, at present, no single assay provides sufficient sensitivity and specificity to confirm the clinical diagnosis.

The nuclear ribosomal DNA (rDNA) internal transcribed spacer region of P. marneffei was sequenced to determine the phylogenetic relatedness of this species (16) and to design oligonucleotide primers that could be used in PCRs for the identification of the organism. Recently, the nucleotide sequence from the 18S rDNA of P. marneffei has been determined (25). An oligonucleotide probe was designed and proved to be specific for P. marneffei in the PCR-hybridization reaction, regardless of whether the fungus was isolated from humans or natural habitats. In addition, this PCR-hybridization technique was used to detect P. marneffei DNA in EDTA-blood samples collected from AIDS patients with penicilliosis. Although the method is highly sensitive and specific, the hybridization technique is labor intensive and requires specific and complex instruments. In this study, new PCR primers were designed based on the 18S rDNA sequence of P. marneffei. They were used in a PCR-based assay to rapidly identify this pathogenic fungus.

MATERIALS AND METHODS

Organisms and growth conditions.

The following fungi were used in this experiment: human isolates P. marneffei ATCC 20050, 233H, 299BM, 299S, 429H, 444H, 495H, 496H, 497H, 502H, 515H, 517H, and 518H; bamboo rat isolates P. marneffei SpB0601, SpB0701, LuB3701, LuB3801, SpB4001, LiB4901, LuB5001, SpB5101, LiB6201, SpB6203, LuB7401, and LuB8001; soil isolate P. marneffei ATCC 201564; and other pathogenic fungal isolates from infected patients, including Aspergillus fumigatus, Histoplasma capsulatum, Cryptococcus neoformans, Candida albicans, and Candida krusei; and nine environmental isolates of Penicillium species other than P. marneffei. These fungi were maintained on Sabouraud's glucose agar (SGA) at 28°C. The yeast forms of P. marneffei and H. capsulatum were maintained on brain-heart infusion (BHI) agar at 37°C.

DNA extraction from fungal cultures.

DNA was extracted from fungal hyphae or yeast cells by two methods described previously (23, 25). DNA was extracted directly from fungal cells (rapid method) or from fungal spheroplasts. By the rapid method, fungal cells from the surface of the agar medium were suspended in 0.5 ml of lysis buffer (1.5% sodium dodecyl sulfate, 0.25 M Tris [pH 8.0]), and boiled for 30 min. The suspension was vortexed for 2 min. An equal volume of phenol-chloroform-isoamyl alcohol (25:24:1 ratio) was added, and the suspension was vortexed for 10 min to extract the DNA. After centrifugation, the upper phase was removed and DNA precipitation was carried out with cold acetone. The DNA pellet was air dried and resuspended in 50 μl of water.

DNA was also extracted from fungal spheroplasts. Fungal spheroplasts were prepared by the method described previously (23). Briefly, fungal cells were suspended in filter-sterilized osmotic medium (1.2 M MgSO₄, 10 mM sodium phosphate [pH 5.8], 5 ml/g of yeast cells), and the suspension was placed on ice. Spheroplasts were prepared by incubating with NovoZym 234 (20 mg/ml in osmotic medium, 2 ml/g of yeast cells) in the presence of bovine serum albumin (12 mg/ml in osmotic medium, 0.5 ml/mg of yeast cells) at 37°C for 2 h. The spheroplasts were lysed with lysis buffer (1% sodium dodecyl sulfate, 10 mM Tris, 1 mM EDTA [pH 8.0]). The suspension was deproteinized with 5 M potassium acetate. The nucleic acids were collected by 2-propanol precipitation and resuspended in TE buffer (10 mM Tris, 1 mM EDTA [pH 8.0]). Following phenol-chloroform-isoamyl alcohol (25:24:1 ratio) extraction of nucleic acids, ethanol precipitation was performed. The DNA pellet was resuspended in TE buffer. The DNA concentration was determined by measuring the A₂₆₀ with a spectrophotometer or by gel electrophoresis.

Oligonucleotide primers and PCR.

Two sets of nucleotide primers were used in this study. The outer primer pair RRF1 5′…ATCTAAATCCCTTAACGAGGAACA…3′ and RRH1 5′…CCGTCAATTTCTTTAAGTTTCAGCCTT…3′, amplifying a 631-bp sequence of 18S rRNA gene, was fungus specific (25). The inner primer pair Pm1 5′..ATGGGCCTTTCTTTCTGGG..3′ and Pm2 5′…GCGGGTCATCATAGAAACC..3′ was designed for P. marneffei by comparing the sequences of 18S rRNA genes of P. marneffei (GenBank accession no. AF034197) (25) and other fungi in the GenBank database. Nested PCR was performed with these two primer sets. The DNA template was first amplified with the primers RRF1 and RRH1. This PCR step was performed in a 50-μl volume containing 10 pmol of each primer, 1.25 U of Taq polymerase (Boehringer Mannheim GmbH, or Qiagen GmbH, Germany, or Takara Shuzo, Co., Ltd., Japan), deoxynucleoside triphosphate (dNTP) mixture (each at 200 μM) containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl₂, and about 1 to 10 ng of extracted DNA. PCR was performed in a Thermal Cycler (model 480; Perkin-Elmer, Foster City, Calif.) programmed as follows: 95^oC for 5 min; 35 cycles of 95^oC for 30 s, 55^oC for 30 s, 72^oC for 2 min; and final extension at 72^oC for 10 min. The amplified product was diluted 1,000-fold, and 1 μl of this diluted product was amplified with the inner primer pair Pm1 and Pm2 in the same manner described above, except that 2.0 Uof Taq polymerase was used, and the annealing temperature was 65^oC. Single PCR amplification directly with Pm1 and Pm2 was also tested. The PCR amplification products were analyzed by agarose gel (1% [wt/vol]) electrophoresis followed by ethidium bromide staining.

The sensitivity of the system was determined by PCR assay with the serially diluted DNA extracted from P. marneffei 497H. The system was also tested with very young single colonies cultured on the SGA plate after 2 days of incubation at 25°C.

Nucleotide sequence analysis.

The amplified products from nested PCR were purified by preparative agarose gel electrophoresis and QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany). The nucleotide sequences from these PCR products were determined with the ABI Prism 377 DNA sequencer (Perkin-Elmer) according to the manufacturer's instructions.

RESULTS AND DISCUSSION

The nested PCR system with two primer pairs (RRF1 and RRH1 and Pm1 and Pm2) proved to be specific for P. marneffei, regardless of whether the fungus was isolated from humans or natural habitats. Primers RRF1 and RRH1 amplified a region of the 18S rDNA sequences of P. marneffei and other fungi resulting in approximately 600-bp PCR products (Fig. 1A). The primer pair RRF1-RRH1 has been reported to be fungus specific (25). These primers amplify a part of the 18S rDNA sequences of P. marneffei, Penicillium spp., Aspergillus fumigatus, Aspergillus flavus, Histoplasma capsulatum, Cryptococcus neoformans, Candida albicans, and Candida krusei. No amplification was observed with Streptococcus DNA and human DNA. In the nested PCR step with the inner primer pair Pm1 and Pm2, a specific approximately 400-bp fragment was amplified from P. marneffei, but not from other fungi (Fig. 1B). Figure 2 shows the regions of the primers located in the 18S rDNA genes of P. marneffei that were used in this study.

FIG. 1.

Nested PCR amplification of DNA from various organisms with the universal fungal primers (first primer pair) RRF1 and RRH1 (A) and with specific primers (second primer pair) Pm1 and Pm2 (B). Lanes: 1, mold form of Penicillium marneffei human isolate 497H; 2, Penicillium sp. (not P. marneffei); 3, Aspergillus fumigatus; 4 and 5, mold and yeast forms of Histoplasma capsulatum, respectively; 6, Cryptococcus neoformans; 7, Candida albicans; 8, Candida krusei; 9, Streptococcus sp.; 10, human DNA; M, size marker of 100-bp-ladder standard DNA; C, negative control.

FIG. 2.

Regions of the primers RRF1 and RRH1 and specific primers Pm1 and Pm2, which are located on the P. marneffei 18S rRNA gene. Pm3 is the specific oligonucleotide probe, which was previously reported (25).

Single PCR with the specific primers Pm1 and Pm2 gave positive results with P. marneffei (Fig. 3). The amplified product was about 400 bp in length and was not observed in other fungi. However, a band with a size of about 200 bp could be seen in other Penicillium species and Aspergillus fumigatus. Additional experiments with DNA from eight environmental isolates of Penicillium species gave a negative PCR result with an approximately 400-bp fragment. Several isolates of P. marneffei from human and natural sources gave positive PCR results with specific primers Pm1 and Pm2 (Fig. 4). Good results were obtained with DNA from both mold and yeast forms of P. marneffei. The P. marneffei isolates used in this study were 13 human isolates, 12 bamboo rat isolates (DNA types I and II), and 1 soil isolate (DNA type II). All isolates were positive by the direct PCR assay with the specific primers Pm1 and Pm2.

FIG. 3.

Single PCR amplification of DNA from various organisms with specific primers Pm1 and Pm2. Lanes: 1, Penicillium sp. (not P. marneffei); 2, Aspergillus fumigatus; 3 and 4, mold and yeast forms of Histoplasma capsulatum, respectively; 5, Cryptococcus neoformans; 6, Candida albicans; 7, Candida krusei; 8, Streptococcus sp.; 9, human DNA; 10 and 11, Penicillium marneffei bamboo rat isolate SpB6203 and human isolate 497H, respectively; 12, water as a negative control; M and S, marker sizes of HindIII-digested lambda DNA and 100-bp-ladder DNA, respectively.

FIG. 4.

Single PCR results of Penicillium marneffei human and natural isolates by specific primer pair Pm1 and Pm2. Lanes: 1 to 8, P. marneffei human isolates 444H, 495H, 497H, 233H, 518H, 299H, 391H (ATCC 20050), and 502H, respectively; 9 to 11, P. marneffei bamboo rat isolates SpB0601, LiB4901, and SpB6203, respectively; 12, P. marneffei soil isolate SB0501 (ATCC 201564). Template DNAs were extracted by the rapid method (lanes 1 and 2 and 4 to 8) or by using their spheroplasts (lanes 3 and 9 to 12). Lanes M and S, marker sizes of HindIII-digested lambda DNA and 100-bp ladder DNA, respectively.

In this study, DNA which was extracted from the tested fungi by two different methods, gave different PCR results in the single PCR amplification with the primers Pm1 and Pm2. The PCR result obtained from the P. marneffei DNA extracted by the rapid procedure showed bands at 400 and 200 bp, whereas only a single band at 400 bp was demonstrated from the spheroplast-extracted DNA (Fig. 4). This might reflect the difference in the quality of target DNA. However, the extra band at approximately 200 bp did not interfere with the identification of this pathogenic fungus.

Sensitivities of the single PCR with specific primers Pm1 and Pm2 and nested PCR with primer pairs RRF1 and RRH1 and Pm1 and Pm2 were 1.0 pg/μl and 1.8 fg/μl, respectively (Fig. 5 and Fig. 6). Nucleotide sequence analysis of the amplified product from nested PCR revealed the correct 389-bp sequence of the P. marneffei rDNA gene (GenBank accession no. AF034197). This PCR assay proved to be specific and rapid for identification of P. marneffei grown on culture media. The time course for identification was reduced from 4 to 7 days with mold-to-yeast conversion to 7 and 10 h with single PCR and nested PCR, respectively. Positive results were obtained when the PCR method was performed with very young filamentous colonies approximately 2 mm in diameter (2-day-old culture on SGA medium). Single PCR seemed to be more simple, but nested PCR may increase the sensitivity of the detection system, as demonstrated in the diagnosis of Pneumocystis carinii pneumonia (15) and invasive aspergillosis (27). In disseminated P. marneffei infection without any significant symptoms, a more sensitive diagnostic method than a conventional culture technique will be necessary. The method described in this report, except for the DNA extraction, may be useful for the early diagnosis of P. marneffei infection or monitoring infected patients for successful treatment. More suitable methods for extraction of DNA from clinical specimens will be studied. The application needs further evaluation with a larger number of clinical samples.

FIG. 5.

Sensitivity of primers Pm1 and Pm2 in the single PCR amplification from various amounts of P. marneffei 497H DNA template and analyzed by agarose gel electrophoresis with ethidium bromide staining. Lanes: M, 100-bp-ladder DNA marker; 1 to 10, P. marneffei DNA template at 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, 1 pg, 0.5 pg, 0.25 pg, and 50 fg and H₂O, respectively.

FIG. 6.

Sensitivity of primers RRF1 and RRH1 (A) and inner primers Pm1 and Pm2 (B) in the nested PCR amplification. Lanes: M, 100-bp-ladder DNA marker; C, negative control; 1 to 10, P. marneffei 497H DNA template at 180 ng, 18 ng, 1.8 ng, 180 pg, 18 pg, 1.8 pg, 180 fg, 18 fg, 1.8 fg, and 0.18 fg, respectively.