Abstract
Excessive lipid accumulation in the liver can lead to fatty liver disease, which causes substantial economic losses in the poultry industry. To investigate whether irisin could alleviate hepatic lipid accumulation in 19-day-old chicken embryos or in high-fat diet (HFD)-induced models, we constructed transgenic chimeric chickens overexpressing irisin by embryonic injection of lentiviral or adenoviral vectors. The results showed that these chickens exhibited stable and sustained high-level expression of irisin in vivo, which significantly improved lipid content and liver injury markers in both serum and liver, as determined by biochemical assays and histological analysis. Gene expression analysis of liver tissue samples revealed that irisin overexpression inhibited lipogenesis and promoted lipolysis. Moreover, overexpression of irisin reduced levels of oxidative stress markers and suppressed the expression of pro-inflammatory factors. These findings provide a foundation for the use of irisin as an interventional treatment for fatty liver disease in chickens.
Key words: Hepatic lipid accumulation, Inflammation, Irisin, Overexpression, Oxidative stress
Introduction
Excessive accumulation of lipids in the liver often progresses to fatty liver disease, which is described in poultry as fatty liver hemorrhagic syndrome (FLHS), a prevalent metabolic disorder in the poultry industry. It leads to a significant increase in hepatic lipid content, causing the liver to appear yellow or pale yellow in color with a fragile and friable texture(Chu et al., 2024; You, et al., 2023). In severe cases, FLHS can lead to hepatic haemorrhage and rupture, with diffuse haemorrhagic spots or haematoma appearing in the liver parenchyma, and may result in sudden death(Trott, et al., 2014). Research shows, FLHS is the primary cause of non-infectious death in caged laying hens, accounting for over 40% of total deaths—a rate significantly higher than that of other metabolic diseases(Shini, et al., 2019). In addition to causing death, affected chicken flocks experience a 20%∼30% decline in egg production rate, shortened peak periods, and increased culling rates, resulting in significant economic losses to the poultry industry(Anene, et al., 2023). The poultry industry generally believes that the excessive accumulation of lipids in the chicken liver is caused by the widespread use of high-energy, low-protein diets, which results in the rate of hepatic lipid synthesis exceeding its metabolic capacity(Rozenboim, et al., 2016; Zhuang, et al., 2019). The primary preventive measures for excessive lipid accumulation in chicken liver include adjusting the ratio of energy to protein in the feed(Song, et al., 2017; Yang, et al., 2017), supplementing with choline chloride(Yaqoob, et al., 2024), or employing other methods. However, these approaches are often employed as preventive measures due to their slow onset of action, and therapeutic agents currently remain lacking.
Irisin was first discovered in 2012 as a myokine secreted by skeletal muscle, and its expression is induced during exercise through the activation of the factor peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α)(Boström, et al., 2012). It is a glycosylated peptide generated through the hydrolysis of the transmembrane protein fibronectin type III domain-containing protein 5 (FNDC5)(Lai, et al., 2024; Zhang, et al., 2024). Irisin enters the bloodstream and acts on various tissues and organs, including adipose tissue, bone, the cerebrum, and the liver, to exert key metabolic regulatory functions(Flori, et al., 2021; Zhang, et al., 2022). Studies have demonstrated that irisin exerts beneficial effects in various metabolic diseases(Kou, et al., 2022; Wang, et al., 2025). Research has shown that in models of obesity and type 2 diabetes mellitus (T2DM), irisin improves energy balance, reduces blood glucose and lipid levels, and alleviates insulin resistance(Bonfante, et al., 2017). Another study demonstrated that subcutaneous injection of irisin in C57BL/6 J mice fed a high-fat diet reduced the body weight and organ mass of the mice, improved glucose intolerance, and decreased plasma and liver cholesterol levels(Tang, et al., 2016). These studies confirm that irisin represents a potential therapeutic strategy for treating fat accumulation and its related diseases. However, research on irisin in chickens is limited. The only study indicates that the FNDC5/irisin gene is widely expressed in various tissues and organs of chickens(Li, et al., 2015). Whether irisin can effectively regulate lipid metabolism in chickens in vivo remains unknown.
This study employed lentiviral and adenoviral vectors to generate transgenic chimeric chickens overexpressing irisin, aiming to investigate its effects on hepatic lipid accumulation. The results showed that in chicken embryos, irisin overexpression significantly reduced liver TG and TC content, along with downregulating the expression of key genes involved in lipid synthesis, compared to the control group. Under high-fat diet conditions, irisin-overexpressing chickens exhibited reductions in liver index, plasma lipid parameters, and lipid synthesis-related gene expression relative to controls. Additionally, irisin overexpression ameliorated oxidative stress and inflammation in chickens fed a high-fat diet. In summary, irisin overexpression can reduce hepatic fat accumulation in chickens, providing a potential therapeutic strategy for alleviating excessive lipid buildup in the avian liver.
Materials and methods
Experimental animals
Animal experiments were approved by the Animal Ethics Committee of Guangxi University (Approval No.: GXU-2025-146). Fertilized embryos of Hyline Brown chickens were purchased from Guangxi Jinling Agriculture and Animal Husbandry Group Co., Ltd. Fertilized eggs were incubated in a fully automatic incubator at 37.8 ± 0.2°C and 55%–60% relative humidity. To ensure normal embryonic development, the eggs were turned six times daily. Chickens were individually housed in three-tier battery cages (45 × 30 × 37 cm). The ambient temperature was maintained between 20 and 30°C under a 14 h light: 10 h dark cycle. Feed and drinking water were available ad libitum, but fasting for 12 hours was required prior to blood collection.
Experimental Design 1 At E3, 1 μL of blood was collected from the allantoic vein of Hyline Brown chicken embryos for sex determination by PCR. At E3.5, recombinant lentivirus was injected into the somatic tissue of female embryos, while the control group received injections of normal saline (0.9% NaCl). The injection procedure followed the method described in(Liang, et al., 2025). A volume of 1–2 μL of either normal saline or lentivirus was injected. Incubation was carried out until day 19, at which point the survival rate of chicken embryos was recorded. Six chicken embryos injected with normal saline were randomly selected and assigned to the Control group (Control, n = 6). Ten chicken embryos injected with lentivirus and exhibiting the highest levels of irisin expression were selected and designated as the Irisin group (Irisin, n = 10). Liver tissues from the selected chicken embryos were collected for subsequent analysis.
Experimental Design 2 Injection of normal saline and recombinant adenovirus was performed according to the protocol outlined in experimental design one. After incubation, 32 Hyline Brown chickens were selected from the saline-injected chicken embryos and randomly divided into two groups: the NC group (NC, n = 16) and the HFD group (HFD, n = 16). A basal diet was provided to all chicks of NC group and HFD group until 6 weeks of age. To achieve the most stable transgenic expression, we decided to add doxycycline (50 mg/kg)(Kistner, et al., 1996; Zabala, et al., 2004) to the feed of individuals injected with adenoviral vectors starting at the end of week 4 in Hyline Brown chickens, inducing expression for two weeks(Koo, et al., 2012). Following a 2 weeks induction period, fasting plasma samples were collected from the brachial wing veins. Plasma irisin concentrations were measured using ELISA, and the 16 chickens with the highest expression levels were designated as the HFD+Irisin group (HFD+Irisin, n = 16). Both the HFD group and the HFD+Irisin group were fed a high-fat diet from weeks 7 to 14, for a total duration of 8 weeks. The feed composition and calculated nutritional values are presented in Table 1.
Table 1.
Diet formulation.
| Component (%) | Control | High-fat |
|---|---|---|
| Corn | 43.622 | 44.859 |
| Soybean meal | 30.676 | 36.984 |
| Choline chloride | 0.260 | 0.260 |
| Dicalcium phosphate | 1.424 | 1.643 |
| Limestone | 1.893 | 1.742 |
| DL-methionine | 0.255 | 0.294 |
| L-lysine | 0.271 | 0.246 |
| NaCl | 0.255 | 0.255 |
| Soybean oil | 3.000 | 13.468 |
| Wheat bran | 18.094 | 0 |
| Vitamin premix* | 0.050 | 0.050 |
| Mineral premix⁎⁎ | 0.200 | 0.200 |
| Calculated chemical composition | ||
| Metabolizable energy (MJ/kg) | 10.900 | 15.060 |
| Crude protein (%) | 20.000 | 20.000 |
| Methionine (%) | 0.551 | 0.556 |
| Lysine (%) | 1.064 | 1.073 |
| Calcium (%) | 1.000 | 1.000 |
| Phosphorus (%) | 0.450 | 0.450 |
Vitamin Premix Composition
The vitamin premix was added to the diet at the following concentrations per kilogram of feed: vitamin A, 2.4 mg; vitamin D3, 0.075 mg; vitamin E, 33 mg; vitamin K3, 2.3 mg; thiamine, 1.75 mg; riboflavin, 6.9 mg; niacin, 28.45 mg; pantothenic acid, 6.7 mg; biotin, 2.75 mg; folic acid, 0.6 mg; vitamin B12, 2.2 mg; choline chloride (50%), 840 mg; cyanocobalamin, 2.2 mg; and pyridoxine, 3.35 mg.
Mineral Premix Composition
The mineral premix provided the following per kilogram of feed: ferrous sulfate heptahydrate, 183.4 mg; zinc sulfate heptahydrate, 255 mg; manganese sulfate monohydrate, 276.8 mg; copper sulfate, 22 mg; calcium iodate, 2.2 mg; and sodium selenite pentahydrate, 0.6 mg.
Sample collection
In experimental design one, at E19, six livers from the control group of chicken embryos, and all livers from the Irisin group of chicken embryos were collected and washed with PBS. One portion of the samples was fixed in 4% paraformaldehyde solution (Servicebio, Wuhan, China) for 48 hours, then subjected to hematoxylin and eosin (H&E) and Oil Red O staining. One portion was placed in lyophilization tubes and immediately frozen in liquid nitrogen for biochemical analysis and determination of liver-related gene mRNA and protein relative expression.
In experimental design two, plasma samples were collected at weeks 6, 10, and 14 after a 12-hour fasting period and stored at −80°C (chickens are fasted for 12 hours prior to blood collection to reduce fluctuations in blood lipids and glucose, stabilize metabolite concentrations, minimize stress responses, and ensure the accuracy and comparability of biochemical blood test results). The plasma samples collected at weeks 6 and 10 were used to measure irisin concentration, while those collected at week 14 were allocated for both the measurement of irisin concentration and biochemical analysis. At the end of week 14, the chickens were euthanized. Fresh livers were weighed to calculate the liver index, defined as liver weight (g) divided by body weight (kg). The liver tissues were then collected for subsequent analysis according to the protocol described in experimental design one.
Plasmid construction and lentivirus and adenovirus packaging
The adenoviral vector used in this study was a Tet-On-irisin plasmid, which contained regulatory elements for efficient doxycycline-inducible expression of irisin, along with a transposon component. The other adenoviral vector contained an expression cassette for PiggyBac transposase. The irisin gene fragment was derived from a previous study(Li, et al., 2015)and was synthesized with a C-terminal 6 × His tag (Guangzhou Yunzhuo Biotechnology Co., Ltd., Guangzhou, China). The lentiviral vector was a conventional eukaryotic overexpression plasmid. Plasmids were designed using an online tool (https://www.vectorbuilder.cn/) and were subsequently constructed and packaged into adenovirus and lentivirus by Guangzhou Yunzhuo Biotechnology Co., Ltd. The final titers of the adenoviruses for Tet-On-irisin and PiggyBac transposase reached 1 × 1011 PFU/mL, these adenoviral preparations were then mixed at a 1:1 volume ratio immediately prior to use. The lentivirus titer was 1 × 10⁹ TU/mL.
H&E and Oil Red O staining
Fresh liver tissues were rinsed with PBS and fixed in 4% paraformaldehyde (Servicebio, Wuhan, China) for 24 h. After fixation, samples were dehydrated through a graded ethanol series (Sinopharm, Shanghai, China), cleared in xylene (Sinopharm, Shanghai, China), embedded in paraffin, and sectioned at 4 μm. The paraffin sections were deparaffinized, rehydrated, and stained with H&E (Servicebio, Wuhan, China), followed by dehydration, clearing, and mounting with neutral resin (Sinopharm, Shanghai, China). For frozen sections, liver tissues from the same batch were fixed in formaldehyde, cryoprotected with a sucrose gradient (Sinopharm, Shanghai, China), embedded in OCT compound (Servicebio, Wuhan, China), and cryosectioned at 8 μm. Sections were stained with Oil Red O (Servicebio, Wuhan, China) in the dark for 8–10 min, counterstained with hematoxylin (Servicebio, Wuhan, China), and mounted with glycerol gelatin (Servicebio, Wuhan, China). (Fig. 1B) sections were scanned using a digital slide scanner (3DHistech, Budapest, Hungary); the remaining sections were examined under an optical microscope (Olympus, Tokyo, Japan), with images randomly acquired.
Fig. 1.
Lipid accumulation pattern in the liver of 14-19day chicken embryos. A 14-19 days liver morphological observation. B 14-19 days liver Oil red O staining sections.
Measurement of TG and TC levels in plasma and liver tissue
Hepatic and plasma triglycerides (TG) and total cholesterol (TC) levels were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer's protocols. Briefly, for plasma analysis, fasting blood samples were centrifuged at 3,000 × g for 15 min to obtain plasma. Then, 2.5 μL of plasma sample, distilled water (blank), or a 2.26 mmol/L calibrator was added to a 96-well plate, followed by 250 μL of the respective reagent working solution. After incubation at 37°C for 10 min, the absorbance was measured at 500 nm using a microplate reader (BioTek, USA). The TG concentration was calculated using the formula: (Sample OD-Blank OD) / (Calibrator OD-Blank OD) × Calibrator concentration. For liver tissue analysis, samples were homogenized in anhydrous ethanol (1:9, w/v) and centrifuged at 2,500 rpm for 10 min. The supernatant was collected for protein concentration measurement using a commercial kit, and TG/TC levels were analyzed following the same procedure as for plasma.
AST and ALT Assay
Plasma aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's protocol. Briefly, fasting blood samples were collected from the wing vein and centrifuged at 3,000 × g for 15 min to obtain plasma. The assay was performed in 96-well plates. Briefly, 20 μL of substrate solution (prewarmed to 37°C) was added to all wells. Then, 5 μL of plasma sample was added only to the test wells, which were mixed and incubated at 37°C for 30 min. Subsequently, 20 μL of 2,4-dinitrophenylhydrazine solution was added to all wells, immediately followed by the addition of 5 μL of plasma sample to the control wells. After mixing, the plates were incubated at 37°C for another 30 min. Finally, 200 μL of 0.4 mol/L NaOH was added to all wells. Following a 15-min incubation at room temperature, the absorbance was measured at 510 nm. Enzyme activities were determined from the respective standard curves.
Measurement of hepatic MDA, SOD, GST and GSH-Px levels
Malondialdehyde (MDA) content and the activities of superoxide dismutase (SOD), glutathione s-transferase (GST), and glutathione peroxidase (GSH-Px) were determined colorimetrically using commercial kits (Jiancheng Bioengineering Institute, Nanjing, China) following the manufacturer's instructions. Briefly, Tissue samples were accurately weighed, and physiological saline was added at a ratio of weight (g): volume (mL)=1:9. The samples were homogenized mechanically at low temperature, then centrifuged at 2,500 rpm for 10 minutes, and the supernatant was collected. Sample analysis was conducted according to the manufacturer's protocol. The optical density values for MDA, SOD, GST, and GSH-Px were measured at 532 nm, 450 nm, 412 nm, and 412 nm, respectively. The contents were calculated using the corresponding formulas based on the measured OD values.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from liver tissues using the Fast RNA Mini Kit (Jianshi, Beijing, China) according to the manufacturer’s instructions. Briefly, cDNA was synthesized from the RNA using ABScript Neo RT Master Mix. qPCR was performed on a real-time PCR detection system using 2 × SYBR Mix in a 20 μL reaction volume containing: 10 μL of SYBR Premix, 0.4 μL of ROX Reference Dye I, 0.4 μL of each primer, 2.0 μL of cDNA template, and 6.8 μL of ddH₂O. Gene-specific primers (sequences in Table 2) were designed using Primer Premier 5 software, with β-actin as the internal control. The thermal cycling protocol was as follows: initial denaturation at 95°C for 5 min; 40 cycles of 95°C for 10 s and 60°C for 30 s; followed by a melt curve analysis (95°C for 15 s, 60°C for 1 min, and 95°C for 15 s). Relative gene expression was calculated using the 2−ΔΔCt method.
Table 2.
Primer sequence information for q-PCR.
| Gene name | Sequence information (5′−3′) |
|---|---|
| ACC | F: AGTGGATAACTGCTCAGATTGC |
| R: AGGGTTCATCTCCAGGGGTT | |
| FAS | F: TGCTATGCTTGCCAACAGGA |
| R: ACTGTCCGTGACGAATTGCT | |
| SCD | F: AGCAGAACGAGGCATGGTAG |
| R: GAGCACTCAACACGAAGCAC | |
| SREBP-1 | F: CTGGCTGAAGGGTGACGAG |
| R: CCGTCCTGCTTGCTCAACAT | |
| SREBP-2 | F: GGAGCCATGGATTGCACTTT |
| R: GCTGGACAATGTCTTGGTGAAG | |
| ACOX1 | F: TTAATGACCCTGACTTCCAGC |
| R: TTAATGACCCTGACTTCCAGC | |
| CPT1A | F: CGAGTCAGACACCACAGCAACAC |
| R: CACCGTAACCATCATCAGCCACAG | |
| PPARA | F: TGCTGTGGAGATCGTCCTGGTC |
| R: CTGTGACAAGTTGCCGGAGGTC | |
| IL-1β | F: TGCCTGCAGAAGAAGCCTCG |
| R: CTCCGCAGCAGTTTGGTCAT | |
| IL-6 | F: ACTCGTCCGGAGAGGTTGG |
| R: TCTCCATGCTGTTCTCGCAC | |
| TNF-α | F: CCTGCTGGGGGAATGCTAGG |
| R: AGCGTTGTCTGCTCTGTAGC | |
| INF-γ | F: AGAAGACATAACTATTAGAA |
| R: TTAGCAATTGCATCTCCTCT | |
| β-actin | F: CCAGCCATGTATGTAGCCATCC |
| R: CACCATCACCAGAGTCCATCAC |
ELISA
Plasma levels of irisin were measured using a His Tag ELISA kit (Abcam, Cambridge, UK), Hepatic concentrations of TNF-α and IL-1β were determined with commercial chicken-specific ELISA kits (Solarbio, Beijing, China; Cat. No: SEKCN-0006 and SEKCN-0153) following the protocols provided by the manufacturer. Briefly, the lyophilized standards were reconstituted and then subjected to two-fold serial dilutions to generate a concentration gradient. The pre-coated plate was washed, and then 100 μL of standards or serum samples were added to each well, followed by incubation with shaking (100-300 rpm) for 60 min. After discarding the liquid and washing, 100 μL of biotinylated antibody was added and incubated for 60 min. Following another wash step, 100 μL of enzyme conjugate was added and incubated for 20 min. Finally, 100 μL of tetramethylbenzidine substrate was added for color development for 20 min before the reaction was terminated with 50 μL of stop solution. The absorbance was measured at 450 nm within 5 min. A standard curve was plotted to calculate the protein concentrations in the plasma samples.
Statistical analysis
All data were analyzed using GraphPad Prism 9.5 software (GraphPad Software, California, USA). Except for the chi-square test, all data are presented as the mean ± standard error of the mean (SEM) from at least three independent biological replicates conducted under identical conditions. A chi-square test was used for Fig. 2B and 4B, and a paired student's t-test was applied for Fig. 4D. For the remaining data, comparisons between two groups were performed using unpaired student's t-test, while comparisons among three or more groups were conducted by one-way analysis of variance (ANOVA). For the figures, groups with statistically significant differences are indicated by * for vs. Control, # for vs. HFD, and no mark indicates not significant (ns). Statistical significance was defined as */#P < 0.05, **/##P < 0.01, and not significant (ns) for P > 0.05.
Fig. 2.
Lipid accumulation in the liver of 19-day chicken embryos was reduced by lentivirus-mediated overexpression of irisin. A Schematic diagram of the lentiviral vector structure. B Effects of lentivirus -mediated overexpression of irisin on chicken hatchability. Data analysis was performed using the chi-square test. C The levels of exogenous irisin in plasma were measured in 19-day-old chicken embryos. D Triglyceride (TG) and total cholesterol (TC) content in chicken embryonic liver. E H&E and Oil Red O staining of chicken embryonic liver. In the Control group, numerous lipid droplets were observed within hepatocytes, accompanied by extensive cytoplasmic vacuolization and indistinct hepatic cord architecture. Compared to the Control group, the Irisin group exhibited a significant reduction in lipid droplets, marked improvement in cytoplasmic vacuolization, and clear, intact hepatic cord structure. F Effects of irisin on the expression levels of lipid-related genes in chicken embryonic liver.
Data are presented as mean ± SEM. Statistical significance is indicated as follows: *P < 0.05, **P < 0.01, ns > 0.05.
Fig. 4.
Effect of adenovirus-mediated overexpression of irisin on chickens. A Schematic diagram of adenoviral vector structure and Workflow for generating irisin-overexpressing chickens. B Effect of adenovirus-mediated overexpression of irisin on chicken hatchability. Data analysis was performed using the chi-square test. C The levels of exogenous irisin in plasma were measured on chickens. D Expression levels of irisin in transgenic chimeric chickens at weeks 6, 10, and 14. Data were analyzed using paired t-test.
Data are presented as mean ± SEM. Statistical significance is indicated as follows: *P < 0.05, **P < 0.01, ns > 0.05.
Results
Lentivirus-mediated overexpression of irisin reduces lipid accumulation in the liver during chicken embryo development
Egg yolk is rich in lipids, and a substantial accumulation of lipids in the liver occurs during Hyline Brown chicken embryonic development(Surugihalli, et al., 2019). To determine the optimal time point for assessing lipid accumulation, livers from E14 to E19 chicken embryos were collected for morphological examination and Oil Red O staining to characterize lipid changes during development. The results showed a progressive enlargement of the liver from E14 to E19, accompanied by an increasingly dark yellow-brown and greasy appearance (Fig. 1A). Oil Red O staining revealed that lipid droplet accumulation peaked at E19 (Fig. 1B).
To investigate the effect of irisin on hepatic lipid accumulation in chicken embryos, Irisin was overexpressed via lentiviral transduction (Fig. 2A). Following lentiviral injection, the hatching rate of chicken embryos was 32.65%, significantly lower than the 58.0% observed in the control group (Fig. 2B). ELISA analysis showed that the average concentration of exogenous irisin in the overexpression group reached 28.58 ng/mL (Fig. 2C). The 10 chicken embryos exhibiting the highest levels of irisin expression (33.83–88.36 ng/mL) were selected for the quantification of hepatic TC and TG contents. A significant reduction in both TC and TG levels was observed in the irisin-overexpressing group compared to the control group, with average decreases exceeding 40% (P < 0.01) (Fig. 2D). Oil Red O staining revealed a widespread and dense lipid distribution in the control group, with nuclear regions extensively covered by lipids. In contrast, the irisin-overexpressing group displayed a markedly reduced and more dispersed presence of red-stained lipids, with most areas characterized by visible nuclei and a pale background (Fig. 2E). HE staining showed numerous uniformly sized vacuole-like structures occupying the majority of the cytoplasmic space in the control group. In the irisin-overexpressing group, only scattered small vacuoles were detected, and hepatocyte morphology appeared closer to normal (Fig. 2E).The mRNA expression levels of key genes involved in lipid metabolism revealed that the overexpression of irisin led to a significant downregulation of lipogenesis-related genes, including acetyl-CoA carboxylase 1 (ACC-1), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element-binding protein 1(SREBP-1), and sterol regulatory element-binding protein 2 (SREBP-2), with FAS expression significantly reduced by approximately 50% (P < 0.01). Conversely, genes associated with the fatty acid oxidation pathway: peroxisomal acyl-CoA oxidase 1 (ACOX1), carnitine palmitoyl transferase 1A (CPT1A), and peroxisome proliferator-activated receptor alpha (PPARA) were markedly upregulated, with ACOX1 showing an increase of 40% (P < 0.01) (Fig. 2F).
These results demonstrate that irisin effectively inhibits lipogenesis pathway while simultaneously promoting lipolysis and fatty acid oxidation pathways. In summary, these findings reveal a reduction in lipid accumulation within chicken embryo livers following irisin treatment.
Effects of lentivirus-mediated overexpression of irisin on oxidative stress and inflammatory factors in chicken embryonic liver
Hepatic lipid accumulation is often associated with oxidative stress and inflammation. To examine the effects of irisin on oxidative stress and inflammation in chicken fatty liver, key biomarkers related to these processes were assessed. MDA, the final product of lipid peroxidation, serves as a direct indicator of lipid oxidative damage. SOD, a central enzyme in the antioxidant defense system, reflects the capacity to scavenge superoxide anions. GST indicates hepatic detoxification ability, while GSH-Px reflects the capacity to eliminate peroxides. Compared with the control group, no significant differences were observed in the levels of MDA, GST, SOD, and GSH-Px in the irisin overexpression group (Fig. 3A). tumor necrosis factor-α (TNF-α) is a central initiator of the inflammatory response, Interferon-γ (INF-γ) is a key cytokine involved in Th1-type immune responses, interleukin-6 (IL-6) serves as a major driver of metabolic inflammation, and interleukin-1β (IL-1β) is a pro-inflammatory cytokine that mediates the onset of acute inflammation(Deng, et al., 2024; Ghosh and Bishayi, 2024). In the irisin overexpression group, significantly reduced mRNA expression levels of TNF-α, IL-1β, and IL-6 were observed (P < 0.01), whereas no significant change was detected in INF-γ expression (Fig. 3B). However, ELISA results indicated that the protein expression levels of TNF-α and IL-1β did not differ significantly between the irisin overexpression group and the control group (Fig. 3C).
Fig. 3.
Effects of lentivirus-mediated overexpression of irisin on inflammatory cytokines and oxidative stress in chicken embryos. A Effect of irisin on the expression levels of MDA, GST, SOD, and GSH-Px in chicken embryonic liver. B Effect of irisin on the mRNA expression of TNF-α, INF-γ, IL-1β, and IL-6 in chicken embryonic liver. C Effect of irisin on the protein expression levels of TNF-α and IL-1β in chicken embryonic liver.
Data are presented as mean ± SEM. Statistical significance is indicated as follows: *P < 0.05, **P < 0.01, ns > 0.05.
The above results indicate that irisin has no significant effect on chicken embryos oxidative stress, but it can alleviate the inflammatory reaction. The inconsistency between mRNA expression levels and ELISA detection results needs to be further investigated by other studies.
Effect of adenovirus-mediated overexpression of irisin on growth and biochemical parameters in chickens fed a high-fat diet
To minimize the impact of irisin overexpression on chicken embryo development, a transposon-based adenoviral vector incorporating the Tet-on system was constructed to enable inducible overexpression of irisin in adult chickens, followed by high-fat feeding until 14 weeks of age (Fig. 4A). No significant difference in embryo survival rate was observed between the adenovirus-injected group and the control group (Fig. 4B). Upon induction, the average concentration of exogenous irisin reached 86.10 ng/mL (Fig. 4C) and remained stable without notable decline for up to six weeks (Fig. 4D). These results demonstrate that stable overexpression of irisin was successfully achieved in vivo without significantly affecting hatchability.
We measured the growth and blood plasma parameters in three groups of chickens. The HFD group showed a significant increase in liver weight and liver index compared to the NC group. The HFD+Irisin group exhibited a significant decrease in liver weight and liver index compared to the HFD group, reaching a level with no significant difference compared to the NC group. There were no significant differences in body weight among the three groups (Fig. 5A). The TG and TC levels in the HFD group were significantly increased compared to the NC group. In the HFD+Irisin group, TC levels were significantly decreased compared to the HFD group, while TG was significantly higher than the NC group but TC showed no significant difference (Fig. 5B). It is noteworthy that the AST and ALT levels in the HFD+Irisin group were significantly decreased compared to the high-fat diet group (P < 0.01), with no significant difference observed when compared to the NC group (Fig. 5C).
Fig. 5.
Effect of adenovirus-mediated overexpression of irisin on growth and blood plasma parameters in chickens subjected to a high-fat diet. A Effect of overexpression of irisin on body weight, liver weight, and liver index. B Effect of overexpression of irisin on plasma TG and TC. C Effect of overexpression of irisin on AST and ALT levels.
Data are presented as mean ± SEM. Statistical significance is indicated as follows: */#P < 0.05, **/##P < 0.01, ns > 0.05.
We successfully induced excessive hepatic lipid accumulation in chickens through a high-fat diet. This condition was characterized by an enlarged liver volume, elevated blood lipid levels, and liver tissue damage. However, irisin significantly ameliorated these pathological manifestations.
Effect of adenovirus-mediated overexpression of irisin on liver lipid accumulation in chickens fed a high-fat diet
To investigate the effects of irisin on liver lipid accumulation in chickens, we performed Oil Red O and HE staining on the liver. Oil Red O staining revealed that the majority of the visual field in the HFD group was covered by red, with lipid droplets exhibiting diffuse distribution in patchy or fused forms of accumulation, demonstrating the typical Oil Red O staining characteristics of severe liver fatty. Compared to the high-fat diet (HFD) group, the HFD+Irisin group showed a significant reduction in lipid droplets, predominantly small vesicular droplets, with clearly visible cell nuclei and restored basic liver structure, though the number of red-stained lipid droplets remained higher than that in the NC group (Fig. 6A). HE staining revealed that the liver tissue in the HFD group was damaged, with hepatic steatosis and inflammatory infiltration observed in hepatocytes, exhibiting typical pathological manifestations of FLHS. Compared with the HFD group, the HFD+irisin group showed a reduction in the number of hepatocyte vacuoles, a decrease in the extent of inflammatory cell infiltration, and an improvement in fatty degeneration and inflammatory reaction, but it still did not return to the level of the NC group (Fig. 6B). Analysis of TG and TC results showed that compared with the NC group, HFD group exhibited a significant increase in both TG and TC levels. However, compared with the HFD group, the HFD+Irisin group showed a significant decrease (P < 0.05) in TG and TC levels, with a reduction in TG of up to 25%, reaching a level that was not significantly different from that of the NC group (Fig. 6C). Compared to the HFD group, the HFD+irisin group exhibited significant downregulation of Fat synthesis pathway genes ACC-1, FAS, SCD, SREBP-1, and SREBP-2, with FAS showing a decrease of approximately 44% (P < 0.01), while Fat oxidation pathway genes PPARA, ACOX1 and CPT1A were significantly upregulated (P < 0.01) (Fig. 6D). The above results indicate that irisin can significantly inhibit lipid accumulation in the liver of chickens fed with a high-fat diet.
Fig. 6.
Effect of adenovirus-mediated overexpression of irisin on lipid profiles in the livers of chickens fed a high-fat diet. A Liver H&E Staining. NC group: The liver exhibited normal architecture without significant steatosis or inflammatory infiltration; HFD group: hepatocytes showed widespread vacuolization, liver architecture was unclear, and inflammatory infiltration was pronounced; HFD+Irisin group: compared to the HFD group, vacuolization was reduced, liver architecture was largely restored, and inflammatory infiltration decreased. B Liver Oil Red O Staining. NC group: A small number of lipid droplets were observed, with no abnormal lipid accumulation; HFD group: A large number of lipid droplets were present, indicating severe lipid accumulation; HFD+Irisin group: Compared to the HFD group, both the number and size of lipid droplets were significantly reduced, with only scattered droplets observed, demonstrating marked improvement in lipid accumulation. C Effect of overexpression of irisin on TG and TC levels in chicken liver. D Effect of irisin overexpression on lipid-related genes in chicken liver lipid-related genes.
Data are presented as mean ± SEM. Statistical significance is indicated as follows: */#P < 0.05, **/##P < 0.01, ns > 0.05.
Effect of adenovirus-mediated overexpression of irisin on oxidative stress and inflammatory factors in chickens fed a high-fat diet
Through a high fat diet, the HFD group exhibited a significant state of oxidative stress, whereas compared to the HFD group, the HFD+Irisin group showed a significant downregulation in MDA (P < 0.01), although it remained higher than the NC group (Fig. 7A). Regarding SOD and GSH-Px activity, the HFD+Irisin group demonstrated a significant increase (P < 0.01) compared to the HFD group, and reached a level with no significant difference from the NC group (Fig. 7A). Specifically, the GST activity in the irisin overexpression group showed a significant upregulation compared to both the HFD group and the NC group (Fig. 7A). In terms of the mRNA expression of inflammation-related factors, HFD+Irisin group compared to the HFD group showed significant downregulation (P < 0.05) in TNF-α, IL-6, and IL-1β, with only IFN-γ showing no significant difference. Compared to the NC group, HFD+Irisin group showed no significant differences in TNF-α and IFN-γ levels, but IL-6 and IL-1β were significantly upregulated (Fig. 7B). The results of TNF-α and IL-1β were further confirmed by ELISA analysis (Fig. 7C).
Fig. 7.
Effect of adenovirus-mediated overexpression of irisin on oxidative stress and inflammatory factors in the livers of chickens fed a high-fat diet. A Effect of irisin overexpression on the concentrations of MDA, GSH-Px, SOD, and GST in chicken liver B Effect of irisin overexpression on the mRNA levels of TNF-α, IFN-γ, IL-6, and IL-1β in chicken liver. C Effect of irisin overexpression on the protein levels of TNF-α and IL-1β.
Data are presented as mean ± SEM. Statistical significance is indicated as follows: */#P < 0.05, **/##P < 0.01, ns > 0.05.
In summary, the above results indicate that irisin can effectively alleviate high fat diet-induced hepatic oxidative injury, mitigate liver inflammatory reaction, and enhance hepatic antioxidant and anti-inflammatory capacities.
Discussion
Currently, the primary measure for preventing and controlling excessive lipid accumulation in chicken liver is the use of feed additives. Previous studies have demonstrated that choline is an essential component for the assembly of very low-density lipoproteins (VLDL)(Griffin, 1992). When dietary choline is deficient, the synthesis of phosphatidylcholine is impaired, leading to reduced VLDL production and subsequent abnormal accumulation of triglycerides within hepatocytes, resulting in hepatic steatosis. Research has confirmed that in a high-energy, low-protein (HELP) diet-induced fatty liver model in laying hens, supplementation with choline chloride significantly enhances VLDL synthesis, promotes hepatic lipid export, and thereby reduces liver lipid content(Yaqoob, et al., 2024). Another study showed that Ginkgo biloba leaf extract reshapes the cecal microbiota in chickens and alleviates excessive hepatic lipid accumulation through fecal microbiota transplantation(Yang, et al., 2023). In addition, magnolol, a natural bioactive compound derived from plants, has also been shown to significantly alleviate excessive lipid accumulation in laying hens by modulating the PPARα/SREBP-1c signaling pathway, thereby inhibiting lipogenesis and promoting fatty acid β-oxidation(Chu, et al., 2024). Our findings indicate that the overexpression of irisin can markedly reduce hepatic lipid accumulation. Compared with feed additives, its mechanism of action is more clearly defined and may allow for more rapid intervention.
Studies indicate that irisin plays a central role in regulating lipid homeostasis, glucose metabolism, and inflammatory responses(Askari, et al., 2018; Martinez Munoz, et al., 2018; Perakakis, et al., 2017). In mice, irisin induces the browning of white adipose tissue by upregulating Uncoupling Protein 1(UCP1), thereby enhancing energy expenditure and reducing fat accumulation(Arhire, et al., 2019). Furthermore, irisin ameliorates endothelial function by suppressing oxidative stress and inflammatory responses, such as reducing TNF-α and IL-1β levels, thereby attenuating atherosclerosis(Jiao, et al., 2023; Sadier, et al., 2024). Based on these studies, we investigated the effects of irisin on oxidative stress and inflammatory responses induced by abnormal lipid accumulation in chicken liver. The analysis revealed that irisin reduced the levels of TNF-α and IL-1β, confirming its reparative effects on oxidative stress and inflammation. These results are consistent with studies in mammals, indicating that the biological function of irisin exhibits evolutionary conservation across species.
In Experimental Design one, we innovatively utilized 19-day-old Hyline Brown chicken embryos as a hepatic lipid accumulation model. Existing studies show that E19, corresponding to the late incubation stage, the chicken liver undergoes natural excessive lipid accumulation. During this phase, lipids from the yolk sac are transported to the liver via circulation, triggering endogenous lipogenesis(Decuypere and Bruggeman, 2007; Liu, et al., 2020; Peebles, et al., 1999). At this developmental stage, the majority of energy demands rely on the oxidation of yolk lipids, resulting in the liver being continuously exposed to elevated levels of free fatty acids—this condition mimics the pathological precursor state of human nonalcoholic fatty liver disease (NAFLD)(Tilg and Moschen, 2010; Yadgary, et al., 2010). Compared to conventional chicken fatty liver models, the E19 natural model offers standardized developmental staging(Fonseca, et al., 2021), absence of exogenous interference, and cost efficiency. Using this model, we efficiently investigated the effects of irisin on excessive lipid accumulation in embryos, providing foundational data and confidence for subsequent research. In Experimental Design two, we induced fatty liver in adult Hyline Brown chickens by administering a high-fat diet for a duration of 8 weeks. This model effectively simulates abnormal lipid accumulation in the chicken liver, and its nutritional imbalance characteristics reflect the common practice of using high-energy feed in commercial farming(Rozenboim, et al., 2016). HFD-induced abnormal lipid accumulation in the liver typically leads to oxidative stress and inflammatory responses after 8 weeks(Jian, et al., 2022). The 8-week high-fat diet (from 6 to 14 weeks of age) successfully induced the symptoms of abnormal lipid accumulation in the chicken liver, providing a rationale for subsequent experiments. A key innovation of this study is the achievement of sustained and stable expression through adenovirus-mediated irisin overexpression (Fig. 4D). Current evidence indicates exogenous irisin has a short half-life. In Sprague-Dawley rats receiving continuous infusion (5μg/kg/day) via osmotic pumps, pharmacokinetic monitoring was essential to compensate for rapid clearance after single injections(Alzoughool, et al., 2022). Epilepsy models require repeated irisin administration every 72 hours to maintain efficacy(Yu, et al., 2022). Our adenoviral approach fundamentally overcomes these pharmacokinetic limitations, providing an effective delivery strategy for long-term irisin studies.
Conclusion
Overexpression of irisin alleviated hepatic lipid metabolic disorders in high-fat diet chickens by reducing lipogenesis and increasing lipolysis. Furthermore, irisin mitigated oxidative stress-induced injury and inflammatory reactions in chickens. Our findings provide novel evidence and insights for the application of irisin as an effective therapeutic approach for FLHS.
CRediT authorship contribution statement
Jiahan Liu: Writing – original draft, Visualization, Validation, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Jinhan Wang: Writing – original draft, Visualization, Validation, Project administration, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Ning Xiao: Validation, Investigation, Formal analysis, Data curation. Huicheng Lu: Investigation, Formal analysis. Ruiying Han: Investigation, Data curation. Baichunzhu Tao: Investigation, Formal analysis. Peng Yan: Investigation, Formal analysis. Zhirui Wu: Investigation, Formal analysis. Xiaoli Wang: Writing – review & editing, Resources, Funding acquisition. Xiaochuan Tang: Writing – review & editing, Visualization, Validation, Supervision, Software, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization.
Disclosures
The authors report no conflicts of interest, financial or personal, that might have influenced the findings presented in this study.
Acknowledgments
This work was supported by Guangxi Natural Science Foundation Project (2023GXNSFAA026260, 2025GXNSFAA069363)
References
- Alzoughool F., Al-Zghoul M.B., Ghanim B.Y., Gollob M., Idkaidek N., Qinna N.A. The role of interventional Irisin on heart molecular physiology. Pharmaceuticals (Basel) 2022;15:863. doi: 10.3390/ph15070863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Anene D.O., Akter Y., Groves P.J., Horadagoda N., Liu S.Y., Moss A., Hutchison C., O'Shea C.J. Association of feed efficiency with organ characteristics and fatty liver haemorrhagic syndrome in laying hens. Sci. Rep. 2023;13:5872. doi: 10.1038/s41598-023-30007-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arhire L.I., Mihalache L., Covasa M. Irisin: a hope in understanding and managing obesity and metabolic syndrome. Front. Endocrinol. (Lausanne) 2019;10:524. doi: 10.3389/fendo.2019.00524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Askari H., Rajani S.F., Poorebrahim M., Haghi-Aminjan H., Raeis-Abdollahi E., Abdollahi M. A glance at the therapeutic potential of irisin against diseases involving inflammation, oxidative stress, and apoptosis: an introductory review. Pharmacol. Res. 2018;129:44–55. doi: 10.1016/j.phrs.2018.01.012. [DOI] [PubMed] [Google Scholar]
- Bonfante I.L.P., Chacon-Mikahil M.P.T., Brunelli D.T., Gáspari A.F., Duft R.G., Oliveira A.G., Araujo T.G., Saad M.J.A., Cavaglieri C.R. Obese with higher FNDC5/Irisin levels have a better metabolic profile, lower lipopolysaccharide levels and type 2 diabetes risk. Arch. Endocrinol. Metab. 2017;61:524–533. doi: 10.1590/2359-3997000000305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boström P., Wu J., Jedrychowski M.P., Korde A., Ye L., Lo J.C., Rasbach K.A., Boström E.A., Choi J.H., Long J.Z., Kajimura S., Zingaretti M.C., Vind B.F., Tu H., Cinti S., Højlund K., Gygi S.P., Spiegelman B.M. A PGC1-α-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature. 2012;481:463–468. doi: 10.1038/nature10777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chu Y., Zheng Y., Li Y., Gui S., Zhao J., Zhao Y., Chen X. Dietary supplementation of magnolol alleviates fatty liver hemorrhage syndrome in postpeak Xinhua laying hens via regulation of liver lipid metabolism. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Decuypere E., Bruggeman V. The endocrine interface of environmental and egg factors affecting chick quality. Poult. Sci. 2007;86:1037–1042. doi: 10.1093/ps/86.5.1037. [DOI] [PubMed] [Google Scholar]
- Deng W., Cao Z., Dong R., Yan Y., Jiang Q. Irisin inhibits CCK-8-induced TNF-α production via integrin αVβ5-NF-κb signaling pathways in Nile tilapia (Oreochromis niloticus) Fish. Shellfish. Immunol. 2024;144 doi: 10.1016/j.fsi.2023.109245. [DOI] [PubMed] [Google Scholar]
- Flori L., Testai L., Calderone V. The "irisin system": from biological roles to pharmacological and nutraceutical perspectives. Life Sci. 2021;267 doi: 10.1016/j.lfs.2020.118954. [DOI] [PubMed] [Google Scholar]
- Fonseca B.B., da Silva M.V., de Morais Ribeiro L.N. The chicken embryo as an in vivo experimental model for drug testing: advantages and limitations. Lab. Anim. (NY) 2021;50:138–139. doi: 10.1038/s41684-021-00774-3. [DOI] [PubMed] [Google Scholar]
- Ghosh R., Bishayi B. Endogenous blocking of TLR2 along with TNF-α and IL-1β ameliorates the severity of the S. aureus arthritis via modulating STAT3/SOCS3 expressions in tissue resident macrophages. Microb. Pathog. 2024;187 doi: 10.1016/j.micpath.2023.106518. [DOI] [PubMed] [Google Scholar]
- Griffin H.D. Manipulation of egg yolk cholesterol: a physiologist's view. World's. Poult. Sci. J. 1992;48:101–112. doi: 10.1079/WPS19920010. [DOI] [Google Scholar]
- Jian H., Xu Q., Wang X., Liu Y., Miao S., Li Y., Mou T., Dong X., Zou X. Amino acid and Fatty acid metabolism disorders trigger oxidative stress and inflammatory response in excessive dietary valine-induced NAFLD of laying hens. Front. Nutr. 2022;9 doi: 10.3389/fnut.2022.849767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiao R., Han Z., Ma J., Wu S., Wang Z., Zhou G., Liu X., Li J., Yan X., Meng A. Irisin attenuates fine particulate matter induced acute lung injury by regulating Nod2/NF-κb signaling pathway. Immunobiology. 2023;228 doi: 10.1016/j.imbio.2023.152358. [DOI] [PubMed] [Google Scholar]
- Kistner A., Gossen M., Zimmermann F., Jerecic J., Ullmer C., Lübbert H., Bujard H. Doxycycline-mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 1996;93:10933–10938. doi: 10.1073/pnas.93.20.10933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koo B.C., Kwon M.S., Roh J.Y., Kim M., Kim J.H., Kim T. Quantitative analysis of tetracycline-inducible expression of the green fluorescent protein gene in transgenic chickens. J. Reprod. Dev. 2012;58:672–677. doi: 10.1262/jrd.2012-092. [DOI] [PubMed] [Google Scholar]
- Kou G., Li P., Shi Y., Traore S.S., Shi X., Amoah A.N., Cui Z., Lyu Q. Sesamin activates skeletal muscle FNDC5 expression and increases irisin secretion via the SIRT1 signaling pathway. J. Agric. Food Chem. 2022;70:7704–7715. doi: 10.1021/acs.jafc.2c02794. [DOI] [PubMed] [Google Scholar]
- Lai E., Sands J., Unniappan S. Fibronectin type III domain-containing protein 5 (FNDC5)-like immunoreactivity and mRNA abundance in domestic animal tissues. Vet. J. 2024;306 doi: 10.1016/j.tvjl.2024.106161. [DOI] [PubMed] [Google Scholar]
- Li X., Fang W., Hu Y., Wang Y., Li J. Characterization of fibronectin type III domain-containing protein 5 (FNDC5) gene in chickens: cloning, tissue expression, and regulation of its expression in the muscle by fasting and cold exposure. Gene. 2015;570:221–229. doi: 10.1016/j.gene.2015.06.022. [DOI] [PubMed] [Google Scholar]
- Liang J., Qin K., Xiao N., Zhao Y., Han R., Wang J., Liu J., Lu H., Wang X., Yu F., Tang X. Recombinant nanobody expressed by transgenic chimeric chickens eliminated vertical transmission of avian leukosis virus subgroup. J. Vet. Microbiol. 2025;302 doi: 10.1016/j.vetmic.2025.110407. [DOI] [PubMed] [Google Scholar]
- Liu Y., Zhou J., Musa B.B., Khawar H., Yang X., Cao Y., Yang X. Developmental changes in hepatic lipid metabolism of chicks during the embryonic periods and the first week of posthatch. Poult. Sci. 2020;99:1655–1662. doi: 10.1016/j.psj.2019.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martinez Munoz I.Y., Camarillo Romero E.D.S., Garduno Garcia J.J. Irisin a novel metabolic biomarker: present knowledge and future directions. Int. J. Endocrinol. 2018;2018 doi: 10.1155/2018/7816806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peebles E.D., Li L., Miller S., Pansky T., Whitmarsh S., Latour M.A., Gerard P.D. Embryo and yolk compositional relationships in broiler hatching eggs during incubation. Poult. Sci. 1999;78:1435–1442. doi: 10.1093/ps/78.10.1435. [DOI] [PubMed] [Google Scholar]
- Perakakis N., Triantafyllou G.A., Fernández-Real J.M., Huh J.Y., Park K.H., Seufert J., Mantzoros C.S. Physiology and role of irisin in glucose homeostasis. Nat. Rev. Endocrinol. 2017;13:324–337. doi: 10.1038/nrendo.2016.221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rozenboim I., Mahato J., Cohen N.A., Tirosh O. Low protein and high-energy diet: a possible natural cause of fatty liver hemorrhagic syndrome in caged White Leghorn laying hens. Poult. Sci. 2016;95:612–621. doi: 10.3382/ps/pev367. [DOI] [PubMed] [Google Scholar]
- Sadier N.S., El Hajjar F., Al Sabouri A.A.K., Abou-Abbas L., Siomava N., Almutary A.G., Tambuwala M.M. Irisin: an unveiled bridge between physical exercise and a healthy brain. Life Sci. 2024;339 doi: 10.1016/j.lfs.2023.122393. [DOI] [PubMed] [Google Scholar]
- Shini A., Shini S., Bryden W.L. Fatty liver haemorrhagic syndrome occurrence in laying hens: impact of production system. Avian Pathol. 2019;48:25–34. doi: 10.1080/03079457.2018.1538550. [DOI] [PubMed] [Google Scholar]
- Song Y., Ruan J., Luo J., Wang T., Yang F., Cao H., Huang J., Hu G. Abnormal histopathology, fat percent and hepatic apolipoprotein A I and apolipoprotein B100 mRNA expression in fatty liver hemorrhagic syndrome and their improvement by soybean lecithin. Poult. Sci. 2017;96:3559–3563. doi: 10.3382/ps/pex163. [DOI] [PubMed] [Google Scholar]
- Surugihalli C., Porter T.E., Chan A., Farley L.S., Maguire M., Zhang C., Kattapuram N., Muyyarikkandy M.S., Liu H.C., Sunny N.E. Hepatic mitochondrial oxidative metabolism and lipogenesis synergistically adapt to mediate healthy embryonic-to-neonatal transition in chicken. Sci. Rep. 2019;9 doi: 10.1038/s41598-019-56715-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tang H., Yu R., Liu S., Huwatibieke B., Li Z., Zhang W. Irisin inhibits hepatic cholesterol synthesis via AMPK-SREBP2 signaling. EBioMedicine. 2016;6:139–148. doi: 10.1016/j.ebiom.2016.02.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tilg H., Moschen A.R. Evolution of inflammation in nonalcoholic fatty liver disease: the multiple parallel hits hypothesis. Hepatology (Baltimore, Md.) 2010;52:1836–1846. doi: 10.1002/hep.24001. [DOI] [PubMed] [Google Scholar]
- Trott K.A., Giannitti F.., Rimoldi G., Hill A., Woods L., Barr B., Anderson M., Mete A. Fatty liver hemorrhagic syndrome in the backyard chicken: a retrospective histopathologic case series. Vet. Pathol. 2014;51:787–795. doi: 10.1177/0300985813503569. [DOI] [PubMed] [Google Scholar]
- Wang M., Huang X., Shu J., Li H., Yang T., Li N., Yang P. Irisin alleviates autoimmune uveitis through promoting retinal microglial M1 to M2 phenotypic polarization mediated by HIF-1α pathway. Inflammation. 2025;48:1716–1727. doi: 10.1007/s10753-024-02149-5. [DOI] [PubMed] [Google Scholar]
- Yadgary L., Cahaner A., Kedar O., Uni Z. Yolk sac nutrient composition and fat uptake in late-term embryos in eggs from young and old broiler breeder hens. Poult. Sci. 2010;89:2441–2452. doi: 10.3382/ps.2010-00681. [DOI] [PubMed] [Google Scholar]
- Yang F., Ruan J., Wang T., Luo J., Cao H., Song Y., Huang J., Hu G. Improving effect of dietary soybean phospholipids supplement on hepatic and serum indexes relevant to fatty liver hemorrhagic syndrome in laying hens. Anim. Sci. J. 2017;88:1860–1869. doi: 10.1111/asj.12832. [DOI] [PubMed] [Google Scholar]
- Yang X., Li D., Zhang M., Feng Y., Jin X., Liu D., Guo Y., Hu Y. Ginkgo biloba extract alleviates fatty liver hemorrhagic syndrome in laying hens via reshaping gut microbiota. J. Anim. Sci. Biotechnol. 2023;14:97. doi: 10.1186/s40104-023-00900-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yaqoob M.U., Qi Y., Hou J., Zhe L., Zhu X., Wu P., Li Z., Wang M., Li Y., Yue M. Coated cysteamine and choline chloride could be potential feed additives to mitigate the harmful effects of fatty liver hemorrhagic syndrome in laying hens caused by high-energy low-protein diet. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.104296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- You M., Zhang S., Shen Y., Zhao X., Chen L., Liu J., Ma N. Quantitative lipidomics reveals lipid perturbation in the liver of fatty liver hemorrhagic syndrome in laying hens. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu J., Cheng Y., Cui Y., Zhai Y., Zhang W., Zhang M., Xin W., Liang J., Pan X., Wang Q., Sun H. Anti-seizure and neuronal protective effects of Irisin in Kainic acid-induced chronic epilepsy model with spontaneous seizures. Neurosci. Bull. 2022;38:1347–1364. doi: 10.1007/s12264-022-00914-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zabala M., Wang L., Hernandez-Alcoceba R., Hillen W., Qian C., Prieto J., Kramer M.G. Optimization of the Tet-on system to regulate interleukin 12 expression in the liver for the treatment of hepatic tumors. Cancer Res. 2004;64:2799–2804. doi: 10.1158/0008-5472.can-03-3061. [DOI] [PubMed] [Google Scholar]
- Zhang H., Wu X., Liang J., Kirberger M., Chen N. Irisin, an exercise-induced bioactive peptide beneficial for health promotion during aging process. Ageing Res. Rev. 2022;80 doi: 10.1016/j.arr.2022.101680. [DOI] [PubMed] [Google Scholar]
- Zhang Q.X., Zhang L.J., Zhao N., Yang L. Irisin in ischemic stroke, Alzheimer's disease and depression: a Narrative review. Brain Res. 2024;1845 doi: 10.1016/j.brainres.2024.149192. [DOI] [PubMed] [Google Scholar]
- Zhuang Y., Xing C., Cao H., Zhang C., Luo J., Guo X., Hu G. Insulin resistance and metabonomics analysis of fatty liver haemorrhagic syndrome in laying hens induced by a high-energy low-protein diet. Sci. Rep. 2019;9 doi: 10.1038/s41598-019-46183-y. [DOI] [PMC free article] [PubMed] [Google Scholar]







