GPR176 represses mitophagy to promote the progression of osteosarcoma by facilitating mTORC1 activity via PI3K-AKT pathway

Abstract

Background

Osteosarcoma (OS) is a common primary malignant tumor of the bone. It is reported that abnormal GPR176 expression contributes to the occurrence and subsequent progression of tumors. However, the role of GPR176 in OS has not been elucidated. Thus, the aim of this study was to evaluate the role of GPR176 in the progression of OS.

Methods

The expression level and prognosis of GPR176 were explored based on Gene Expression Omnibus (GEO), TARGET and Genotype-Tissue Expression (GTEx) databases, as well as the involved pathways. Effects of GPR176 on the proliferation, migration, invasion, and apoptosis of U2OS cells, as well as in a mouse tumor xenograft model. Multiple parameters were employed to explore the role of GPR176 in mitophagy, including mitochondrial membrane potential (MMP), reactive oxygen species (ROS), and mitophagy-related proteins. The protein levels of downstream substrates of mTORC1 were analyzed by Western blot.

Results

The expression level of GPR176 was obviously elevated in OS, and increased GPR176 expression associated with poor prognosis in patients with OS. Gene Set Enrichment Analysis (GSEA) showed that GPR176 is mainly involved in the oxidative phosphorylation, retinol metabolism, and ErbB signaling pathways. GPR176 knockdown suppressed the proliferation, migration, and invasion of U2OS cells and enhanced their apoptosis. GPR176 downregulation also induced mitophagy in U2OS cells, as evidenced by an increase in ROS levels; a decrease in MMP, adenosine triphosphate (ATP), and mitochondrial DNA (mtDNA); and concomitant changes in mitophagy-related proteins. GPR176 knockdown suppresses mTORC1 activity in U2OS cells. Moreover, GPR176 knockdown represses the growth of tumor xenografts in vivo while promoting mitophagy. The levels of phosphorylated-mechanistic target of rapamycin complex 1 (p-mTORC1)/mTORC1, p-v-akt murine thymoma viral oncogene homolog 1 (AKT)/AKT, and p-phosphatidylinositol-3 kinase (PI3K)/PI3K were significantly downregulated following GPR176 knockdown.

Conclusions

GPR176 is upregulated in OS and is associated with a poor prognosis. GPR176 suppresses mitophagy to promote OS progression by facilitating mTORC1 activity via the PI3K-AKT pathway.

Highlight box.

Key findings

• GPR176 is an oncogene in osteosarcoma (OS).

• GPR176 regulates mitophagy in OS.

• Downregulation of GPR176 facilitates mitophagy in OS cells by suppressing mTORC1 activity via PI3K-AKT pathway.

What is known and what is new?

• GPR176, a G-protein coupled receptor, has been implicated in the progression of several cancers. Mitophagy plays a critical role in tumorigenesis, and mTORC1 is a known negative regulator of mitophagy. A previous study indicated that GPR176 inhibits mitophagy in colorectal cancer.

• This study is the first to identify GPR176 as an oncogene in OS. It delineates a novel mechanism whereby GPR176 promotes OS progression by activating mTORC1 signaling to suppress mitophagy, providing new insights into OS pathogenesis.

What is the implication, and what should change now?

• GPR176 serves as a novel prognostic biomarker and a potential therapeutic target for OS. Targeting the GPR176/mTORC1/mitophagy axis may represent a promising strategy for OS treatment.

• Further research is warranted to validate these findings in clinical samples and to develop specific inhibitors targeting GPR176 for translational application in OS therapy.

Introduction

Osteosarcoma (OS) is a primary bone malignancy with the highest incidence among adolescents and young adults (1). It usually occurs in the growing bones, especially during puberty, with tumor growth frequently occurring in the femur, tibia, and humerus (2). The main clinical features of OS are pain, swelling, localized redness, fever, fracture, and movement limitations (3). Due to the high malignancy and rapid progression of OS, most patients are already at an advanced disease stage at the time of diagnosis (4). However, the five-year survival rate of patients with late-stage OS is <20%, and the prognosis of patients with OS is poor with a high mortality risk (5). Therefore, exploring biomarkers associated with OS can provide candidate targets for the early diagnosis and treatment of OS.

Mitophagy is the selective encapsulation and degradation of damaged mitochondria by cells via autophagy to maintain mitochondrial and intracellular homeostasis (6). Mitochondrial regulation plays a significant role in the occurrence and progression of tumors (7). As an important mechanism for mitochondrial quality control, mitophagy-mediated mitochondrial elimination plays a crucial role in many processes, including early embryonic development, cell differentiation, inflammation, and apoptosis (8,9). The dysregulation of mitophagy can lead to the accumulation of damaged mitochondria, which play critical roles in carcinogenesis and tumor progression (10,11). Although Wang et al. reported that the MEK5-ERK5 pathway regulates mitophagy to accelerate the tumorigenesis of OS cells by mediating Nur77 (12), more studies are needed to investigate the association between mitophagy and OS development.

G-protein-coupled receptors (GPCR) constitute the largest family of drug targets (13). Dysregulation of GPCR facilitates the occurrence and metastasis of tumors and regulates cancer cells (14). Previous studies have reported that abnormal GPR176 expression might contribute to the occurrence and subsequent progression of tumors (15,16). For instance, Ni et al. reported that GPR176 is a biomarker for predicting prognosis and immune infiltration in stomach adenocarcinoma (15). Yang et al. found that exosomal miR-382-5p prevents pre-metastatic niche formation by inhibiting GPR176/GNAS-CXCR1/CXCR2 axis in colorectal cancer liver metastasis (17). Zhang et al. indicated that high expression of GPR176 predicts poor prognosis in patients with gastric cancer and promotes the proliferation, migration, and invasion of gastric cancer cells (18). While the role of GPR176 in OS has not been elucidated, GPR176 has been reported to regulate mitophagy in colorectal cancer (19). Thus, the functions and mechanisms of GPR176, particularly its role in mitophagy, were explored in this study. This study identified novel targets for OS diagnosis and treatment. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-2146/rc).

Methods

Bioinformatics analysis

Two OS-related gene expression profile datasets, GSE19276 and GSE39058, were acquired from Gene Expression Omnibus (GEO) database. The GSE19276 dataset comprised 44 OS and five normal samples, and the GSE39058 dataset contained 47 OS samples. In addition, the OS-related dataset including 83 OS samples was obtained from the TARGET database, the information of 70 pericancerous samples was derived from the Genotype-Tissue Expression (GTEx) database, and the TARGET and GTEx databases were merged to create a new dataset. The GSE19276 and TARGET/GTEx merged datasets were used to explore the expression levels of GPR176, and the GSE39058 dataset was used to analyze the prognosis of GPR176 in OS, followed by Gene Set Enrichment Analysis (GSEA). Moreover, this study combined GPR176 with five mitophagy-related prognostic biomarkers of OS (KLK2, NRXN1, HES5, OR2W3, and HS3ST4) (20) to construct a multi-parameter prognostic model. Subsequently, risk score was calculated with the following formula:

$$RiskScore={\displaystyle \sum \left({\beta }_i\times Ex{p}_i\right)}$$ [1]

The patients in TARGET-OS, GSE39058, and GSE21257 datasets were stratified into high- and low-risk groups according to the optimal cutoff values. Kaplan-Meier (KM) curves were then plotted to compare survival differences between risk groups using ggsurvplot in Survminer. Receiver operating characteristic (ROC) curves for 1-, 3-, and 5-year survival were plotted separately for the TARGET-OS, GSE39058, and GSE21257 datasets, using the timeROC package. Correlation analysis was conducted to explore the association between GPR176 and mitophagy (PRKN and MAP1LC3A)/mTORC1 activity (RPS6KB1)-related markers based on the TARGET-OS dataset. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.

Cell culture and transfection

The OS cell lines, HOS (#CL-0360), MG63 (#CL-0157), U2OS (#CL-0236), and Saos-2 (#CL-0202), were obtained from Pricella (Wuhan, China). HOS and MG63 cells were cultured in minimum essential medium (MEM) medium (#12492013, Gibco, Grand Island, NY, USA), while U2OS and Saos-2 cells were cultured in McCoy’s 5A medium (#16600082, Gibco) supplemented with 10% fetal bovine serum (FBS) (#16140071, Gibco) and 1% penicillin/streptomycin (#SV30010, Hyclone, Logan, USA). Human osteoblast cells hFOB1.19 (#ml096328, Millipore, Burlington, USA) were grown in Dulbecco’s Modified Eagle Medium (DMEM) medium (#6123034, Gibco). For transfection, shGPR176 was designed using the Designer of Small Interfering RNA website. The sequences used for shRNA in this study were contained sense: 5'-GCTCGGAAACTTCATGGTGTT-3'; antisense: 5'-AACACCATGAAGTTTCCGAGC-3'. U2OS cells (2×10⁵) were grown to 70–90% confluence and transfected with a lentivirus composed of either shGPR176 or shNC for 24 h. A commercial Cell Counting Kit-8 (CCK-8) kit (#C0037; Beyotime, Shanghai, China) was used to investigate cell viability.

Invasion assay

After the cells were diluted with basic medium into a cell suspension of 1×10⁵ cells/mL, 600 µL cell suspension was added to 24-well Transwell chambers coated with or without 50 mg/mL Matrigel. Cells were then treated with anhydrous methanol and stained with crystal violet (#G1063-100mL, Solarbio, Beijing, China). The cells in each group were examined under an inverted microscope (CKX53; Olympus, Tokyo, Japan).

Wound healing assay

After digestion with trypsin, the cells were cultured in six-well culture plates at 2–4×10⁵ cells/well. The horizontal lines on the back of the six-well plates were drawn with a marker pen, and a scratch perpendicular to the horizontal line was made across the cell monolayer using a pipette tip in the next day. Scratched cells were collected by washing with phosphate-buffered saline (PBS), followed by the addition of serum-free medium. Scratch wound healing was assessed at 0 and 24 h.

Flow cytometry

After 24 h of culture, the cells were digested with trypsin. Binding buffer (195 µL) was then added to suspend the cells, and then fixed with 5 µL of Annexin V-FITC. Subsequently, 10 µL propidium iodide was employed to stain cells, and apoptosis was detected. For mitochondrial membrane potential (MMP) detection, one milliliter JC-1 solution was added to same volume of cell suspension at 37 ℃ for 20 min. Reactive oxygen species (ROS) levels were measured using an ROS Detection kit (#S0033S, Beyotime). Finally, the cells were sorted and analyzed using a flow cytometer (Beckman, CytoFLEX S).

Immunofluorescence

The expression and localization of LC3B were explored using immunofluorescence. Briefly, MitoTracker Green (#C1048, Beyotime) was used to stain the cells. The cells were then fixed with 4% paraformaldehyde, followed by the addition of 0.5% Triton-X-100 (#T8200, Solarbio). Cells were incubated with anti-LC3 (1:250, #AL221, Beyotime) at 4 ℃ overnight after blocking with goat serum (#SL038, Solarbio) and further incubation with secondary antibody. After 4',6-diamidino-2-phenylindole (DAPI; #C1005, Beyotime) staining for 5 min, cells were observed under the fluorescence microscope.

Mitochondrial DNA (mtDNA) copy number

Genomic DNA was extracted from the cells using a Genomic DNA Mini Preparation Kit (#D0063, Beyotime) according to the manufacturer’s instructions. The mtDNA copy number was measured with the ND1 forward primer 5'-CCCTAAAACCCGCCACATCT-3' and the reverse primer 5'-TCAGGGGAGAGTGCGTCATA-3', and GAPDH forward primer 5'-GGAGCGAGATCCCTCCAAAAT-3' and the reverse primer 5'-GGCTGTTGTCATACTTCTCATGG-3'.

Adenosine triphosphate (ATP) detection

Cellular ATP content was measured using an ATP Assay Kit (#S0026, Beyotime) according to the manufacturer’s instructions.

Xenograft tumor model

After one week of adaptation, BALB/c nude mice (male, 4 weeks old) were stochastically separated into three groups (n=6) and subcutaneously injected with 1×10⁷ cells stably transfected with shNC or shGPR176. One week after injection, the tumor size was assessed with a caliper every five days. After 25 days, the mice were sacrificed by cervical dislocation and the xenograft tumors were resected and weighed. All experimental procedures were approved by the Laboratory Animal Welfare and Ethics Committee of Zhongyan Zichuang (Beijing) Biotechnology Co., Ltd. (Ethics No. ZYZC202504011S), which was carried out in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines, EU Directive 2010/63/EU for animal experiments.

Immunohistochemistry

Tumor tissues were placed in 4% formaldehyde to fix for 24 h, and further embedded in paraffin and cut into 4 µm sections. The sections were then dewaxed, hydrated, and incubated with primary antibody Ki67 (1:200, #AF0198, Affinity, Cincinnati, USA) at 4 ℃ overnight. Next, the sections were incubated with a secondary antibody (1:2,000, #A0208, Beyotime) for 10–15 min. Following 3,3-diaminobenzidine (DAB) color development (#P0202, Beyotime) and hematoxylin (#G1080, Solarbio) counterstaining, sections were observed under a microscope.

Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)

Total RNA was collected using TRIzol (#15596018, Invitrogen) and reverse transcribed into cDNA using FastKing-RT SuperMix (#KR118-02, TIANGEN, Beijing, China). SYBR Green PCR Master Mix (#A4004M, Life Technologies) was used for qRT-PCR. The primer sequences are listed in Table 1. GAPDH was used as the internal control.

Table 1. The primer sequences used for qRT-PCR.

Gene	Primers (5'-3')
GPR176
Forward	GTGGTGGTGTTCCTCTTCTT
Reverse	TGGGAGGCATAGGGAATAGA
GAPDH
Forward	GGAGCGAGATCCCTCCAAAAT
Reverse	GGCTGTTGTCATACTTCTCATGG

qRT-PCR, quantitative reverse transcriptase polymerase chain reaction.

Western blot

RIPA buffer (#P0013B, Beyotime) was added to the cells for extraction of total protein, and the protein concentration was determined using a bicinchoninic acid (BCA) kit (#PC0020, Solarbio). Proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (#FFP24; Beyotime). The blocked membranes were incubated with specific primary antibodies against GPR176 (1:1,000, #ab250759, Abcam, Cambridge, UK), Bax (1:1,000, #ab32503, Abcam), Bcl-2 (1:2,000, #ab182858, Abcam), Pro caspase-3 (1:10,000, #ab32499, Abcam), cleaved caspases-3 (1:1,000, #9661, CST, Danvers, USA), P62 (1:1,000, #ab240635, Abcam), LC3 II/I (1:2,000, #ab192890, Abcam), PINK1 (1:1,000, #ab216144, Abcam), parkin (1:1,000, #2132, CST), p-S6K1 (1:500, #ab59208, Abcam), S6K1 (1:10,000, #ab32529, Abcam), p-4EBP1 (1:2,000, #ab75767, Abcam), 4EBP1 (1:2,000, #ab32024, Abcam), p-mTORC1 (1:1,000, #AF3308, Affinity), mTORC1 (1:1,000, #AF6308, Affinity), p-AKT (1:1,000, #9271, CST), AKT (1:1,000, #9272, CST), p-PI3K (1:2,000, #AF3241, Affinity), PI3K (1:2,000, #AF6241, Affinity), and GAPDH (1:10,000, #ab181602, Abcam) at 4 ℃ overnight. Membranes were then incubated with Goat Anti-Rabbit IgG secondary antibody (1:10,000, #A0208, Beyotime) for one hour. Membranes were developed using enhanced chemiluminescence (#34579, Pierce, Rockford, USA).

Statistical analysis

Data were identified as mean ± standard deviation, and statistical analysis was carried out using GraphPad 7.0 software by one-way analysis of variance with Tukey’s post-hoc test. Statistical significance was set at P<0.05.

Results

GPR176 is upregulated in OS and related to poor prognosis

Based on the GSE19276 and TARGET/GTEx merged datasets, the expression of GPR176 was elevated in OS (all P<0.05; Figure 1A,1B). qRT-PCR and Western blotting confirmed these results (Figure 1C,1D). Furthermore, survival analysis revealed that upregulated GPR176 expression was associated with a poor prognosis in patients with OS (P=0.02; Figure 1E). In addition, this study combined GPR176 with five reported mitophagy-related prognostic biomarkers in OS (KLK2, NRXN1, HES5, OR2W3, and HS3ST4) (20) to construct a multi-parameter prognostic model and evaluate its effectiveness in improving risk stratification in OS. A six-mitophagy-related gene prognostic model was constructed based on the five mitophagy-related prognostic biomarkers and GPR176. Herein, the prognostic model of the five mitophagy-related genes was considered the control model. Patients from the TARGET-OS, GSE39058, and GSE21257 datasets were stratified into high- and low-risk groups using the optimal cutoff values. Survival analysis revealed that high-risk patients exhibited significantly shorter survival in both datasets (TARGET-OS: P<0.0001; GSE39058: P=0.006; GSE21257: P=0.01), and the area under the curve (AUC) values for 1-, 3-, and 5-year survival of the six mitophagy-related gene prognostic models in TARGET-OS, GSE39058, and GSE21257 were higher than those in the control model (Figures S1-S3). To further investigate the pathogenesis of OS, GSEA of GPR176 was conducted. The results showed that GPR176 was primarily involved in oxidative phosphorylation, retinol metabolism, and the ErbB signaling pathway (Figure 1F). These data demonstrate that GPR176 is overexpressed in OS and is associated with poor prognosis in patients with OS.

Figure 1.

GPR176 is upregulated in OS and related to poor prognosis. The expression level of GPR176 explored in GSE19276 dataset (A) and TARGET/GTEx merged dataset (B). The mRNA (C) and protein (D) expression levels of GPR176 in OS. (E) Survival analysis of GPR176 in OS. (F) GSEA of GPR176. *, P<0.05; **, P<0.01; ****, P<0.0001. GSEA, Gene Set Enrichment Analysis; OS, osteosarcoma.

Knockdown of GPR176 represses the malignant features of OS cells

A loss-of-function experiment was performed to evaluate the function of GPR176 in OS. In this study, the U2OS cell line was selected for the shRNA-mediated knockdown experiments because GPR176 expression was the highest in this cell line. Transfection efficacy was determined using qRT-PCR and Western blotting (Figure 2A,2B). CCK-8, Transwell, flow cytometry, and wound healing assays were conducted, and the results showed that GPR176 downregulation effectively alleviated the proliferation, migration, and invasion of U2OS cells, while facilitating apoptosis (all P<0.05; Figure 2C-2F). Furthermore, the expression of apoptosis-related proteins was assessed, and the results showed that the protein levels of Bax and cleaved caspases-3 were both markedly elevated after GPR176 knockdown, while those of Bcl-2 and pro caspase-3 were decreased (all P<0.05; Figure 2G). These data suggest that GPR176 knockdown suppresses tumorigenesis in OS.

Figure 2.

GPR176 knockdown can suppress the tumorigenesis of OS. Transfection efficiency was detected by qRT-PCR (A) and Western blot (B). (C) The proliferation of U2OS cells was detected using CCK-8 assay. (D) The invasion ability of U2OS cells was explored using Transwell assay (crystal violet staining). (E) The migration ability of U2OS cells was detected using wound healing assay. (F) The apoptosis of U2OS cells was detected using flow cytometry. (G) The levels of apoptosis-related proteins in U2OS cells were detected by Western blot. Scale bar: 200 µm. *, P<0.05; **, P<0.01. CCK-8, Cell Counting Kit-8; OS, osteosarcoma; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction.

GPR176 regulates mitophagy in OS

The effect of GPR176 on mitophagy was also investigated in U2OS cells. Correlation analysis revealed that GPR176 was significantly negatively correlated with PRKN and MAP1LC3A based on the TARGET-OS dataset (Figure S4A). Immunofluorescence revealed that the LC3 protein, which co-localized with mitochondria, was significantly increased after GPR176 knockdown (P<0.01; Figure 3A). In addition, the protein levels of mitophagy-related proteins were explored, and the results showed that the protein level of P62 in U2OS cells remarkably decreased after GPR176 downregulation, while LC3 II/I, PINK1, and parkin showed the opposite trend (all P<0.05; Figure 3B). Additionally, ROS levels were elevated after shGPR176 treatment, while MMP, ATP, and mtDNA levels were reduced (all P<0.01; Figure 3C-3F). These results indicate that GPR176 downregulation facilitates mitophagy in OS cells.

Figure 3.

Downregulation of GPR176 induces mitophagy in OS cells. (A) The location and expression of LC3 were detected by immunofluorescence. Scale bar: 40 µm. (B) The protein expression levels of P62, LC3 II/I, PINK1, and parkin (mitophagy-related proteins) were detected by Western blotting. (C) The mitochondrial membrane potential (JC-1 red/green) was detected by flow cytometry. (D) The ROS was measured by flow cytometry. (E) ATP content detection. (F) The mtDNA content detection. *, P<0.05; **, P<0.01. ATP, adenosine triphosphate; mtDNA, mitochondrial DNA; OS, osteosarcoma; ROS, reactive oxygen species.

Downregulation of GPR176 facilitates mitophagy in OS cells by suppressing mTORC1 activity via PI3K-AKT pathway

In this study, GSEA showed that GPR176 was mainly involved in the oxidative phosphorylation pathway (Figure 1F). The oxidative phosphorylation inhibitor, metformin, inhibits the growth of hepatocellular carcinoma and the activity of mTORC1 (21), and mTORC1 inhibits mitophagy (19,22). mTORC1 comprises three core components: mTOR, Raptor, and mLST8 (23). In addition, Yang et al. found that GPR176 overexpression increases the phosphorylation of mTOR (24). In addition, correlation analysis revealed that GPR176 was significantly negatively correlated with RPS6KB1 based on the TARGET-OS dataset (Figure S4B). Thus, we suspected that GPR176 might suppress mitophagy by promoting mTORC1 activity to facilitate tumorigenesis in OS. To verify this hypothesis, cells were treated with five µM MHY1485 (mTORC1 activator) for 12 h after 48 h of transfection. As illustrated in Figure 4A, the phosphorylation levels of S6K1 and 4EBP1 (downstream substrates of mTORC1) were significantly attenuated in U2OS cells after GPR176 knockdown (all P<0.01), whereas MHY1485 (an mTORC1 activator) treatment reversed this trend (all P<0.05; Figure 4B). Moreover, MHY1485 treatment remarkably decreased the level of LC3 protein that co-localized with mitochondria after GPR176 knockdown (all P<0.05; Figure 4C). Addition of MHY1485 also altered the protein levels of P62, LC3 II/I, PINK1, and parkin in U2OS cells caused by GPR176 downregulation (all P<0.05; Figure 4D). These findings highlight that GPR176 suppresses mitophagy by promoting mTORC1 activity to facilitate tumorigenesis in OS.

Figure 4.

GPR176 represses mitophagy to promote the progression of OS by facilitating mTORC1 activity via PI3K-AKT pathway. (A) The phosphorylation levels of S6K1 and 4EBP1 in U2OS cells after GPR176 knockdown detected by Western blot. (B) The phosphorylation levels of S6K1 and 4EBP1 in U2OS cells after MHY1485 treatment detected by Western blot. (C) The location and expression of LC3 were detected by immunofluorescence. Scale bar: 40 µm. (D) The protein expression of P62, LC3 II/I, PINK1, and parkin (mitophagy-related proteins) was detected by Western blot. (E) The expression levels of PI3K-AKT-related proteins were detected by Western blott. *P<0.05, **P<0.01 compared with shNC group; ^P<0.05, ^^P<0.01 compared with shGPR176 group. OS, osteosarcoma.

Moreover, it’s reported that the PI3K-AKT-mTORC1 axis mediates mitophagy and improves mitochondrial function (25). Yang et al. found that GPR176 overexpression increased the expression of p-Akt and p-mTOR, promoted proliferation, and inhibited apoptosis of ovarian cancer cells by activating the PI3K-Akt-mTOR pathway (24). Thus, we speculated that GPR176 downregulation might facilitate mitophagy in OS cells by suppressing mTORC1 activity via the PI3K-AKT pathway. As illustrated in Figure 4E, the levels of p-mTORC1/mTORC1, p-AKT/AKT, and p-PI3K/PI3K were significantly downregulated after GPR176 knockdown (all P<0.05). These data suggest that GPR176 suppresses mitophagy by promoting mTORC1 activity to facilitate OS tumorigenesis via the PI3K-AKT pathway.

Knockdown of GPR176 inhibits the growth of OS xenografts in vivo

The effect of GPR176 on OS was confirmed using a mouse xenograft model. As shown in Figure 5A-5C, the growth of tumor xenografts in mice was inhibited after GPR176 knockdown, as evidenced by an obvious decrease in tumor volume and weight (all P<0.01). In addition, immunohistochemistry revealed that shGPR176 injection significantly reduced Ki67 expression (P<0.01; Figure 5D). In addition, Western blot showed that the protein level of P62 in U2OS cells was remarkably reduced after GPR176 downregulation, while LC3 II/I, PINK1, and parkin showed the opposite trend (all P<0.05; Figure 5E). These results revealed that the GPR176 knockdown mitigated the growth of OS xenografts in vivo.

Figure 5.

Knockdown of GPR176 inhibits the growth of OS xenografts in vivo. (A) The morphology of the mouse model and separated tumor xenografts. (B) The tumor volume. (C) The tumor weight. (D) Ki67 expression measured by immunohistochemistry. Scale bar: 20 µm. (E) The protein expression levels of P62, LC3 II/I, PINK1, and parkin (mitophagy-related proteins) were detected by Western blot. *, P<0.05; **, P<0.01.

Discussion

OS is a common primary malignant bone tumor (26). In the present study, we explored the role and potential mechanisms of action of GPR176 in OS progression. This study revealed that GPR176 is upregulated in OS and is related to poor prognosis and that GPR176 represses mitophagy to promote the progression of OS by facilitating mTORC1 activity.

GPR176, a member of the GPCR family, is a cell surface receptor that participates in the response to growth factors, hormones, and neurotransmitters (27). Numerous studies have reported that GPR176 is involved in tumorigenesis and tumor development. For example, Zhang et al. found that the upregulation of GPR176 predicts poor prognosis in patients with gastric cancer and accelerates the tumorigenesis of gastric cancer cells (18). Similarly, Yun et al. revealed that GPR176 overexpression may participate in esophageal cancer carcinogenesis and promote chemoresistance and lipogenesis (28). Consistently, this study found that GPR176 was highly expressed in OS and positively correlated with poor prognosis in patients with OS. In addition, GSEA revealed that GPR176 was principally involved in the oxidative phosphorylation, retinol metabolism, and ErbB signaling pathways. Deng et al. showed that elevated oxidative phosphorylation is linked to cancer stemness, a determinant of chemoresistance (29). Cao et al. suggested that genetic variants in retinol metabolism pathway genes are associated with the risk of prostate cancer (30). Additionally, ErbB family members have been implicated in breast cancer tumorigenicity, including ErbB1/EGFR/HER-1, ErbB2/HER-2, and ErbB3/HER-3 (31). Li et al. reported that NSUN7 promotes cervical cancer progression through activation of the ErbB signaling pathway (32). These findings indicate that GPR176 may play a significant role in the development of OS via oxidative phosphorylation, retinol metabolism, and the ErbB signaling pathway. However, the mechanism through which GPR176 influences OS requires further investigation. GPR176 knockdown alleviated the proliferation, migration, and invasion of U2OS cells and enhanced their apoptosis. Moreover, GPR176 knockdown suppressed the growth of tumor xenografts in vivo. These data indicate that GPR176 is involved in oncogenesis and tumor development in OS.

Mitophagy plays a significant role in various human diseases such as cancers, cardiovascular disease, metabolic disease, and neurodegenerative disorders, via the clearing of dysfunctional or excess mitochondria from cells (33-35). Wu et al. showed that USP26 restrains PRKN-mediated mitophagy to facilitate tumorigenesis in colorectal cancer (36). A recent study suggested that NDUFAF6 promotes breast cancer progression by inhibiting mitophagy and apoptosis (37). In this study, immunofluorescence revealed that the LC3 protein, which co-localizes with mitochondria, showed an increasing trend after GPR176 knockdown, and the protein levels of mitophagy-related proteins were dysregulated after GPR176 downregulation. Additionally, MMP expression was reduced after shGPR176 treatment, whereas ROS levels were elevated. These results indicate that GPR176 downregulation facilitates mitophagy in OS cells. Notably, Zheng et al. suggested that soy isoflavones facilitate mitophagy via the AKT/mTOR signaling pathway to repress the progression of OS (38). Tang et al. emphasized that the GPR176/GNAS complex facilitates the progression of colorectal cancer by restraining cell mitophagy (19). Taken together, these findings indicate that GPR176 activates mitophagy, which is the primary mechanism by which GPR176 facilitates OS progression.

The mechanistic targets of the mTORC1 signaling hub integrate numerous environmental signals to regulate cell growth and metabolism (39). Numerous studies have shown that mTORC1 plays a significant role in cancer development and progression. For instance, Wu et al. showed that cystine in a nutritional formula activates mTORC1 to facilitate colon cancer growth and chemotherapy resistance (40). Liang et al. found that the TRAF2-p62 complex activated the mTORC1 pathway to accelerate the survival and proliferation of liver cancer cells (41). Jeong et al. highlighted that inhibition of phosphodiesterase 4D regulates the growth of pancreatic cancer cells by suppressing mTORC1 signaling (42). In this study, the phosphorylation levels of both S6K1 and 4EBP1 (downstream substrates of mTORC1) were attenuated in U2OS cells after GPR176 knockdown, indicating that the downregulation of GPR176 could suppress mTORC1 activity in OS. To confirm this result, mTORC1 was activated by MHY1485 for subsequent analyses. MHY1485 treatment reverses the effects of GPR176 knockdown on mitophagy. Therefore, GPR176 suppresses mitophagy by promoting mTORC1 activity to facilitate tumorigenesis in OS. In addition, the levels of p-mTORC1/mTORC1, p-AKT/AKT, and p-PI3K/PI3K were significantly downregulated following GPR176 knockdown. These data suggest that GPR176 represses mitophagy to promote OS progression by facilitating mTORC1 activity via the PI3K-AKT pathway.

Although this study determined the role and potential mechanism of action of GPR176 in OS progression, some limitations should be considered. First, the focus here was on the effect of GPR176 on mitophagy in OS through the facilitation of mTORC1 activity. Additional studies are required to investigate other underlying mechanisms. Second, mitophagy activators or inhibitors should be used to confirm the effect of GPR176 on OS by regulating mitophagy. Third, mTORC1 was only evaluated in vitro; therefore, in vivo experiments are needed to confirm this finding. Moreover, the correlation between GPR176 protein expression and prognosis, autophagy markers, and mTORC1 activity should be validated based on clinical cohort. Lastly, GPR176 functioning in OS via influencing oxidative phosphorylation, retinol metabolism, and Erb signaling pathways should be further explored.

Conclusions

In summary, this study shows that GPR176 is an oncogene involved in OS that represses mitophagy to promote OS progression by facilitating mTORC1 activity via the PI3K-AKT pathway. This study provides new insights into the early diagnosis of OS and potential therapeutic targets for OS treatment.

Supplementary

The article’s supplementary files as

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. All experimental procedures were approved by the Laboratory Animal Welfare and Ethics Committee of Zhongyan Zichuang (Beijing) Biotechnology Co., Ltd. (Ethics No. ZYZC202504011S), which was carried out in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines, EU Directive 2010/63/EU for animal experiment.

Data Sharing Statement

Available at https://tcr.amegroups.com/article/view/10.21037/tcr-2025-2146/dss

tcr-15-03-193-dss.pdf ^{(93.6KB, pdf)}

DOI: 10.21037/tcr-2025-2146