Mesenchymal stem cell-derived miR-125b-1-3p-abundant exosomes alleviate osteoarthritis by modulating the KDM6B-H3K27me3-FOXM1 axis

Abstract

Background

Osteoarthritis (OA) is a prevalent degenerative joint disorder characterized by the gradual deterioration of articular cartilage and the presence of inflammatory responses. In recent years, the use of exosomes (Exos) derived from bone marrow-derived mesenchymal stem cells (BMSCs) has emerged as a promising novel therapeutic approach for OA because of the role of these cells in tissue repair and immunomodulation. This study aimed to elucidate the functions and molecular mechanisms of miR-125b-1-3p, which is enriched in BMSC-Exos, in the progression of OA.

Methods

An in vitro OA model was constructed by exposing chondrocytes to IL-1β, followed by treatment with BMSC-Exos, to evaluate their protective effects. miRNA sequencing was performed to analyse the miRNA expression profile in BMSC-Exos, identifying miR-125b-1-3p as a pivotal molecule. Dual-luciferase reporter assays and chromatin immunoprecipitation quantitative PCR (ChIP‒qPCR) were used to further validate the target genes of miR-125b-1-3p and its downstream regulatory network. Additionally, a rat OA model was constructed, and the therapeutic effects of miR-125b-1-3p in BMSC-Exos were verified in vivo through safranin O staining, HE staining, and immunohistochemical analysis.

Results

MicroRNA (miRNA) sequencing revealed that compared with its expression in untreated normal chondrocytes, the expression of miR-125b-1-3p was significantly enriched in BMSC-Exos but downregulated in IL-1β-induced OA chondrocytes. Functional experiments demonstrated that BMSC-Exos delivered miR-125b-1-3p, which markedly enhanced chondrocyte anabolism and migration while inhibiting apoptosis, thereby alleviating OA progression. Mechanistic studies revealed that miR-125b-1-3p targeted the histone demethylase KDM6B, resulting in increased H3K27me3 enrichment at the FOXM1 promoter region and epigenetic suppression of FOXM1 expression, ultimately exerting chondroprotective effects.

Conclusion

This study elucidates a novel molecular mechanism through which BMSC-Exos shuttle miR-125b-1-3p to alleviate OA by modulating the KDM6B/H3K27me3/FOXM1 signalling axis. These findings provide a theoretical rationale and identify promising therapeutic targets for the development of exosome-based therapeutic strategies against OA.

Graphical abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s13018-026-06765-9.

Background

Osteoarthritis (OA) is a common degenerative orthopaedic disease. Approximately 500 million people worldwide are affected by OA, accounting for 7% of the global population [1]. With the ageing of the global population and the increasing prevalence of obesity, OA is projected to become the leading cause of disability worldwide by 2030 [2]. Currently, the treatment of OA faces numerous challenges that urgently need to be overcome [3]. Most of the drugs currently used to treat OA can only relieve joint pain, while effective therapies for improving joint damage have not yet emerged.

Bone marrow-derived mesenchymal stem cells (BMSCs) are adult stem cells with self-renewal ability and multilineage differentiation potential that can differentiate into osteoblasts and chondrocytes [4]. These cells migrate to inflammation and injury sites, promoting cartilage repair, and have thus recently become a research focus for cartilage treatment [5, 6]. However, the clinical application of BMSCs is limited by potential oncogenic risks, invasive sampling procedures, low cell yield, decreased proliferative capacity with passage, the impaired differentiation of BMSCs from elderly donors, and ethical issues [7, 8]. Additionally, cell-based therapies struggle with cell preservation [9, 10]. Consequently, researchers are exploring alternative cell-independent treatments.

Exosomes are a subclass of extracellular vesicles (EVs) with a diameter of 30–200 nm. They are secreted into the extracellular space via the fusion of vesicular membranes with the plasma membrane and mediate various biological functions [11, 12]. As natural nanocarriers, exosomes facilitate the transfer of various biochemical substances, including lipids, mRNAs, miRNAs, and proteins, thus playing a crucial role in intercellular communication [13–15]. The unique surface ligands of exosomes allow them to selectively bind to target cells, enabling the precise delivery of their cargo and the modulation of distinct biological functions [16, 17]. Preclinical and clinical investigations have demonstrated that exosomes recapitulate many therapeutic properties of mesenchymal stem cells (MSCs) [18]. Like MSCs, exosomes exhibit remarkable capabilities in tissue repair, inflammation resolution, and immune regulation [19].

MicroRNAs (miRNAs), a group of small noncoding RNAs, play important roles in the pathogenesis of OA. These molecules regulate gene expression posttranscriptionally, influencing various cellular processes relevant to OA development [20, 21]. Numerous investigations have identified specific miRNAs that are aberrantly expressed in OA [22, 23]. For example, under physiological conditions, miR-17 is highly expressed in both superficial and middle zone chondrocytes and plays a crucial role in maintaining the balance between physiological catabolism and anabolism, mainly by regulating the HIF-1α signalling pathway [24]. MicroRNA-224-5p has the potential to maintain OA homeostasis through the simultaneous regulation of cartilage degradation and synovial inflammation [25]. Additionally, exosomal miR-26b-5p derived from M2 macrophages alleviates osteoarthritis by regulating macrophage polarization and chondrocyte hypertrophy through targeting COL10A1 and TLR3 [26]. MicroRNA-125b-5p modulates IL-1β-induced inflammatory gene expression in human osteoarthritic chondrocytes via the targeted inhibition of TRAF6-mediated NF-κB and MAPK signalling pathways [27]. Moreover, the downregulation of KDM6B protects against aberrant force-induced osteoarthritis by epigenetically regulating NR4A1, which plays a key role in maintaining cartilage health under abnormal mechanical stress [28]. We hypothesized that BMSC-derived exosomes carrying miR-125b-1-3p may regulate OA progression by targeting KDM6B.

To test this hypothesis, in this study, we explored in depth the mechanism through which exosomal miR-125b-1-3p derived from BMSCs inhibits the degeneration of chondrocytes in OA by targeting KDM6B. The results are expected to provide new directions for the clinical research and treatment of OA.

Methods

Isolation and culture of rat BMSCs and chondrocytes

All animal experiments were performed in compliance with the guidelines of the Animal Research Committee of Tongren Hospital Affiliated with Shanghai Jiao Tong University School of Medicine. BMSCs were isolated and cultured following a previously reported methodology. Healthy 12-week-old male SD rats were selected, anaesthetized and euthanized with pentobarbital sodium (200 mg/kg), disinfected with 75% ethanol and fixed on a clean bench. The skin and muscles on the outer side of the lower limbs were incised to obtain the femurs and tibias, which were placed in PBS to remove the attached tissues. The bone ends were transected to expose the bone marrow cavity, which was irrigated with culture medium. The cell suspension was collected and centrifuged, and the supernatant was discarded. The cells were resuspended in DMEM/F12 medium supplemented with 10% foetal bovine serum (FBS) and 1% penicillin–streptomycin (P/S), seeded into culture flasks after their density was adjusted, and cultured at 37 °C in a 5% CO₂ incubator. The culture medium was replaced every two days, and adherent cells were passaged upon reaching 70–80% confluence.

To isolate chondrocytes, the skin over the knee joints of rats was incised under sterile conditions, and the articular cartilage tissue was carefully dissected. The tissue was rinsed 5 times with PBS containing double antibiotics (penicillin and streptomycin) to remove residual blood and impurities. The rinsed cartilage tissue was minced into small fragments of approximately 1 mm³ and transferred to a centrifuge tube. First, an appropriate amount of 0.25% trypsin was added, and the tube was incubated in a 37 °C thermostatic shaker for 30 min of digestion. During this period, it was shaken occasionally to promote digestion. Subsequently, the trypsin digestion solution was discarded, and the tissue was rinsed 3 times with PBS. Next, DMEM/F12 medium containing 0.2% type II collagenase was added, and digestion continued in an incubator at 37 °C with 5% CO₂ for 6 h until the cartilage tissue was completely digested to form a single-cell suspension.

The single-cell suspension was filtered through a 200-mesh sieve to eliminate undigested tissue clumps. The filtrate was centrifuged at 1500 r/min for 10 min, after which the supernatant was discarded. The cell pellet was resuspended in DMEM/F12 supplemented with 10% foetal bovine serum and 1% penicillin‒streptomycin. After the cell density was adjusted, the cells were placed into a culture flask and maintained in a 37 °C incubator with 5% CO₂. The culture medium was refreshed every 2 to 3 days.

Isolation and identification of exosomes

In subsequent experiments, BMSCs from passages 3–5 were used. After reaching 50–60% confluence, the cells were further cultured in FBS without exosomes at 37 °C and 5% CO₂ for 48 h. The cell culture supernatant was harvested. First, the supernatant was centrifuged at 300×g for 15 min at 4 °C to remove cells, followed by centrifugation at 2500×g for 15 min to eliminate cell debris. The supernatant was then filtered through a 0.22-μm membrane filter. The filtrate was subjected to ultracentrifugation at 100,000×g for 70 min at 4 °C. After the supernatant was discarded, the pellet was resuspended in PBS and centrifuged again at 100,000×g for 70 min. Finally, the pellet was resuspended in 200 μl of PBS to obtain exosomes from rat bone marrow mesenchymal stem cells. Nanosight tracking analysis (NTA; Nanosight Ltd., Novato, CA) was employed to determine the concentration and size distribution of the exosomes. Transmission electron microscopy (TEM; Tecnai 12, Philips, Best, the Netherlands) was utilised to characterise the morphology of the exosomes. Western blotting was used to detect exosomal surface markers, including TSG101 and CD63.

RNA isolation and quantitative real‑time PCR (qRT‑PCR)

Total RNA was purified from cells and exosomes using TRIzol reagent (Invitrogen). After the RNA concentration was determined, cDNA was generated using a reverse transcription system (R232-01; Vazyme, China), and qPCR was performed on an ABI Quant Studio 3 Fast Real-Time PCR System (Applied Biosystems, CA, USA) using SYBR Green PCR Master Mix (Q711-02; Vazyme, China). U6 was adopted as the internal reference for miRNA quantification, while GAPDH served as the endogenous control for mRNA analysis. Relative expression levels were analysed using the 2^(-ΔΔCt) method. Each qRT‒PCR was performed with 3 technical replicates per biological replicate, and the data were analysed on the basis of 3 independent biological replicates. The primers used in this experiment were synthesized by GENEWIZ (Suzhou, China), and the primers used for real-time PCR are listed in Table 1.

Table 1.

Primers of the genes in this study

Gene name	Sequences (5′–3′)
miR-125b-1-3p	F: GCGACGGGTTAGGCTCTTG
	R: AGTGCAGGGTCCGAGGTATT
Collagen II	F: GCCCAACTGGCAAACAAGGAGAC
	R: GCAGGGCCAGAAGTACCC TGATC
Aggrecan	F: CACTTTACTCTTGGTCTTTGTG
	R: AGTGAGTTGTCATGGTCTG
MMP13	F: TTTCCTCCTGGACCAAACC
	R: AGTTGTAGCCTTTGGAGCT
ADAMTS5	F: ACAACCAGCTAGGTGATGAC
	R: AATGATGCCCACATAAATCCTC
KDM6B	F: TGAAACCGAAGATCAACACTG
	R: TGCTCTCCAAATAAATGCTGG
FOXM1	F: ACCAAGTGTTTAAGCCACTG
	R: CAGGATTGGGTCGTTTCTG
GAPDH	F: CCTGGAGAAACCTGCCAAGTAT
	R: TAGCCCAGGATGCCCTTTAGT
U6	F: CTCGCTTCGGCAGCACATATACT
	R: ACGCTTCACGAATTTGCGTGTC

F, forward; R, reverse.

Immunofluorescence staining

Chondrocytes were seeded into 35 mm glass-bottom confocal culture dishes. Once the cells reached an optimal density, the culture medium was discarded, and the cells were washed three times with PBS. The cells were fixed with 4% paraformaldehyde for 20 min, followed by another rinse with PBS. Afterwards, the cells were permeabilized with 0.1% Triton X-100 for 15 min and washed with PBS. The cells were then blocked with 5% BSA for 1 h, followed by incubation with anti-collagen II antibody (sc-52658, Santa Cruz) and anti-MMP13 antibody (sc-515284, Santa Cruz) at 4 °C overnight. The following day, the primary antibodies were removed, and the cells were washed with PBS prior to incubation with fluorescently labelled secondary antibodies at room temperature in the dark for 2 h. After the secondary antibodies were discarded and the cells were rinsed with PBS, the nuclei were stained with DAPI for 5 min, followed by 2 additional rinses with PBS. Finally, the cells were observed and imaged under a fluorescence microscope. For quantitative analysis, immunofluorescence images were captured from 3 independent biological replicates, with 5 random fields selected per sample for quantitative analysis.

Western blot analysis

Total proteins were isolated from cell or exosome samples using RIPA buffer. Proteins were quantified using a BCA protein assay kit (Thermo Fisher Scientific). An SDS‒PAGE gel was prepared, the samples were loaded, and electrophoresis was performed. After electrophoresis was completed, the proteins were transferred to a PVDF membrane via the wet transfer method. The membrane was blocked with 5% nonfat milk powder at room temperature for 1 h. Primary antibodies against CD63 (25682-1-AP; Proteintech), CD9 (20597-1-AP; Proteintech), collagen II (sc-52658; Santa Cruz), MMP13 (sc-515284; Santa Cruz), ADAMTS5 (DF13268-50; Affinity), aggrecan (sc-33695; Santa Cruz), Bax (ab32503; Abcam), BCL-2 (ab32124; Abcam), KDM6B (55354-1-AP; Proteintech), H3K27me3 (9733T; CST), and GAPDH (60004-1-Ig; Proteintech) were added and incubated at 4 °C overnight. The next day, the membrane was washed with TBST, HRP-labelled secondary antibody was added, and the membrane was incubated at room temperature for 1 h. The membrane was washed with TBST again, ECL chemiluminescentreagent was added, and the membrane was exposed for development in a chemiluminescence imaging system.

Cell induction and transfection

Chondrocytes in the logarithmic growth phase were seeded into culture dishes. When the cells adhered to the dish and reached 60–70% confluence, the medium was replaced with IL-1β medium containing a final concentration of 10 ng/mL for induction. This concentration was selected on the basis of previous studies showing that it effectively induces an OA-like phenotype in chondrocytes without excessive cell death [29]. The cells were continuously cultured for 48 h, as preliminary experiments and the literature confirmed that this time point is sufficient to establish a stable OA model [30]. Moreover, BMSCs in the logarithmic growth phase were removed, and miR-125b-1-3p mimics and the control were transfected into the cells using Lipofectamine 3000. Six hours later, the medium was replaced with exosome-depleted FBS-free DMEM/F12, and the cells were further cultured for 48 h. Then, the exosomes from BMSCs (exo-miR-125b-1-3p and exo-miR-NC) were collected to treat the chondrocytes for subsequent experiments.

Transwell measurement of chondrocyte migration

A total of 5 × 10⁴ osteoarthritic chondrocytes were seeded into the upper chamber of a Transwell insert (pore size: 8 μm), and DMEM/F12 medium containing 10% foetal bovine serum was added to the lower chamber. The culture plate was then incubated in a 37 °C incubator with 5% CO₂ for 16 h. After the incubation, the medium in the upper chamber was removed, and the insert was gently washed twice with PBS. Unmigrated cells on the upper surface of the membrane were carefully scraped off with a cotton swab. Cells in the lower chamber were fixed with 4% paraformaldehyde for 15 min, rinsed with PBS, stained with 0.1% crystal violet for 20 min, and then washed three additional times with PBS. For quantitative analysis, a Transwell migration assay was performed with three independent biological replicates. Five random visual fields were selected per insert, and the number of stained migrated cells was counted under a Leica microscope (Leica Microsystems, Wetzlar, Germany) for subsequent statistical analysis.

Apoptosis assays

The treated chondrocytes were digested with trypsin (without EDTA), and then the digestion was terminated with medium containing 10% foetal bovine serum. The cells were transferred to a centrifuge tube and centrifuged at 1000×g for 5 min; the cell pellet was then resuspended in prechilled PBS and recentrifuged at 1000×g for 5 min, after which the supernatant was discarded. Subsequently, according to the instructions of the kit (Annexin V-FITC/PI Apoptosis Kit; APExBIO, K2003), the cells were resuspended in 1 × binding buffer, and the cell density was adjusted to 1 × 10⁶ cells/mL. A 100-μL aliquot of the cell suspension was transferred to a new centrifuge tube, to which 5 μL of Annexin V-FITC and 5 μL of PI were added. The mixture was gently vortexed and incubated at room temperature in the dark for 15 min. Finally, 400 μL of 1× binding buffer was added, and the cells were immediately visualized, imaged, and analysed under a fluorescence microscope. The apoptosis assay was conducted with three independent biological replicates for each biological sample to calculate the apoptotic rate for subsequent statistical analysis.

Dual-luciferase reporter gene assay

A luciferase reporter gene vector, pds131-psicheck-2, containing the 3'-UTR sequence (wild-type or mutant-type) of the KDM6B gene was constructed. The recombinant plasmid was verified through restriction enzyme digestion and DNA sequencing. HEK293T cells were seeded into a 12-well plate. Upon reaching 60%-70% confluence, the cells were cotransfected with the constructed reporter gene vector and either the miR-125b-1-3p mimic or a control using Lipofectamine 3000 transfection reagent. Forty-eight hours after transfection, the cells were lysed. A dual-luciferase reporter gene assay system (Promega, USA) was used to detect the activities of firefly luciferase and Renilla luciferase. For quantitative analysis, the dual-luciferase reporter assay was performed with three independent biological replicates, and each biological replicate included three technical replicates to ensure the reliability of the results.

Chromatin immunoprecipitation (ChIP)

Chondrocytes were transfected with miR-125b-1-3p mimics. The cells were fixed with 1% formaldehyde at room temperature for 10 min to cross-link the proteins and DNA, and then glycine was added to terminate the cross-linking reaction. The cells were collected and lysed, and the chromatin was broken into fragments of 200–500 bp by sonication. The lysate was centrifuged at 12,000×g at 4 °C for 10 min, after which the supernatant was collected. A portion of the supernatant was set aside as a control. Antibodies against H3K27me3 and KDM6B were added to the remaining supernatant, which was subsequently incubated with rotation at 4 °C overnight. The next day, protein A/G magnetic beads were added, and the mixture was incubated with rotation at 4 °C for 2 h to allow the antibody‒protein‒DNA complexes to bind to the magnetic beads. The magnetic beads were subsequently washed with buffer to eliminate nonspecific binding substances. Elution buffer was added, and the samples were incubated at 65 °C for 2 h to reverse the cross-linking of proteins and DNA. Proteinase K was added, and the samples were incubated at 55 °C for 1 h to digest the proteins. The DNA sample was obtained via precipitation and then quantified by real-time PCR. The ChIP‒qPCR assay was performed with three independent biological replicates, and each biological sample was analysed with three technical replicates to ensure the accuracy and reproducibility of the results.

Establishment of an osteoarthritis (OA) rat model

Sprague–Dawley (SD) rats (7–8 weeks old, 200–250 g) were obtained from the Shanghai Laboratory Animal Research Center (Shanghai, China) and housed under specific pathogen-free (SPF) conditions (2 rats per cage); the destabilization of the medial meniscus (DMM) procedure was performed to induce osteoarthritis as previously described [31], while the sham-operated group underwent skin and muscle layer incision without DMM manipulation, and all rats were randomly divided into four groups (n = 6 rats per group): (1) the normal group (no surgery, no injection); (2) the traumatic OA group (DMM surgery + intra-articular injection of sterile PBS); (3) the traumatic OA + exosome group (DMM surgery + intra-articular injection of BMSC-Exo-NC); and (4) the traumatic OA + exosome miR-125b-1-3p group (DMM surgery + intra-articular injection of BMSC-Exo-miR-125b-1-3p). Intra-articular injections were administered via a 30-gauge needle, with a preinjection phase starting 2 weeks after DMM surgery: 50 μL per knee joint per injection, administered twice a week for 3 consecutive weeks, followed by a subsequent treatment phase for the next 4 weeks: 50 μL per knee joint per injection (BMSC-Exo-NC and BMSC-Exo-miR-125b-1-3p at a concentration of 2 × 10¹⁰ particles/mL) or an equal volume of sterile PBS, administered once a week; all rats were anaesthetized with isoflurane for sample collection 11 weeks after DMM surgery, followed by knee joint tissue harvest, fixation in 4% paraformaldehyde for 24 h, and subsequent processing for safranin O-fast green staining, haematoxylin–eosin (H&E) staining, and immunohistochemical analysis.

Safranin O‐fast green cartilage staining and haematoxylin–eosin (H&E) staining

The joint tissues of the SD rats were removed and fixed with 4% paraformaldehyde for 24 h. The samples were then dehydrated in gradient alcohol solutions, cleared, and wax infiltrated, after which they were embedded in paraffin. The embedded tissue blocks were cut into 5 μm thick sections and placed on glass slides. After the sections were dewaxed in water, they were stained with 0.1% safranin O for 30 min. The cells were rinsed with water and then counterstained with 1% fast green for 2 min. The cells were differentiated with 95% alcohol, followed by dehydration, clearing, and mounting. For HE staining, the sections were dewaxed in water, stained with haematoxylin for 10 min, and differentiated with hydrochloric acid‒alcohol and blue in tap water. Afterwards, the sections were stained with eosin for 3 min, followed by dehydration, clearing, and mounting. After the samples were mounted, they were observed and photographed under an optical microscope to evaluate the pathological and morphological changes in the articular cartilage tissue.

Statistical analysis

All the data were analysed statistically using GraphPad Prism 9.0 software, and the results are presented as the mean ± standard deviation. For two groups of unpaired data with a normal distribution and homogeneous variance, an independent samples t test was used for intergroup comparisons. For multiple-group difference analysis, one-way analysis of variance (ANOVA) was performed, followed by Tukey’s post hoc test for pairwise comparisons. When P < 0.05, the differences between groups were considered to be statistically significant.

Results

Isolation and characterization of BMSC Exos

BMSCs were derived from the bone marrow of rats. Under an optical microscope, BMSCs exhibited a spindle-shaped morphology when they reached 80–90% confluence (Fig. 1). TEM revealed that the BMSC-Exos presented a typical circular or oval cup-like structure, approximately 100 nm in size (Fig. 1B). Nanoparticle tracking analysis revealed that the particle size distribution of the BMSC-Exos was relatively concentrated, and the peak value revealed that the radius of most of the particles was approximately 100 nm (Fig. 1C). Western blot analysis revealed that the expression of the typical exosomal markers CD63 and CD9 was significantly greater in BMSC-Exos than in BMSCs, while their expression was barely detectable in whole-cell lysates (Fig. 1D).

Fig. 1.

Characterisation of BMSCs and BMSC-derived exosomes. A Morphology of BMSCs observed under phase-contrast microscopy. Scale bars, 50 μm. B The morphology of the exosomes was observed by TEM. Scale bars, 100 nm. C Particle size distribution and concentration of BMSC-Exos measured by nanoparticle tracking analysis (NTA). D Detection of the exosomal markers CD63 and CD9 in BMSC-Exos by Western blotting. n = 3 independent experiments. No statistical test was performed for the morphological/characterisation data

BMSC-Exos attenuated IL-β-mediated chondrocyte damage

To investigate the role of BMSC-Exos in OA, IL-1β was used to induce an in vitro OA model in chondrocytes, after which the IL-1β-treated chondrocytes were subjected to BMSC-Exo treatment. First, we detected the mRNA expression of aggrecan, collagen II, MMP13, and ADAMTS5 by qRT‒PCR. IL-1β induction significantly inhibited the expression of anabolic markers (aggrecan and collagen II) and promoted the expression of catabolic markers (MMP13 and ADAMTS5), and these changes were reversed after treatment with BMSC-Exos (Fig. 2A). Further immunofluorescence and Western blot assays demonstrated that BMSC-Exos reversed the changes in the expression of anabolic and catabolic markers induced by IL-1β (Fig. 2B–F). These results indicate that BMSC-Exos mitigate IL-1β-induced chondrocyte injury in vitro.

Fig. 2.

BMSC-Exo treatment mitigates IL-1β-induced alterations in the expression of chondrocyte markers. A The gene expression levels of aggrecan, collagen II, MMP-13, and ADAMTS5 determined by qRT‒PCR. B–E Immunofluorescence staining of collagen II and MMP13 in chondrocytes with or without BMSC-Exo treatment. Scale bars, 100 μm. F Western blot analysis of collagen II, aggrecan, ADAMTS5, and MMP13 protein levels in cells treated with or without BMSC-Exos. n = 3 independent experiments. Statistical significance was analysed by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001

BMSC-Exos-encapsulated miR-125b-1-3p inhibits IL-1β-mediated chondrocyte damage

To explore the potential mechanism by which BMSC-Exos promote the repair of chondrocyte injury, considering that miRNAs are key functional components in exosomes, we hypothesized that the miRNAs in BMSC-Exos play a role in promoting the repair of chondrocyte injury. Therefore, high-throughput sequencing (miRNA-seq) was used to analyse the miRNA expression profile of the BMSC-Exos. Among the abundant miRNAs in BMSC-Exos, miR-125b-1-3p was particularly notable, as it is highly enriched in BMSC-Exos (Fig. 3a). qRT‒PCR analysis revealed that miR-125b-1-3p expression was significantly lower in IL-1β-induced chondrocytes than in untreated chondrocytes but was significantly upregulated after BMSC-Exo treatment (Fig. 3B). These results indicated that BMSC-Exos can deliver miR-125b-1-3p to chondrocytes. To verify the role of miR-125b-1-3p in the ability of BMSC-Exos to repair chondrocyte injury, miR-125b-1-3p mimics were synthesized and transfected into BMSCs. Exosomes derived from the transfected BMSCs were then isolated and used to treat OA chondrocytes. The results of the qRT‒PCR, immunofluorescence, and Western blot assays demonstrated that compared with the BMSC-Exo-NC group, the BMSC-Exo-miR-125b-1-3p group transfected with the miR-125b-1-3p mimic had significantly greater expression of anabolic markers (aggrecan and collagen II) and lower expression of catabolic markers (MMP13 and ADAMTS5) (Fig. 3C–H). Collectively, these findings indicate that BMSC-Exos can suppress IL-1β-induced chondrocyte injury via miR-125b-1-3p.

Fig. 3.

miR-125b-1-3p mediates the protective effects of exosomes on IL-1β-treated chondrocytes. A Heatmap of differentially expressed miRNAs in bone marrow mesenchymal stem cell-derived exosomes. B qRT‒PCR analysis of miR-125b-1-3p expression in chondrocytes transfected with BMSC-Exos and BMSC-miR-125b-1-3p-Exos with or without the miR-125b-1-3p mimics. C qRT‒PCR assessment of aggrecan, collagen II, MMP-13, and ADAMTS5 mRNA levels. D–G Immunofluorescence staining of collagen II and MMP-13 in chondrocytes under different treatment conditions. Scale bars, 100 μm. H Expression of aggrecan, collagen II, MMP-13, and ADAMTS5 as visualized by Western blotting. GAPDH was used as an endogenous control. n = 3 independent experiments. Statistical significance was analysed by one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001

Exosomal miR-125b-1-3p accelerates chondrocyte migration and inhibits chondrocyte apoptosis

We subsequently used Transwell assays to investigate the effect of BMSC-Exos on chondrocyte migration. Compared with the control group, both the BMSC-Exo-NC group and the BMSC-Exo-miR-125b-1-3p group promoted chondrocyte migration. Notably, compared with the BMSC-NC group, the BMSC-Exo-miR-125b-1-3p group exhibited significantly enhanced chondrocyte migration ability (Fig. 4A, B). Additionally, apoptosis assays demonstrated that compared with BMSC-Exo-NC, BMSC-Exo-miR-125b-1-3p strongly inhibited OA chondrocyte apoptosis (Fig. 4C–E). Taken together, these findings indicate that compared with the control treatment and BMSC-Exo-NC treatment, the BMSC-Exo-miR-125b-1-3p treatment more effectively promotes chondrocyte migration and inhibits chondrocyte apoptosis.

Fig. 4.

Exosomal miR-125b-1-3p alleviates IL-1β-induced chondrocyte dysfunction. A and B Transwell assays were performed to examine the migration of chondrocytes transfected with the BMSC-Exos and the BMSC-miR-125b-1-3p-Exos with or without the miR-125b-1-3p mimics. C and D FITC (green), PI (red), and Hoechst (all nuclei, blue) costaining to detect apoptosis in chondrocytes. E. Western blot analysis of BAX and BCL-2 protein levels in chondrocytes under various conditions, with GAPDH as an endogenous control. Scale bars, 100 μm. n = 3 independent experiments. Statistical significance was analysed by one-way ANOVA followed by Tukey’s post hoc test. **P < 0.01, ***P < 0.001

MiR-125b-1-3p targets and inhibits KDM6B

Previous studies have established that miRNAs play crucial roles in the regulation of gene transcription. To investigate the specific regulatory mechanism of miR-125b-1-3p, we used TargetScan software to predict its potential mRNA targets, and the results suggested that KDM6B is a candidate target (Fig. 5A). To validate this hypothesis, the sequence of the 3'-UTR of the KDM6B gene containing the predicted miR-125b-1-3p binding site was cloned and inserted into a luciferase reporter vector (Fig. 5B). The results of the dual-luciferase reporter assay revealed that compared with the control treatment, the miR-125b-1-3p mimic significantly reduced the luciferase activity of the vector containing the wild-type KDM6B 3'-UTR (KDM6B 3'UTR WT). In contrast, this inhibitory effect was not observed in the vector with the mutant KDM6B 3'-UTR (KDM6B 3'-UTR MUT) (Fig. 5C). Additionally, our experiments revealed that the miR-125b-1-3p mimic significantly decreased the protein and mRNA expression levels of both KDM6B in chondrocytes (Fig. 5D, E). Taken together, these results confirm that miR-125b-1-3p can directly target the 3'-UTR of KDM6B, thereby inhibiting the expression of KDM6B in chondrocytes.

Fig. 5.

miR-125b-1-3p directly targets KDM6B. A The binding site between miR-125b-1-3p and KDM6B was predicted through the TargetScan website. B Potential binding sites of miR-125b-1-3p and KDM6B. C A dual-luciferase reporter assay was performed in 293T cells to confirm the relationship between KDM6B and miR-125b-1-3p. D and E qRT‒PCR and Western blot analysis of KDM6B expression levels in cells transfected with miR-125b-1-3p mimics. n = 3 independent experiments. Statistical significance was analysed by independent samples t tests (two-group comparisons). **P < 0.01

MiR-125b-1-3p targets KDM6B and influences H3K27me3 markers of FOXM1

Previous studies have shown that in osteoarthritis, KDM6B, as a histone demethylase, regulates gene expression by catalysing the demethylation of trimethylated lysine 27 on histone H3 (H3K27me3) [32]. Western blot results revealed that the H3K27me3 marker in chondrocytes was significantly enriched after treatment with BMSC-Exo-miR-125b-1-3p (Fig. 6A). Further qRT‒PCR revealed decreased expression of FOXM1 in chondrocytes after BMSC-Exo-miR-125b-1-3p treatment (Fig. 6B). To investigate how miR-125b-1-3p affects FOXM1 transcription, we performed ChIP‒qPCR assays, which revealed a significant decrease in the binding affinity of KDM6B for the FOXM1 promoter. Moreover, the increase in H3K27me3 markers on the FOXM1 promoter reflected the loss of KDM6B occupancy (Fig. 6C, D). These results suggest that miR-125b-1-3p modulates H3K27me3 marking at the FOXM1 promoter by targeting KDM6B, thereby epigenetically regulating chondrocyte injury repair.

Fig. 6.

miR-125b-1-3p influences the binding of KDM6B and H3K27me3 to the FOXM1 gene. A Western blot analysis of KDM6B and H3K27me3 protein levels in chondrocytes treated with BMSC-Exos and BMSC-derived miR-125b-1-3p-Exos. B qRT‒PCR analysis of FOXM1 mRNA levels in cells transfected with miR-125b-1-3p mimics. C miR-125b-1-3p treatment reduced the affinity of KDM6B for the promoter region of FOXM1. D miR-125b-1-3p treatment increased H3K27me3 in FOXM1 promoter regions. n = 3 independent experiments. Statistical significance was analysed by independent samples t tests (two-group comparisons). *P < 0.05, **P < 0.01

BMSC-Exo-miR-125b-1-3p alleviates OA damage in vivo

To investigate the mechanism of action of exosomal miR-125b-1-3p in OA in vivo, we established an OA rat model. Safranin O-fast green (S&F) staining and haematoxylin–eosin (H&E) staining revealed that the articular cartilage matrix of surgically induced rats was significantly reduced and that the cartilage thickness was significantly decreased (Fig. 7A–D). Compared with the BMSC-Exo-NC treatment group, the BMSC-Exo-miR-125b-1-3p treatment group provided greater protection of articular cartilage in OA rats. Immunohistochemical staining revealed that intra-articular injection of BMSC-Exo-miR-125b-1-3p significantly decreased the expression level of MMP13 and increased the expression of collagen II in the articular cartilage (Fig. 7E, F). These experimental data confirm that BMSC-Exo-miR-125b-1-3p can effectively inhibit the progression of osteoarthritis and significantly reduce the degree of damage to knee cartilage in OA model rats.

Fig. 7.

miR-125b-1-3p alleviates the progression of OA in a DMM-induced OA model. A–D Histological analysis of the cartilage was performed by haematoxylin‒eosin and safranin O/fast green staining. E and F Immunohistochemical analysis of collagen II and MMP-13 expression in rat knee joints. Scale bars, 200 μm. n = 6 rats per group. Statistical significance was analysed by one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001

Discussion

Osteoarthritis is the most common chronic musculoskeletal disease and one of the leading causes of disability worldwide, greatly affecting patients' quality of life [33, 34]. Currently, the treatment of osteoarthritis primarily focuses on relieving patients' symptoms and improving their quality of life [35]. The commonly used treatment methods mainly rely on medications, such as nonsteroidal anti-inflammatory drugs (NSAIDs) and painkillers [36]. Although these treatments can alleviate pain and improve joint function to some extent, they have considerable limitations [37]. They cannot reverse or stop the progression of the disease, nor can they promote the repair of damaged joint tissues [33]. Therefore, it is particularly urgent to actively explore more innovative and effective treatment methods.

Mesenchymal stem cell (MSC) therapy can improve treatment outcomes for osteoarthritis (OA) patients by promoting cartilage regeneration and repair [4]. In recent years, the therapeutic efficacy of MSC-derived EVs in OA has attracted widespread attention [38]. Numerous studies have shown that MSC-derived exosomes (MSC-Exos) mediate tissue repair through the delivery of functional proteins and RNAs [15]. They not only promote chondrocyte proliferation and differentiation and accelerate cartilage tissue regeneration but also protect chondrocytes against apoptosis and inhibit macrophage activation and OA progression [39]. The abundant microRNAs (miRNAs) contained within MSC-Exos can be internalized by chondrocytes and regulate cellular functions [20]. For example, miR-92a-3p derived from human mesenchymal stem cell exosomes regulates cartilage developmental homeostasis by targeting WNT5A, and miRNA-361-5p from human bone marrow mesenchymal stem cell exosomes alleviates osteoarthritis by downregulating DDX20 and inhibiting the NF-κB signalling pathway [40]. Therefore, safe and effective cell-free therapies based on stem cell-derived exosomal miRNAs are considered ideal alternatives to stem cell therapy for OA, providing a new strategy to address the limitations of traditional treatments.

In this study, we first confirmed that BMSC-Exos promote chondrocyte repair by significantly upregulating the expression of the cartilage-specific matrix molecules aggrecan and collagen II and downregulating the expression of the catabolic enzymes MMP13 and ADAMTS5, which is consistent with the findings of previous reports. To further investigate the potential mechanisms underlying the enhanced osteoarthritis (OA) alleviation effect of BMSC-Exos, we performed miRNA expression profiling on exosomes isolated from BMSC culture supernatants and found that miR-125b-1-3p was significantly enriched in BMSC-Exos and significantly downregulated in IL-1β-induced chondrocyte injury models. In vitro coculture experiments further revealed that compared with BMSC-Exos, BMSC-Exos containing miR-125b-1-3p (BMSC-Exos-miR-125b-1-3p) more effectively promoted the synthesis of aggrecan and collagen II and inhibited the expression of ADAMTS5 and MMP13, indicating that BMSC-Exos promote chondrocyte repair primarily through the delivery of miR-125b-1-3p.

MiRNAs play important roles in the regulation of gene expression by targeting the 3'UTRs of specific mRNAs, often leading to the degradation of target mRNAs [41]. In this study, miR-125b-1-3p encapsulated in BMSC-derived exosomes facilitated chondrocyte damage repair by modulating KDM6B expression. Previous studies have shown that KDM6B is overexpressed in OA cartilage tissue and that its inhibition can promote cartilage repair by suppressing the activation of the NF-κB signalling pathway, suggesting that KDM6B may be a potential target for OA treatment [42]. Notably, the NF-κB pathway is commonly regulated by miRNAs in musculoskeletal diseases; for example, miRNA-204-5p targets the SSRP1/NF-κB pathway to inhibit apoptosis in intervertebral disc degeneration [43]. These findings confirm the importance of NF-κB pathway regulation in musculoskeletal tissue repair, supporting the use of KDM6B as an OA therapeutic target. As a histone demethylase, KDM6B can regulate the H3K27me3 modification level in the promoter region, thereby affecting the odontogenic differentiation of dental cells (DPSCs) and dentin formation [44]. Additionally, research has demonstrated that KDM6B can activate HOX transcription factors to upregulate Runx2 transcription, which plays a key role in mediating osteoblast genesis and regulating the osteogenic differentiation of BMSCs [45]. On the basis of these findings, we speculate that miR-125b-1-3p may exert its biological functions by targeting KDM6B to regulate the H3K27me3 modification levels of downstream genes. To further identify the target genes of KDM6B, we confirmed through ChIP‒qPCR experiments that miR-125b-1-3p derived from BMSC exosomes can inhibit the expression of FOXM1 by suppressing KDM6B expression, thereby increasing the H3K27me3 modification level in the FOXM1 promoter region and ultimately promoting chondrocyte damage repair. Notably, FOXM1 expression is significantly upregulated in IL-1β-induced chondrocytes, and FOXM1 knockdown effectively alleviates the IL-1β-induced decrease in cell viability and inhibits the production of the matrix metalloproteinases MMP-3 and MMP-13, suggesting that FOXM1 may be a potential intervention target for OA treatment [46]. Furthermore, as a key regulator of inflammatory responses, FOXM1 can activate the JAK1/STAT3 signalling pathway by interacting with STAT3, thereby promoting OA progression [47]. In summary, our findings demonstrate that miR-125b-1-3p in BMSC-derived exosomes significantly alleviates OA-induced chondrocyte damage both in vivo and in vitro. In addition to OA, nucleic acid molecules play important regulatory roles in other musculoskeletal diseases. Among them, noncoding RNAs (ncRNAs) are widely involved in disease regulation through pathway-mediated mechanisms; for example, the lncRNA HCG18 modulates the hsa-miR-146a-5p/TGF-β1/SMAD pathway to regulate spinal tuberculosis progression [48], LncRNA CRNDE ameliorates bone fracture by regulating cell viability and apoptosis of osteoblasts [49], miR-217 participates in the progression of postmenopausal osteoporosis by regulating the OPG/RANKL/RANK pathway [50], and the miR-106a-5p/PTEN axis is associated with the progression and diagnosis of postmenopausal osteoporosis [51]. Moreover, the therapeutic potential of microRNAs has also been demonstrated in tendon injuries[52], further highlighting the broad involvement of ncRNAs in musculoskeletal homeostasis and repair. In addition, small interfering RNAs (siRNAs) have therapeutic potential in the treatment of tendon injuries [53], rheumatoid arthritis [54] and osteoporosis [55], while circular RNAs are involved in the management of osteoporosis [56]. These studies suggest that nucleic acid molecule-mediated regulatory pathways may be common among different musculoskeletal diseases, which provides new ideas for exploring the therapeutic potential of miR-125b-1-3p in other related diseases.

Despite these promising implications, several limitations of the present study should be acknowledged. First, the in vitro OA model was induced only by IL-1β, which does not fully mimic the multifactorial nature of OA pathogenesis. Second, in vivo experiments were performed using rat models, which differ from humans in terms of anatomy and immune responses, thus limiting the translational relevance of our findings. Third, we did not clarify the contribution of other BMSC-Exos components in addition to miR-125b-1-3p. We expect to explore these issues in the future studies.

In general, this study experimentally verified that BMSC-derived exosomal miR-125b-1-3p can alleviate OA progression by improving chondrocyte anabolism and migration capacity while inhibiting chondrocyte apoptosis. Mechanistic research has indicated that miR-125b-1-3p can target KDM6B and promote H3K27me3 in the FOXM1 promoter region, thereby suppressing FOXM1 expression and ultimately mitigating the pathological progression of osteoarthritis. This study provides a potential therapeutic strategy for the application of BMSC-Exos-miR-125b-1-3p in the treatment of osteoarthritis.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

OA

Osteoarthritis

Exos

Exosomes

BMSCs

Bone marrow-derived mesenchymal stem cells

miRNA

MicroRNA

IL-1β

Interleukin-1 beta

KDM6B

Lysine (K)-specific demethylase 6B

H3K27me3

Trimethylation of histone H3 lysine 27

FOXM1

Forkhead box M1

PCR

Polymerase chain reaction

ChIP-qPCR

Chromatin immunoprecipitation quantitative PCR

HE

Haematoxylin‒eosin

EVs

Extracellular vehicles

mRNA

Messenger RNA

FBS

Foetal bovine serum

NTA

NanoSight tracking analysis

TEM

Transmission electron microscopy

TSG101

Tumour susceptibility gene 101

CD63

Cluster of differentiation 63

tRNA

Total RNA

cDNA

Complementary DNA

Collagen II

Type II collagen

MMP13

Matrix metalloproteinase 13

ADAMTS5

A disintegrin and metalloproteinase with thrombospondin motifs 5

BCL-2

B-cell lymphoma 2

Bax

Bcl-2-associated x protein

ChIP

Chromatin immunoprecipitation

SD

Sprague‒Dawley

DMM

Destabilization of the medial meniscus

NSAIDs

Nonsteroidal anti-inflammatory drugs

Authors’ contributions

X.L. and S.J. were involved in the conception and design of the present study, performed the experiments, conducted the analyses, interpreted the results, and drafted and edited the manuscript. J.Z., B.C., Y.X., P.L., and T.S. performed the experiments, assisted with the analyses and interpretation of the results, contributed intellectually to manuscript revisions, and approved the final version of the manuscript. G.Z. and R.C. were involved in the conception and design of this study and contributed to manuscript revisions. All the authors approved the final version of the manuscript.

Funding

This study is supported by grants from the Youth Project of Shanghai Changning Health Commission (20234Y011), the Research Fund of Shanghai Tongren Hospital (2020TRYJ (JC)02), the Laboratory Open Fund of Key Technology and Materials in Minimally Invasive Spine Surgery (2024JZWC-YBA03), the Key Discipline of Shanghai Changning Health Commission (20231002), and the Key Discipline Construction Project of Pudong Health Commission of Shanghai (PWZxk2022-09).

Data availability

All the data generated or analysed during this study are included in this published article.

Declarations

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Tongren Hospital, Shanghai Jiao Tong University School of Medicine (A2025-042-01).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.