Umami induces pulmonary epithelial senescence via L-glutamic acid-triggered minority MOMP

Abstract

Although cellular senescence in pulmonary epithelial cells is a recognized driver of chronic lung diseases, the role of dietary factors in initiating this process remains poorly defined. Here, we identify monosodium glutamate (MSG), the primary source of umami taste, as a trigger of a novel dietary-lung axis. We demonstrate that chronic intake of high amounts of MSG elevates pulmonary L-glutamic acid (Glu) levels, which activate an NMDAR–miMOMP signaling cascade in pulmonary epithelial cells, leading to cellular senescence and lung injury. This mechanism is consistent across multiple high-Glu diets, including high-fat and high-protein regimens. Furthermore, we demonstrate that high-Glu diets exacerbate pulmonary fibrosis progression by increasing the senescence burden. Our findings suggest that dietary Glu is a modifiable risk factor for chronic lung diseases and reveal that the NMDAR-miMOMP-senescence axis is a potential therapeutic target for metabolic respiratory syndromes.

Introduction

Monosodium glutamate (MSG), one of the most common food additives worldwide, is widely used in commercially processed foods to enhance umami taste¹. Over the past three decades, the demand for MSG has increased substantially. Concurrently, public concern has increased regarding the potential health effects of long-term MSG intake². Following a re-evaluation, the European Food Safety Authority established an acceptable daily intake of 30 mg/kg body weight/day in 2017³. However, surveys indicate that MSG intake in European countries ranges between 8 and 198 mg/kg body weight/day, with some consumers consuming up to 10 grams daily, suggesting that excessive MSG consumption remains widespread^4,5. Animal studies have shown that chronic, high-dose MSG intake can cause adverse effects on organs such as the liver, kidneys, and testes⁶, and can increase the prevalence of conditions such as hypertension, obesity, and asthma⁷. Nevertheless, the potential effect of high MSG intake on the physiological structure and function of the lungs, which are also vital for maintaining normal bodily functions, warrants further exploration.

L-Glutamic acid (Glu) is a crucial neurotransmitter involved in most excitatory synapses, thereby influencing brain physiology⁸. Abnormally high Glu concentrations lead to the overactivation of the Glu receptor N-methyl-D-aspartate receptors (NMDARs), resulting in mitochondrial dysfunction and the release of large amounts of reactive oxygen species (ROS) and ultimately inducing neuronal cell senescence^9–11. Cellular senescence occurs when cells enter an abnormal state after encountering irreparable damage. It can occur throughout the body and is a key driver in various diseases, including neurodegenerative disorders such as Alzheimer’s disease and Parkinson’s disease^12,13. Similar processes occur in the lungs. Studies have shown that overactivated NMDARs can exacerbate acute lung injury induced by sepsis and bleomycin^14–17, pulmonary fibrosis¹⁸, and hyperoxia-induced chronic lung disease¹⁹. Furthermore, senescent pulmonary epithelial cells are important drivers of chronic lung diseases such as pulmonary fibrosis and chronic obstructive pulmonary disease (COPD)^20,21. However, whether Glu similarly induces senescence in pulmonary epithelial cells and whether this process also depends on NMDARs remain to be elucidated.

Here, we focus on investigating the impact of elevated Glu levels resulting from high MSG intake on lung health and respiratory function. First, we found that increased Glu levels due to high MSG intake impair lung tissue health and lead to decreased respiratory function, a finding validated in other dietary models that also increase Glu levels. Subsequently, we demonstrated that this effect is partly attributable to the Glu-induced senescence of pulmonary epithelial cells, which is mediated via NMDAR-dependent minority mitochondrial outer membrane permeabilization (miMOMP). Finally, we showed that high MSG intake and other high-Glu diets exacerbate the extent of cellular senescence in pulmonary fibrosis, leading to more severe disease progression.

Results

A high-MSG diet induces lung injury by elevating pulmonary Glu concentration

To assess the effects of a high-MSG diet on the lungs, we administered drinking water containing 300 mM MSG (5% w/v) to mice for four to eight weeks, following the protocol of Andres-Hernando et al. ²² (Fig. 1A). We observed that the high-MSG diet significantly increased water consumption compared with the control group and led to rapid initial weight gain, consistent with existing research and confirming the reliability of the model (Fig. 1B, Fig. S1A). To better characterize the effect of high Glu on the lungs, we used the FlexiVent system to comprehensively evaluate murine lung function, as described by Lv et al. ²³ and Lv et al. ²⁴. The results revealed that several pulmonary function parameters, including inspiratory capacity (IC), respiratory system elastance (Ers), and respiratory system compliance (Crs), indicated significantly impaired lung function following prolonged MSG exposure, exhibiting a time-dependent relationship. Specifically, IC and Crs were significantly decreased, while Ers was significantly increased, reflecting increased lung stiffness and reduced distensibility in response to MSG. (Fig. 1C–E). Pathological sections of mouse lungs and their scoring revealed that long-term MSG consumption gradually increased the area of lung injury (Fig. 1F–H). Masson’s trichrome staining revealed localized fibrosis in the lungs of the MSG-fed mice. To investigate whether the observed lung injury and functional decline were associated with elevated Glu levels induced by the high-MSG diet, we first measured the Glu content in mouse lungs. The results revealed a significant increase in pulmonary Glu levels in the high-MSG group (Fig. 1J). Pulmonary Glu concentration was strongly and positively correlated with both lung function parameters and lung injury area (Fig. 1K–N). Therefore, increased pulmonary Glu concentration likely contributes to the lung injury caused by the high-MSG diet.

Fig. 1. Chronic MSG consumption drives pulmonary functional impairment through Glu accumulation.

A Schematic diagram of the experimental timeline for high-MSG diet administration. B Body weight change of mice during the 8-week high-MSG diet period. C–E Pulmonary function parameters measured by the flexivent system: (C) IC, (D) Ers, and (E) Crs in mice fed a control or high-MSG diet for 4 and 8 weeks. F–H Representative images of H&E-stained lung sections (F) and quantitative analysis of lung-injured area (G, H) after 4 and 8 weeks of high-MSG diet. I Representative Masson’s trichrome staining of lung sections after 8 weeks of high-MSG diet, indicating collagen deposition (blue). J Quantitative analysis of Glu concentration in lung tissues from mice fed a control or high-MSG diet for 8 weeks. K–N Correlation analysis between pulmonary Glu concentration and pulmonary function parameters (K–M) or lung injury area (N) in mice from the high-MSG diet group. O–R Effects of HFD: Representative H&E-stained lung sections (O) and quantitative analysis of lung injured area (P–Q), and fibrosis area (R) after 8 and 12 weeks of HFD feeding. S Pulmonary Glu concentration and (T) its correlation with lung injury area in HFD-fed mice. U–X Effects of HPD: Representative H&E-stained lung sections (U) and quantitative analysis of lung injured area (V, W), and fibrosis area (X) after 8 and 12 weeks of HPD feeding. Y Pulmonary Glu concentration and (Z) its correlation with lung injury area in HPD-fed mice. All data are presented as mean ± SEM. ns no significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group as indicated by one-way ANOVA or two-way ANOVA.

To further validate the critical role of Glu in MSG-induced lung injury, we conducted additional verification in other dietary models known to increase Glu levels. Current research indicates that a long-term high-fat diet (HFD) increases systemic Glu levels²⁵. Thus, we fed mice a HFD for eight to twelve weeks, during which time body weight increased significantly compared with that of the controls, confirming the reliability of the model (Fig. S1B). Pathological scoring of mouse lungs revealed that a HFD induced a time-dependent increase in the lung injury area and fibrosis (Fig. 1O–R), consistent with the findings of existing studies^26–28. We then confirmed the effect of a HFD on Glu concentration, observing a significant increase that positively correlated with the degree of lung injury (Fig. 1S, T), consistent with the trend observed for high-MSG diet. Subsequently, we tested the effects of a high-protein diet administered for eight to twelve weeks. Similar to a HFD, the long-term high-protein (HPD) diet also increases systemic Glu levels²⁹; however, the effect of HPD on the lungs requires investigation. Compared with the mice in the control group, the weight of the mice in the HPD group decreased (Fig. S1C). This finding is consistent with previous studies and confirms the success of the modeling process³⁰. This study revealed that, similar to the other two diets, the HPD led to increased lung injury and fibrosis (Fig. 1U–X), along with elevated Glu levels (Fig. 1Y). Further correlation analysis revealed a strong positive correlation between Glu concentration and HPD-induced lung injury (Fig. 1Z). In summary, we found that lung injury induced by the high-MSG diet was positively correlated with pulmonary Glu concentration, and this correlation was validated in other dietary regimens that increase Glu levels.

High-MSG diet-induced lung injury depends on Glu-mediated pulmonary epithelial cell senescence

Given that Glu can induce neuronal cell senescence, and senescence of pulmonary epithelial cells is a significant contributing factor to many chronic diseases, such as pulmonary fibrosis, we focused on examining senescence changes in pulmonary epithelial cells in mice fed a high-MSG diet. To determine whether a high-MSG diet induces pulmonary epithelial cell senescence, we first performed multiplex immunohistochemistry (mIHC) and costaining for the pulmonary epithelial cell marker AQP5 and the senescence marker p21. The staining results revealed a significant increase in the percentage of p21-positive pulmonary epithelial cells in response to a high-MSG diet (Fig. 2A, B), which strongly correlated with the Glu concentration (Fig. 2C). Similarly, other high-Glu diets, such as HFD and HPD, yielded comparable results (Fig. S2A–F). To further confirm whether Glu directly causes pulmonary epithelial cell senescence, we treated pulmonary epithelial A549 cells with Glu. Western blot analysis revealed significant upregulation of p21 expression in the Glu-treated A549 cells (Fig. 2D, E). β-galactosidase (β-gal) staining revealed a marked increase in the positive area of the pulmonary epithelial cells in the Glu-treated group (Fig. 2F). Furthermore, detection of typical senescence-associated secretory phenotype (SASP) factors such as IL-6 and IL-8 demonstrated that the transcription level of these genes were increased (Fig. 2G). Therefore, we concluded that Glu directly induces pulmonary epithelial cell senescence.

Fig. 2. Senescence of pulmonary epithelial cells is required for MSG-induced lung injury.

A, B Representative mIHC images (A) and quantitative analysis (B) of AQP5 and P21 co-staining showing pulmonary epithelial cell senescence after high-MSG diet. C Correlation analysis between pulmonary Glu concentration and P21-positive pulmonary epithelial cell ratio. D, E Western blot analysis (D) and quantitative analysis (E) of P21 protein levels in A549 cells treated with Glu. F Representative images and quantitative analysis of SA-β-gal staining in A549 cells treated with Glu. G mRNA expression levels of SASP factors IL-6 and IL-8 in A549 cells treated with Glu. H Schematic diagram of D + Q treatment timeline in high-MSG diet mice. I–K Pulmonary function parameters (I) IC, (J) Ers, and (K) Crs in high-MSG diet mice treated with D + Q. L, N Representative H&E-stained lung sections (L) and quantitative analysis of lung injury area (M-N) in D + Q-treated mice. O Representative Masson’s trichrome staining showing fibrosis in D + Q-treated mice. P, Q Representative mIHC images (P) and quantitative analysis (Q) of AQP5 and P21 co-staining showing pulmonary epithelial cell senescence in D + Q-treated mice. All data are presented as mean ± SEM. ns no significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group (B, E, G) or MSG group (I–K, Q) as determined by one-way ANOVA.

To further verify the role of pulmonary epithelial cell senescence in MSG-induced lung injury, we treated high-MSG diet-fed mice with dasatinib plus quercetin (D + Q), a recognized senolytic combination, and assessed lung function after four weeks (Fig. 2H). The results revealed that MSG exposure significantly impaired lung function, as evidenced by a marked reduction in inspiratory capacity (IC) and respiratory system compliance (Crs), alongside a concomitant increase in respiratory system elastance (Ers). Notably, the coadministration of D + Q partially reversed these pathological trends—effectively restoring IC and Crs while reducing Ers—in mice fed a high-MSG diet (Fig. 2I–K), despite the presence of similar pulmonary Glu concentrations. (Fig. S2G). H&E staining and pathological quantification revealed a reduced lung injury area in mice receiving D + Q (Fig. 2L–N). Masson’s trichrome staining also revealed that D + Q partially reversed the pulmonary fibrosis induced by the high-MSG diet (Fig. 2O). Additionally, mIHC staining revealed a significant reduction in the percentage of p21-positive pulmonary epithelial cells in D + Q-treated mice (Fig. 2P–Q). Thus, high-MSG diet-mediated lung injury and functional decline depend on Glu-induced pulmonary epithelial cell senescence.

Glu-mediated pulmonary epithelial cell senescence depends on NMDAR

We then explored the molecular process through which Glu induces pulmonary epithelial cell senescence and focused on NMDAR, a glutamate-activated cation channel. Excessively high Glu concentrations around neurons lead to overactivation of NMDARs, resulting in neuronal cell senescence^9–11. Therefore, we hypothesized that Glu-induced senescence in pulmonary epithelial cells might similarly depend on NMDARs. To test this hypothesis, we coadministered the NMDAR antagonist memantine (Mem) to mice fed a high-Glu diet for four weeks (Fig. 3A). Assessment of pulmonary mechanics revealed that Mem treatment significantly mitigated the decline in lung function induced by chronic MSG exposure. In contrast to the MSG-only group, which exhibited diminished IC and Crs coupled with elevated Ers, mice receiving Mem showed improved pulmonary compliance and reduced stiffness (Fig. 3B–D). Notably, these functional benefits were achieved at a similar concentration of Glu, further identifying NMDAR as the critical mediator of Glu-induced mechanical failure. (Fig. S3A). The results of H&E and Masson’s trichrome staining also revealed a reduction in both the lung injury area and fibrosis in Mem-treated mice (Fig. 3E–H). Subsequently, mIHC assessment of pulmonary epithelial cell senescence revealed that Mem decreased the proportion of senescent pulmonary epithelial cells (Fig. 3I–J). To further confirm the pivotal role of NMDAR in Glu-induced pulmonary epithelial senescence, we treated pulmonary epithelial cells with Glu alongside the NMDAR antagonist MK-801. β-gal staining and Western blot results indicated that MK-801 partially alleviated Glu-induced pulmonary epithelial senescence (Fig. 3K–M), and these effects were further validated by measuring SASP expression levels (Fig. 3N). These results demonstrate that Glu-mediated pulmonary epithelial senescence is dependent on NMDARs.

Fig. 3. NMDAR inhibition mitigates glutamate-induced pulmonary senescence and injury.

A Schematic diagram of Mem treatment in high-MSG diet mice. B–D Pulmonary function parameters (B) IC, (C) Ers, and (D) Crs in high-MSG diet mice treated with Mem. E–G Representative H&E-stained lung sections (E) and quantitative analysis of lung injury area F, G in Mem-treated mice. H Representative Masson’s trichrome staining showing fibrosis in Mem-treated mice. I, J Representative mIHC images (I) and quantitative analysis (J) of AQP5 and P21 co-staining in Mem-treated mice. K Representative images of SA-β-gal staining in A549 cells treated with Glu and MK-801. L, M Western blot analysis (L) and quantitative analysis (M) of P21 protein levels in A549 cells treated with Glu and MK-801. N mRNA expression levels of SASP factors IL-6 and IL-8 in A549 cells treated with Glu and MK-801. All data are presented as mean ± SEM. ns no significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. MSG group as determined by one-way ANOVA.

Glu induces pulmonary epithelial cell senescence by triggering miMOMP

Activation of NMDARs in neuronal cells promotes massive calcium influx, leading to the disruption of mitochondrial structure and ultimately cell senescence. Therefore, we first used JC-1 staining to assess the mitochondrial membrane potential in Glu-treated pulmonary epithelial cells (Fig. 4A). Results showed that Glu decreased mitochondrial membrane potential compared with the control group, although the decrease was considerably less than that induced by the positive control CCCP (Fig. 4B). This pattern is characteristic of miMOMP, which occurs specifically during cellular senescence and is recognized as its critical promoter^31,32. Immunofluorescence costaining further confirmed that Glu treatment triggered cytochrome c (Cyto-C) release from only a minority of mitochondria within an intact TOMM20-labeled network, providing direct morphological evidence for the occurrence of miMOMP (Fig. S4A). When we coadministered the NMDAR antagonist MK-801 or silenced NMDAR, this phenomenon was partially reversed (Fig. S4B–E). Thus, we hypothesized that elevated Glu concentrations activate NMDARs, leading to miMOMP in pulmonary epithelial cells and subsequently inducing senescence. To test this hypothesis, we examined another key feature of miMOMP: the activation of cleaved caspase-3 (c-CASP3). Western blot and flow cytometry analyses revealed increased c-CASP3 expression in Glu-treated cells; however, this did not lead to apoptosis compared with that in CCCP-treated cells. (Fig. 4C–E). Furthermore, cotreatment with the pancaspase inhibitor Z-VAD-FMK (Z-VAD) significantly reduced the number of Glu-induced miMOMPs (Fig. 4F, G). Additionally, β-gal staining and Western blot results revealed that Z-VAD cotreatment partially reversed Glu-induced pulmonary epithelial senescence (Fig. 4H–J). These findings were also confirmed by qRT‒PCR analysis of SASP transcript levels (Fig. 4K–L). In conclusion, we determined that Glu promotes pulmonary epithelial cell senescence by inducing miMOMP.

Fig. 4. miMOMP serves as the critical linker between NMDARs and pulmonary epithelial senescence.

A Representative fluorescence images of JC-1 staining in A549 treated with Glu or CCCP. B Quantitative analysis of JC-1 aggregate/monomer fluorescence ratio. C, D Representative images of Western blot analysis (C) and quantitative analysis (D) of c-CASP3 and P21 protein levels in A549 treated with Glu. E Flow cytometry analysis of apoptosis in A549 cells treated with Glu or CCCP. F, G Representative images (F) and quantitative analysis (G) of JC-1 staining in A549 treated with Glu in the presence or absence of Z-VAD. H SA-β-gal staining in A549 treated with Glu in the presence or absence of Z-VAD. I, J Representative images of Western blot analysis (I) and quantitative analysis (J) of P21 protein levels in A549 treated with Glu in the presence or absence of Z-VAD. K, L mRNA expression levels of SASP factors IL-6 (K) and IL-8 (L) measured by qRT-PCR in A549 treated with Glu in the presence or absence of Z-VAD. All data are presented as mean ± SEM. ns no significance, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group (B, D, E), CCCP group (D, E), or MSG group (J–L) as determined by one-way ANOVA.

High-MSG diets and other high-Glu diets exacerbate pulmonary fibrosis

Because high-MSG diets and other high-Glu diets can induce pulmonary epithelial cell senescence, and pulmonary epithelial cell senescence is considered a key driver of pulmonary fibrosis, we hypothesized that high-Glu diets might exacerbate the progression of pulmonary fibrosis. To test this hypothesis, we treated mice with 3 mg/kg bleomycin combined with a high-Glu diet (Fig. 5A). Lung H&E staining and pathological quantification revealed a greater lung injury area in bleomycin-treated mice than in control mice (Fig. 5B–D). Masson’s trichrome and Sirius red staining indicated increased fibrosis, confirming successful model establishment (Fig. 5E–F). Compared with the bleomycin-only treatment, the high-Glu diet further aggravated lung injury and fibrosis. Pulmonary Glu levels significantly increased after bleomycin treatment, and these levels were further elevated by high-Glu diets and were positively correlated with the extent of pathological injury (Fig. S5A–B). The mIHC results subsequently demonstrated that bleomycin treatment alone increased pulmonary epithelial cell senescence, and high-Glu diet further enhanced this trend, showing a positive correlation with Glu concentration (Fig. 5G–H, Fig. S5C). Based on these data, we conclude that high-Glu diets exacerbate pulmonary fibrosis by promoting pulmonary epithelial cell senescence.

Fig. 5. High-MSG and other high-Glu diets exacerbate pulmonary fibrosis.

A Schematic diagram of the experimental timeline for bleomycin-induced pulmonary fibrosis combined with high-Glu diets. B–D Representative images of H&E-stained lung sections (B) and quantitative analysis of lung injury area (C, D) in mice treated with bleomycin and/or high-Glu diets. E, F Representative images of Masson’s trichrome (E) and Sirius red (F) staining showing collagen deposition in lung tissues under different treatment conditions. G, H Representative mIHC images (G) and quantitative analysis (H) of P21 and AQP5 co-staining showing pulmonary epithelial cell senescence in different treatment groups. All data are presented as mean ± SEM. **p < 0.01, ****p < 0.0001 vs. Ble group, as determined by one-way ANOVA.

Discussion

In this study, we reveal a novel and previously unrecognized pathway through which chronic intake of high amounts of MSG, a ubiquitous umami flavor enhancer, detrimentally affects lung health. We demonstrate that dietary MSG leads to elevated pulmonary Glu levels, which drive cellular senescence in pulmonary epithelial cells via NMDAR activation and a subsequent, subtler form of mitochondrial dysfunction known as miMOMP. This Glu-induced senescence is a critical mediator of the observed lung injury and functional decline. Furthermore, we establish the pathophysiological relevance of this mechanism by showing that high-Glu diets exacerbate bleomycin-induced pulmonary fibrosis, a condition in which cellular senescence is a known driver (Fig. 6).

Fig. 6. Dietary Glu initiates pulmonary epithelial senescence through NMDAR-dependent miMOMP.

Chronic consumption of MSG and other high-glutamate diets elevates pulmonary glutamate levels, activating NMDAR in pulmonary epithelial cells. This receptor triggers miMOMP, a sublethal event that promotes pulmonary epithelial senescence. The resulting accumulation of senescent pulmonary epithelial cells drives lung injury and functional decline, while also exacerbating the progression of pulmonary fibrosis. The cartoons were created with biogdp.com³³.

Our findings significantly expand the understanding of the physiological impact of MSG beyond its well-documented effects on metabolic disorders and neurotoxicity. While the liver, kidneys, and central nervous system have been primary foci of MSG toxicity research, the lungs have remained relatively unexplored. The correlation between pulmonary Glu concentration and the degree of lung injury and functional impairment across three distinct dietary models—high-MSG, high-HFD, and high-HPD—provides compelling evidence that Glu is a common, critical mediator. These findings suggest that elevated pulmonary Glu levels are a potential novel risk factor for environmental or diet-induced lung damage, moving the narrative beyond MSG as merely a culinary additive to a modulator of systemic homeostasis.

Mechanistically, we elucidated a coherent signaling cascade in which Glu engages the NMDAR on pulmonary epithelial cells, triggering miMOMP activity as the key downstream event that culminates in cellular senescence. This makes miMOMP a pivotal integrator of metabolic stress (high Glu) and the aging program in the lung, offering a specific subcellular target for interventions.

The translational implications of our study are twofold. First, from a public health perspective, it raises concerns about the long-term effects of chronically high MSG intake on lung health, particularly in populations with preexisting lung conditions or heightened susceptibility. Our data from the bleomycin fibrosis model demonstrate that a high-Glu diet can act as a potent disease modifier, accelerating pathology by increasing the senescent cell burden. These findings suggest that dietary modulation of Glu intake could be a plausible, albeit challenging, adjunctive strategy for managing chronic lung diseases. Second, from a therapeutic standpoint, our findings point to the NMDAR and the miMOMP pathway as potential therapeutic targets for preventing diet-associated or senescence-associated lung damage. The use of senolytics (D + Q) to ameliorate MSG-induced injury provides a proof-of-concept for targeting the senescence program itself.

While this study provides compelling evidence for the existence of a dietary-lung axis, several limitations should be considered when interpreting the findings:

Physiological Relevance of the MSG Model: We successfully established a robust murine model using 300 mM MSG in drinking water, which consistently elevated pulmonary glutamate (Glu) levels and successfully recapitulated the pathological features of lung injury and senescence. While this high-dose approach was necessary to clearly delineate the NMDAR–miMOMP signaling pathway within a controlled experimental timeframe, the calculated human equivalent dose (HED) of approximately 1.37 g/kg/day exceeds typical dietary patterns. Future investigations utilizing lower, more clinically representative dosages over extended periods are warranted to evaluate the cumulative impact of moderate MSG consumption on long-term lung health.

Biological Divergence in Cell Models: Our mechanistic investigations primarily utilized the A549 cell line, which provided a stable and reproducible platform for identifying the Glu-NMDAR signaling cascade. However, A549 cells may exhibit metabolic and signaling profiles that differ from those of healthy tissue. Although our in vivo data largely mirror these cellular findings, validating this axis in primary alveolar epithelial cells would further strengthen the physiological relevance of our conclusions.

Depth of the Glutamate-Dependent Mechanism: Through multiple dietary models and pharmacological inhibition, we identified NMDAR as a key mediator of Glu-induced pulmonary damage. However, while our results implicate epithelial NMDAR signaling as a primary driver of senescence, direct evidence of functional NMDAR activity specifically within pulmonary epithelial cells in vivo remains limited. Given the broad and heterogeneous expression of glutamate receptors across various lung cell types, additional clarification of epithelial-specific NMDAR engagement—perhaps through the development of cell-specific genetic knockout models—would significantly strengthen the mechanistic interpretation of our study. Furthermore, the mechanistic evidence could be refined by precisely quantifying local Glu concentrations within the epithelial microenvironment using advanced mass spectrometry to determine if these levels align with the thresholds required for receptor activation. Finally, while NMDAR activation appears central, the potential contributory roles of other glutamate receptors, such as metabotropic glutamate receptors (mGluRs), remain to be explored to provide a more comprehensive map of the response to metabolic Glu fluctuations.

Causality and Detection of miMOMP-Driven Senescence: We characterized the senescent phenotype through a combination of p21 expression, SA-β-gal staining, and selected SASP factors. While these markers are highly suggestive of miMOMP-mediated senescence, inclusion of additional senescence markers in vivo would strengthen confidence in the phenotype. Additionally, the use of Memantine and senolytics (Dasatinib plus Quercetin) provided strong proof-of-concept that targeting the NMDAR-senescence axis can ameliorate MSG-induced injury. However, given the pleiotropic nature of these compounds, we cannot entirely exclude the possibility that their protective effects involve non-specific anti-inflammatory or antioxidant pathways. The development of tissue-specific genetic knockout models would represent a significant step toward isolating the exact molecular requirements for these therapeutic benefits.

Confounding Factors in Complex Diet Models: We observed a consistent correlation between elevated pulmonary Glu and lung injury across high-fat (HFD) and high-protein (HPD) dietary models. While these results support Glu as a common mediator of diet-induced lung damage, HFD and HPD exert broad systemic effects on lipid metabolism and systemic inflammation. Further interventional studies specifically blocking Glu production or transport within these complex dietary contexts are necessary to confirm Glu as the primary driver of the observed pulmonary pathology.

In conclusion, we have delineated a coherent pathway from dietary umami intake to pulmonary senescence and injury, centered on Glu and its receptor, NMDAR. This work not only reveals a novel dimension of MSG biology but also contributes to the growing understanding of how metabolic and dietary cues can directly influence organ aging and fibrosis through fundamental cellular processes such as senescence. Future studies exploring the role of this pathway in human lung diseases and the efficacy of NMDAR antagonists or senolytics in clinical contexts are warranted.

Methods

Animal Study and Approval

C57BL/6 J male mice, sourced from Vital River Laboratory Animal Technology Co., Ltd. (Jiaxing, China), were maintained under specific pathogen-free (SPF) conditions with a regulated 12-hour light/dark cycle. Animals were provided standard food and water. All experimental procedures received prior approval from the Center for Drug Safety Evaluation and Research of Zhejiang University and were executed in compliance with the Institutional Animal Care and Use Committee (IACUC) guidelines of Zhejiang University (ethical approval number: IACUC-s21-008). Following a one-week acclimatization period, mice were subjected to treatments. For terminal procedures, animals were anesthetized using 2% isoflurane and euthanized by cervical dislocation.

Monosodium glutamate (MSG, T35369, TargetMol, USA) was prepared in sterile water. Bleomycin hydrochloride (T6116L, TargetMol, USA) was diluted in sterile phosphate-buffered saline (PBS). Memantine (T20993, TargetMol, USA), Dasatinib (T1448, TargetMol, USA), and Quercetin (T2174, TargetMol, USA) were initially dissolved in cyclodextrin (Aladdin, H108813) as stock solutions. Mice (aged 7-10 weeks) received weekly oral gavage of the senolytic combination (5 mg/kg Dasatinib plus 50 mg/kg Quercetin) formulated in cyclodextrin, or daily intraperitoneal injections of 10 mg/kg Memantine prepared in corn oil, over a 28-day period.

Histopathological and Immunohistochemical Analysis

Upon euthanasia, lung tissues were excised and segmented. The right lobe was immediately snap-frozen in liquid nitrogen for subsequent storage at −80 °C. The left lobe was immersion-fixed in 4% paraformaldehyde (PFA, P6148, Sigma-Aldrich, USA), followed by paraffin embedding and sectioning into 4 μm slices. These sections were then subjected to standard protocols for H&E, Masson’s trichrome, and Sirius red staining.

mIHC was performed by Hunan Aifang Biological according to established procedures. Primary antibodies employed were: AQP5 (20334-1-AP, Wuhan Sanying, China) and P21 (HA722685, Huabio, China).

Cell Culture and Drug Treatment

The human pulmonary epithelial cell line A549 was obtained from the Typical Culture Collection Committee of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 medium (31800, Gibco, USA) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin, and maintained at 37 °C in a humidified atmosphere containing 5% CO₂. All cell lines were routinely confirmed to be free of mycoplasma contamination.

For experiments, cells were exposed to L-Glutamic acid (Glu, T2A2497, TargetMol, USA) at concentrations of 50, 100, or 200 μM for designated durations. In specified conditions, cells were co-treated with 10 μM Z-VAD-FMK (MedChemExpress, China), 10 μM CCCP (C2003S, Beyotime, China), or 50 μM MK-801 (T6259, TargetMol, USA).

JC-1 Assay

The fluorescent probe JC-1 (C2003S, Beyotime, China) was utilized to monitor mitochondrial depolarization. Post-treatment, A549 cells were trypsinized, resuspended, and incubated with 5 μM JC-1 at 37 °C for 20 min protected from light. Cells were then washed, resuspended in assay buffer, and analyzed immediately under a fluorescence microscope (IX81-FV1000, Olympus, Japan).

Western Blot

Cellular or tissue protein extracts were prepared using a lysis buffer composed of 150 mM NaCl, 50 mM Tris-HCl, 2 mM EGTA, 2 mM EDTA, 25 mM β-glycerophosphate, 25 mM NaF, 0.3% Triton X-100, 0.3% NP-40, 0.3% leupeptin, 0.1% NaVO₃, and 0.1% PMSF. Protein samples (30-50 μg per lane) were resolved by electrophoresis on 8%, 10%, or 12% SDS-polyacrylamide gels and subsequently transferred onto 0.45 μm polyvinylidene fluoride (PVDF) membranes (IPVH00010, Millipore, USA). After blocking with non-fat milk, membranes were incubated with specific primary antibodies overnight, followed by incubation with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies. Protein bands were visualized using an enhanced chemiluminescence (ECL Plus) detection kit (P2300, NCM Biotech, China).

The primary antibodies used for immunoblotting were: c-CASP3 (ET1602-47, HuaBio, China), GAPDH (ET1601-4, HuaBio, China), and P21 (HA722685, HuaBio, China).

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated from treated cells using TRIzol reagent (15596026, Thermo Scientific, USA). Equivalent amounts of RNA were reverse-transcribed into cDNA utilizing a commercial cDNA synthesis kit (AT311, TransGen Biotech, China). Quantitative real-time PCR was performed on a QuantStudio 3 real-time PCR system (A28132, Applied Biosystems, Singapore) with TB Green Premix Ex Taq (RR420A, Takara, Japan). The relative expression levels of target genes were normalized to GAPDH and calculated using the 2^-ΔΔCt method. The primer sequences were as follows:

IL-6 forward: CCACTCACCTCTTCAGAACG

IL-6 reverse: CATCTTTGGAAGGTTCAGGTTG

IL-8 forward: ATACTCCAAACCTTTCCACCC

IL-8 reverse: TCTGCACCCAGTTTTCCTTG

GAPDH forward: ACATCGCTCAGACACCATG

GAPDH reverse: TGTAGTTGAGGTCAATGAAGGG

Flow cytometry analysis

The rate of cellular apoptosis was determined using an Annexin V-FITC/Propidium Iodide (PI) Apoptosis Detection Kit (AP101, MultiSciences Biotech, China). Briefly, A549 cells were seeded in 12-well plates, treated as indicated, harvested, and washed with PBS. Cells were then stained with Annexin V-FITC and PI according to the manufacturer’s instructions. The stained cells were analyzed promptly using a CytoFLEX flow cytometer (B53015, Beckman Coulter, China) to distinguish viable, early apoptotic, late apoptotic, and necrotic cell populations.

Cell transfection

For transient gene knockdown, A549 cells were plated in 12-well plates and allowed to reach approximately 50% confluence. Cells were then transfected with either non-targeting control siRNA (si-NC) or gene-specific siRNAs targeting NMDAR using a commercial siRNA transfection reagent (409-10, Polyplus Transfection, France), adhering to the provided protocol. The following oligonucleotides were provided by GenePharma (Shanghai, China) as siRNAs targeting specific genes:

si NMDAR#1 sence: 5’- CCUCGGACAAGUUUAUCUA (dT)(dT)-3’

si NMDAR#2 sence: 5’- GCGUGUGGUUUGAGAUGAU (dT)(dT) -3’

Pulmonary function test

Respiratory parameters in mice were measured using the flexivent system. Mice were anesthetized, positioned supinely, and securely restrained. Following a midline cervical incision to expose the trachea, an endotracheal cannula was inserted between the tracheal rings and connected to the ventilator. Pulmonary function metrics, including IC, Ers, and Crs, were recorded and analyzed using the accompanying FlexiWare software.

Statistical analysis

All quantitative data are presented as the mean ± standard error of the mean (SEM). Statistical analyses and graph generation were conducted with GraphPad Prism software (Version 8.0). For comparisons between two experimental groups, an unpaired, two-tailed Student’s t-test was applied. When comparing more than two groups, one-way analysis of variance (ANOVA) was employed. A p-value of less than 0.05 was considered statistically significant.

Author contributions

Zizheng Gao and Jiaqi Zhang designed and performed the experiments, analyzed data, and wrote the manuscript draft. Yang Zhao established the animal models and performed histopathological evaluations. Bo Yang and Qiaojun He provided critical intellectual input and revised the manuscript. Zizheng Gao and Peihua Luo conceived the study, supervised all experiments, and finalized the manuscript. All authors reviewed, edited, and approved the final version.

Data availability

All datasets supporting the conclusions of this study are available from the corresponding author upon reasonable request.

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s41538-026-00783-x.