Abstract
Dedicator of Cytokinesis 8 (DOCK8), a member of the DOCK family of guanine nucleotide exchange factors, serves as a key factor in managing the Rho GTPases activity, notably Cdc42 and Rac1, which control key cellular processes, including migration, adhesion, and phagocytosis. Mutations in the DOCK8 gene cause autosomal recessive hyper-IgE syndrome (AR-HIES), a primary immunodeficiency disorder characterized by elevated serum IgE levels, eczema, recurrent infections, and defective immune responses. In this study, a CRISPR/Cas9-generated Dock81281&1282 TG deletion mutation mouse model was constructed to investigate the immunological consequences of Dock8 deficiency. Our results demonstrate that Dock8 is essential for the peripheral homeostasis of T cells, particularly T follicular helper (Tfh), Th2, and regulatory T cells (Treg). Notably, in Dock8 mutant mice, both Th2 and Tfh cells were elevated, and they collaboratively promote IgE production. Additionally, we identified that Annexin A1 (ANXA1) enhances Th2 cell differentiation in Dock8 mutants, suggesting its potential role in restoring immune balance. These findings provide a refined understanding of the molecular mechanisms associated with DOCK8-related immune deficiencies and highlight potential therapeutic strategies for managing AR-HIES.
Keywords: ANXA1, AR-HIES, Dock8, Th2 cell, Treg cell
Graphical abstract
1. Introduction
Functioning as guanine nucleotide exchange factors, the DOCK family of proteins orchestrates the activity of Rho GTPases, particularly Cdc42 and Rac1, which thereby modulates a range of cellular functions, like migration, phagocytosis, and adhesion [1,2]. DOCK8 is highly expressed in innate lymphoid cells (ILCs) 3 [3] and negatively impacts ILC2, which plays a critical role alongside Th2 cells in driving immunity and allergic responses [4]. Autosomal recessive hyper-IgE syndrome (AR-HIES) is a complex primary immunodeficiency disorder characterized by an array of clinical manifestations, including markedly elevated serum IgE levels, eczema, recurrent respiratory tract infections, hyper-eosinophilia, and an impaired ability to clear bacterial, fungal, and viral infections [5]. Among the genetic factors implicated in AR-HIES, mutations in the DOCK8 gene have emerged as the predominant cause [6,7].
DOCK8 deficiency has been shown to affect the migration, function, and survival of immune cells in innate and adaptive immune responses [8]. Previous studies have emphasized the requirement for DOCK8 in the proper differentiation and function of T cells. For instance, in Dock8-deficient mice, lymphopenia and a defect in CD4+ T cell egress are observed, which can be concluded by the involvement of DOCK8 in the MST kinase signaling pathway, highlighting the importance of DOCK8 in facilitating the movement of single-positive thymocytes into the peripheral circulation [9,10]. Moreover, Dock8-deficient CD4+ T cells exhibit a biased Th2 differentiation fate, which is likely to contribute to atopic disease [11,12]. DOCK8 is indispensable to the maintenance and functional quality of CD8+ T cells as well, directly influencing their ability to form long-lived and recallable memory responses [13].
Numerous studies have investigated the mechanism by which DOCK8 mutation causes HIES. Th2 cells play a central role in initiating and maintaining IgE-mediated allergic responses through cytokine production, which regulates B cell differentiation and eosinophil activation [14,15]. T follicular helper (Tfh) cells, a specialized subset of CD4+ T cells, are essential for B cell differentiation, IgE affinity maturation, and germinal center maintenance [16]. Although DOCK8 is critical for Tfh cell function, the interplay between Tfh cells and IgE dysregulation in the context of DOCK8 mutation remains unexplored [17]. Foxp3+ CD4+ regulatory T (Treg) cells are pivotal in maintaining immune homeostasis and preventing autoimmunity [18]. DOCK8 deficiency is characterized by impaired Treg cell suppressive function, with patients exhibiting reduced peripheral Treg cell numbers and activity, yet paradoxically infrequent autoimmune manifestations [8,19]. Mechanistically, Treg-specific deletion of DOCK8 in mice triggers spontaneous multiorgan inflammation, and DOCK8 has been shown to modulate IL-2 signaling via a STAT5-dependent pathway, thereby enforcing immune tolerance [20,21]. Despite these advances, the precise molecular mechanisms linking DOCK8 mutation to HIES and immune deficiency remain poorly understood.
ANXA1 plays key roles in the immune response by executing glucocorticoid effects and governing the inflammatory process [22]. Apart from its anti-tumor effects, the capacity of ANXA1 in regulating T cell differentiation and function has been recognized as well [23]. In our study, to better understand the pathophysiological mechanisms of DOCK8-related high IgE syndrome, we constructed a Dock81281&1282 TG deletion mouse model using CRISPR/Cas9 technology, which mimics the genetic and phenotypic characteristics of patients with DOCK8 mutations. By conducting flow cytometry analysis, we demonstrated the regulatory role of Dock8 in T cells' peripheral homeostasis, particularly in Tfh cells, Th2 cells, and Treg cells. We also investigated the mechanism by which DOCK8 mutations lead to HIES and found that Tfh and Th2 cells jointly influence IgE production in Dock8 mutant mice. Additionally, we proved that ANXA1 promotes Th2 cell differentiation through the treatment of the active mimicking peptide (Ac2–26) and receptor inhibitor of ANXA1 (Boc), which provides a theoretical basis for regulating immune balance in patients with DOCK8 mutation.
2. Materials and methods
2.1. Mice
C57BL/6J (CD45.2+ and CD45.1+) mice were 6–8 weeks from Charles River (Beijing, China). In a specific pathogen-free setting, all mice were kept with a 12-hour light/dark regime. Mouse experiments were performed in accordance with the guidelines of the Institutional Animal Care and Ethics Committee of Animal Experimentation of Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China). All animal experiments were approved by the Animal Experiment Ethics Committee of Tongji Medical College (approval number, 3954).
2.2. Generation of Dock8 mutation
To remove the bases TG at positions 1281 and 1282 in exon 11 of the Dock8 gene (Transcript: NSMUSG00000052085), we developed a repair oligonucleotide paired with two sgRNAs aimed at exon 11 of the Dock8 gene. The sequence of the wild-type C57BL/6 sequence oligonucleotide is as follows, with the bases to be deleted shown in parentheses: GGGAGAGCACAGATGTGGAGCC(TG)GGGTTGGGAGGAACTCTGTGGGTGAG. The repair oligonucleotide, synthesized by BiOligo Biotechnology Co., Ltd., and the sgRNAs, supplied by GenScript, were injected into mouse embryos together with Cas9 mRNA as described previously [24]. The identification of Dock81281&1282 TG deletion mice was achieved by sequencing a 374-bp DNA fragment flanking exon 11 using the following pair of PCR primers: forward 5′- CTGACGCTTTGTTTCATCTTGTCT −3′ and reverse 5′- AGTAATTGTTTCGGGGTCACTGA −3′.
2.3. Cells preparation
Mouse thymus, spleen, pLn, and mLn were separated out and gently ground, then resuspended in HBSS containing 2% FBS to prepare a single cell suspension. Splenic cells were treated with Red Cell Lysis Buffer for three minutes and collected by filtration.
2.4. Purification of CD4+ T cells
Purified CD4+ T cells were separated using the murine CD4+ T cell Isolation Kit. The cells were first washed twice with serum-free RPMI 1640 medium to remove serum, and then labeled with CD4+ T cell-specific antibodies at 4 °C for 30 min. The labeled cells were transferred into sterile flow tubes, and the tubes were placed on a magnetic rack. After 6–8 min, the liquid was discarded, and the washing step was repeated twice. Finally, the cells were collected for further use.
2.5. Th2 cell induction in vitro
The 2 × 10^5 purified CD4+ T cells were spread evenly into 96-well flat-bottomed plates pre-coated with anti-CD3 using 200 ul of complete medium containing 1 μg/mL anti-CD3/28, 20 ng/mL rm IL-4, 5 μg/mL anti-IFN-γ and 10 ng/mL rm IL-2, and incubated at 37 °C for 5 days, with half-exchange on the third day. Then, the cells were collected five days later, and stimulated with PMA, Ionomycin and GolgiStop at 37 °C for five hours, followed by flow staining. IL-4, IFN-γ, IL-2, and IL-17A were stained. IL-4+ represents Th2 cells.
2.6. Flow cytometry
For cell surface staining, a single-cell suspension (5 × 10^5) from the thymus, spleen, pLn, and mLn was incubated with the Fc blocker and then stained with antibody dilutions on ice for 35 min. For intracellular cell staining, a single-cell suspension (1.5 × 10^6) was fixed and permeabilized with Fixation/Permeabilization and subsequently cultured with antibody dilutions on ice for 30 min before analysis. For cytokine analysis, a single-cell suspension (1.5 × 10^6) was cultured with GolgiStop (1:1000), and Ionomycin (1 µM) and PMA (50 ng/mL) at 37 °C for five hours. Then, the cells were collected and stained with antibody dilutions on ice for 35 min. At last, data were collected with the Attune NxT (Thermo Fisher, AFC2) and further analyzed with FlowJo version 10 (TreeStar).
2.7. ELISA
The concentration of IgE in serum was measured with a mouse IgE ELISA Kit.
2.8. BM chimeras
BM cells were collected from wild-type (CD45.1 recipients), Dock81281&1282 TG deletion mutation (CD45.2, donor), and wild-type (CD45.2, donor) mice as described previously [25]. Eight weeks after tail vein injection, thymus, spleen, pLn, and mLn were isolated from mice, ground to prepare a single-cell suspension, stained with antibody dilutions, and then analyzed by flow cytometry.
2.9. RT-PCR
CD4+ T cells from littermate control mice and Dock81281&1282 TG deletion mice were sorted, mRNA was extracted using trizol, then reversed to cDNA, and real-time reverse transcription PCR assay was performed to detect the mRNA level of Dock8 in mutant mice, and the primers were: 5′-GGTGAAGGTCGGTGTGAACG-3′ and 5′-CTCGCTCCTGGAAGATGGTG-3′ for Gapdh; 5′-AGAAAGAGGAGTTCGTTTTG-3′ and 5′-CAGCATCTTTGCATCAGGGG-3′ for Dock8 from the 5′ end; 5′- TTCGAGGAGGAGATGGAGCA- 3′ and reverse 5′ - GTGCTTTGCCTACCAGGGAT- 3′ for Dock8 from the 3′ end.
2.10. Statistical analysis
Data were presented as mean ± SEM, and statistical analyses were performed using Prism 9.5 (GraphPad). When comparing two groups, an unpaired two-tailed Student's t-test was used. Asterisks indicate significant difference: *p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
3. Results
3.1. Construction of a mouse model mimicking DOCK8 mutation in patients
Clinically, patients with DOCK8 gene mutations often present with large deletions in the coding region, although smaller point mutations or missense mutations are also observed [26]. To investigate the consequences of the DOCK8 mutation, different mouse models were generated in our lab according to distinct pathogenic mutations found in DOCK8-deficient HIES patients [26]. In this study, a mouse model with a targeted mutation in exon 11 of the Dock8 gene was constructed using sgRNA and CRISPR/Cas9 technology, which leads to an earlier appearance of a termination codon. A mutation strategy involving the deletion of the thymine-guanine (TG) bases at positions 1281 and 1282 was introduced, resulting in a frameshift mutation and a premature stop codon (TAA) following the mutation site (Fig. 1a). To confirm the successful generation of this mutation, a segment of exon 11 containing the mutation site was amplified. PCR analysis revealed no significant size discrepancies in the products (Fig. 1b). Subsequently, Sanger sequencing of the amplified PCR products was performed and compared to sequences in the NCBI database using the BLAST tool, confirming the deletion of the TG bases at positions 1281 and 1282. Translation of the corresponding nucleotides into amino acid sequences indicated that, in wild-type (WT) mice, the codon at position P427 is CCT (encoding proline) and the codon at G428 is GGG (encoding glycine). After the TG deletion at positions 1281 and 1282, the P427 codon changed to CCG (still encoding proline), while the P428 codon changed to GGT (encoding glycine). Downstream, the original codon at P429 was changed from GTT (encoding valine) to TGG (encoding tryptophan), while the codon at P430 was altered from GTT (encoding proline) to TAA, a stop codon. This change results in a single peak, confirming that the mutation is homozygous (Fig. 1c). These results validate the frameshift mutation and the subsequent premature termination.
Fig. 1.
Dock81281&1282 TG deletion resulted in premature termination of DOCK8 protein translation and elevated serum IgE levels, mimicking the patient phenotype. (a) Schematic representation of the Dock8 gene mutation site. The thymine-guanine (TG) bases at positions 1281 and 1282 in the Dock8 gene were knocked out, leading to a premature stop codon and subsequent termination of translation. (b) Agarose gel electrophoresis of PCR products from Dock8 mutant and littermate control mice. The bands correspond to the expected DNA fragments, indicating successful amplification. M: DNA marker; WT: wild-type control, 376 bp; Mut: mutant, 374 bp. (c) Sanger sequencing results from wild-type (WT) and Dock8 mutant mice, alongside the amino acid sequences encoded by the DNA products. (d) Representative image showing dermatitis on the backs of Dock8 mutant mice. (e) Serum IgE levels were analyzed by enzyme-linked immunosorbent assay (ELISA) (n= 5). Serum IgE levels were significantly elevated in Dock8 mutant mice compared to wild-type controls. (f-g) qPCR analysis of Dock8 mRNA levels in wild-type (WT) and Dock8 mutant mice using primers designed to target the 5′ end (f) and 3′ end (g) of the Dock8 gene (n= 3). (h) Western blotting analysis of DOCK8 protein in CD4+ T cells, revealing significantly reduced DOCK8 protein levels in Dock8 mutant mice.
To determine whether the mutant mice exhibit the elevated IgE phenotype characteristic of patients with DOCK8 mutations, serum IgE levels were measured by ELISA. The serum IgE levels in the mutant mice were substantially elevated compared to those in the control group (Fig. 1e). Furthermore, during the husbandry of these mice, signs of dermatitis were observed (Fig. 1d), consistent with the clinical features associated with DOCK8 mutations. Quantitative PCR (qPCR) analysis of splenocytes from Dock8 mutant mice demonstrated a significant downregulation of Dock8 mRNA levels compared to controls, a finding consistent across amplicons targeting both the 5′ and 3′ ends of the transcript (Fig. 1f-g). In line with these results, DOCK8 protein levels in CD4+ T cells sorted from mutant mice were also markedly reduced under both resting and activated states when compared to the control group (Fig. 1h). Collectively, these findings confirm that the Dock81281&1282 TG deletion mouse model successfully mimics the HIES phenotype observed in clinical cases of DOCK8 mutations, and is accompanied by a reduction in Dock8 expression.
3.2. Dock8 mutation does not affect thymus T cell development but disrupts peripheral T cell homeostasis with features of autoimmune disease
Previous studies have reported that patients with DOCK8 mutations typically exhibit a reduction in the total number of T cells in peripheral blood [9,27]. To further investigate this phenomenon, flow cytometric analysis was performed on total T cell levels in the thymus, spleen, peripheral lymph nodes (pLn), and mesenteric lymph nodes (mLn) of Dock8 mutant mice. Our results indicated a significant decrease in the proportion of TCR-β+ T cells in the spleen of the mutant mice, while the proportion of total T cells in the thymus was increased. In contrast, the proportions of total T cells in the pLn and mLn were nearly identical to those in the control group. Interestingly, cell numbers had no significant changes in the thymus but decreased in the spleen and increased in pLn and mLn (Fig. 2a,e). Further analysis of CD4+ and CD8+ T cells revealed no considerable discrepancy in the proportion of CD4+ and CD8+ T cells in the spleen between the groups, but the cell numbers decreased in the spleen and increased in the mLn. However, the proportion of CD8+ T cells was increased in the thymus, decreased in the peripheral lymph nodes, and showed no difference in the spleen and mesenteric lymph nodes (Fig. 2b,f-g). To further clarify the cause of the changes of mutated T cells in various immune tissues, we examined the proliferation and apoptosis of T cells in Thy, spl, pLn and mLn. However, the results showed that the proliferation and apoptosis of the mutated mice T cells were comparable to those of the control mice T cells (Fig. S1a-b). This phenomenon suggests that the mutation does not affect thymus T-cell development, proliferation or apoptosis, but rather affects thymic egress and peripheral migration. These findings reveal that the Dock8 mutation disrupts the migration of CD8+ T cells from the thymus to the peripheral lymph nodes, while T-cell development remains intact.
Fig. 2.
Effects of Dock8 mutations on T cell differentiation and homeostasis. (a-d) Flow cytometry analysis of TCR-β+ (a), CD4+ and CD8+ T cells (b), CD4+ naïve and activated T cells (c), and CD8+ naïve and activated T cells (d) in the thymus, spleen, peripheral lymph nodes (pLn), and mesenteric lymph nodes (mLn). Representative plots of flow cytometry. (e-g) Quantification of the percentages and cell numbers of TCR-β+ (e), CD4+ (f) and CD8+ (g) T cells, CD4+ naïve (h), CD4+ activated T cells (i) and CD4+ memory T cells (j), CD8+ naïve (k), CD8+ activated T cells (l) and CD8+ memory T cells (m). (n= 6).
CD44 and CD62L are critical adhesion molecules on T cells that play essential roles in T cell activation, migration, homing, and memory formation [28]. To further assess T-cell activation levels, the expression of CD44 and CD62L was examined on T cells. The results demonstrated that the Dock8 mutation did not impact the activation of CD4+ T cells. The proportions of naïve (CD44lowCD62Lhigh), active (CD44highCD62Llow), and memory (CD44highCD62Lhigh) CD4+ T cells in Dock8 mutant mice were equivalent to those in the control group (Fig. 2c,h-j), while CD8+ T cells exhibited an elevated state of activation. The proportions of naïve, activated, and memory CD8+ T cells in the thymus and spleen of Dock8 mutant mice were comparable to those in controls. However, in the pLn and mLn, the proportion of CD8+ naïve T cells was markedly reduced, while the proportions of activated and memory T cells were significantly increased (Fig. 2d,k-m), indicating that the Dock8 mutation leads to a diminished initial capacity of the immune response, alongside an enhancement in the persistence and intensity of the immune reaction. Collectively, these results suggest that the Dock8 mutation results in a complex state of immunosuppression and autoimmune response, indicating its potential association with the development of autoimmune diseases.
3.3. Dock8 mutation inhibits the differentiation of Treg cells, leaving Treg precursor cells unaffected
Treg cells play a crucial role in autoimmune diseases by maintaining immune homeostasis and preventing excessive immune responses that can lead to tissue damage and inflammation [18]. These specialized T cells are characterized by the expression of the transcription factor Foxp3, which is essential for their development and function [29]. We then investigated the changes in Treg subpopulations in the thymus, spl, pLn, and mLn of Dock8 mutant mice. Results showed that the proportions of both CD25+ Treg cells (Fig. 3a,c) and Foxp3+ Treg cells (Fig. 3b,d) were significantly reduced, indicating that Dock8 mutation diminishes Treg populations.
Fig. 3.
Dock8 mutation disrupts immune homeostasis by inhibiting Treg cell differentiation. (a-b) Flow cytometry analysis of CD4+CD25+ Treg cells (a) and CD4+Foxp3+ Treg cells (b) in the thymus, spleen, pLn, and mLn. Representative plots of flow cytometry. (c-d) The percentages and cell numbers of CD4+CD25+ Treg cells (c) and CD4+Foxp3+ Treg cells (d) were quantified. (e) Flow cytometry analysis of CD25 expression on Treg cells. The ratio of mutant to wild-type (mut / wt) for CD25 expression in Treg cells is shown, indicating the relative expression levels of CD25 on the cell surface in different groups. (f-g) Flow cytometry analysis of pre-Treg cells (CD4+CD25+Foxp3-) from CD4+CD45.1+ (f) and CD4+CD45.2+ (g) in the thymus, spleen, pLn, and mLn. Representative plots of flow cytometry. (h-j) The percentages of pre-Treg cells (CD4+CD25+Foxp3-) (h), CD4+CD25+ Treg cells (i) and CD4+Foxp3+ Treg cells (j) from CD45.2+ cells were quantified. (n = 6).
To further validate this finding, we generated mixed BM chimeras by transplanting a 1:1 mixture of wild-type BM (CD45.1+) cells and Dock8 mutant BM (CD45.2+) cells. Compared to the co-transferred CD45.1+ cells, Dock8 mutant BM developed into fewer Treg cells (Fig. 3g-h, S1b-c). This result is consistent with previous studies in Dock8 conditional KO mice [20,21]. The Dock8 mutant cells in the BM chimeras suggest a cell-autonomous effect of Dock8 on Treg cells. CD25, a critical marker for Treg maturation, plays an essential role in the development of functional Tregs [30]. However, we observed that in Dock8 mutant mice, the expression of CD25 in Tregs was significantly reduced (Fig. 3e). This phenomenon was not observed in peripheral lymphoid organs such as the spl, suggesting that the reduced CD25 expression is restricted to thymic Treg cells. This finding indicates that the Dock8 mutation primarily affects Treg development in the thymus.
To further investigate the potential causes behind the reduction in Tregs due to DOCK8 dysfunction, we hypothesized that the Dock8 mutation might impact Treg development by influencing a precursor population. We hypothesized that the Dock8 mutation affects Treg development by acting on a precursor population. Previous studies suggest that Foxp3+ Treg cells develop from the putative precursors (CD4+CD25+Foxp3−) [31]. However, our analysis of the BM chimeras revealed no differences in the CD4+CD25+Foxp3− population between Dock8 mutant and control mice (Fig. 3f-h, S2a, S2i). To further explore the mechanisms underlying the decrease in Treg cells, the expression of Foxp3 in CD4+Foxp3+ Treg cells was assessed. The results indicated that there were no meaningful changes in the MFI of Foxp3 expression between the mutant and control groups (Fig. S2d).
The expression of key molecules, CTLA4 and ICOS, in CD4+Foxp3+ Treg cells was then examined. CTLA4 is primarily known as an inhibitory molecule that downregulates T cell activation and promotes immune tolerance [32]. In contrast, ICOS, while involved in enhancing T cell activation and promoting Treg cell function, plays a dual role [33]. Our results revealed that the expression of CTLA4 was significantly higher in the Treg cells of the mutant mice's thymus compared to the control group (Fig. S2e), while the expression of ICOS was much lower in the mutant group (Fig. S2f). This indicates that the differential expression of CTLA4 and ICOS in the mutant mice jointly impairs the function of Treg cells. Such a phenomenon was not observed in the spleen, pLn and mLn. Interestingly, although the proportion of mLn Treg cells was reduced, the expression of migration-related adhesion molecules, CD103 and NRP1, was higher in the mutant group compared to the control group (Fig. S2g-h). This finding suggests that Dock8 mutation enhances the ability of Treg cells to migrate to and reside in inflamed tissues to exert their immunosuppressive functions. Overall, these results indicate that the Dock8 mutation leads to an imbalance in immune homeostasis by regulating Treg cell function.
3.4. Dock8 mutation leads to imbalance in Th1 and Th2 differentiation
Research has demonstrated that Treg cells can inhibit the differentiation and function of Th2 cells, thereby preventing excessive Th2-mediated immune responses and abnormal B cell activation [34]. However, cytokines secreted by T cell subsets also play critical roles in immune responses. In this study, the levels of IL-2 and IFN-γ secreted by Th1 cells, IL-17A from Th17 cells, and IL-4 from Th2 cells were measured in mutant mice. Flow cytometry results revealed a significant elevation of IL-4 levels in CD4+ T cells (Fig. 4c,h). However, no evident contrasts were observed in the proportion of IFN-γ+ and IL-2+ T cells (Fig. 4a-b,f-g). In CD8+ T cells, IFN-γ levels were significantly elevated (Fig. 4d-e,g-k), while no differences were detected in IL-17A levels between CD4+ and CD8+ T cells (Fig. 4i,l). These findings suggest that Dock8 mutations influence T cell differentiation and immune homeostasis, leading to widespread alterations in T cell differentiation, function, and activation processes, and support the conclusion that Treg inhibits Th2 differentiation and function.
Fig. 4.
Dock8 mutation leads to imbalance in Th1 and Th2 differentiation. (a-e) Flow cytometry analysis of cytokine expression of CD4+ and CD8+ T cells in the thymus, spleen, pLn, and mLn. Representative plots of flow cytometry (a-c are from TCR-β+CD4+, d-e are from TCR-β+CD8+). (f-i) The percentages of IL-2+ (f), IFN-γ+ (g), IL-4+ (h), and IL-17A+ cells (i) were quantified in CD4+ T cells. (n= 5). (j-l) The percentages of IL-2+ (j), IFN-γ+ (k), and IL-17A+ cells (l) were quantified in CD8+ T cells. (n= 5).
3.5. Dock8 mutation promotes IgE secretion by regulating both Th2 and Tfh cells
Th2 cells are key regulators of humoral immunity, primarily directing B cells to produce immunoglobulins through the secretion of IL-4. In contrast, Tfh cells promote B cell affinity maturation via IL-21 [35,36]. Th2 and Tfh cells are critical for promoting B cell antibody production, particularly IgE [37]. To investigate the specific mechanisms underlying high IgE syndrome induced by Dock8 mutations, CD4+ naïve T cells were purified from mice and subjected to Th2 differentiation in vitro using anti-CD3/28, rm-IL-4, anti-IFN-γ, and rm-IL-2. After five days, the cells were collected for further analysis. Flow cytometry was then performed to assess the proportions of IL-4+, IL-2+, IFN-γ+, and IL-17A+ cells. The results showed that the proportion of induced Th2 (IL-4+) cells was appreciably higher than that of the control group (Fig. 5a,e). Conversely, the proportions of IFN-γ+ and IL-2+ (Th1) cells, as well as IL-17A+ (Th17) cells detected, remained very low, suggesting a strong bias towards Th2 polarization under the given conditions (Fig. 5b-d,e), and indicating that the induction of Th2 cell differentiation in vitro was successful. Moreover, the proportion of Th2 cells was elevated in Dock8 mutant mice compared to the control group, suggesting that the increased Th2 cells contribute to elevated IgE secretion by B cells.
Fig. 5.
Dock8 mutation promote IgE secretion by regulating both Th2 and Tfh cells. (a-d) Sorted CD4+ T cells were cultured in vitro under Th-polarizing conditions (1 µg/mL anti-CD3/28, 20 ng/mL rmIL-4, 5 µg/mL anti-IFN-γ, and 10 ng/mL rmIL-2) for 5 days, with a half-medium exchange on day 3. Cells were subsequently re-stimulated with PMA, ionomycin, and GolgiStop for 5 h, followed by intracellular staining and flow cytometric analysis. Representative plots show gating for Th2 (IL-4+) (a), Th1 (IFN-γ+ (b) and IL-2+ (c)), and Th17 (IL-17A+) (d) cells. (e) Quantification of the percentages of Th1, Th2, and Th17 cells among differentiated CD4+ T cells as described in (a-d) (n= 5). (f-g) Representative flow cytometry plots showing the gating strategy for CXCR5+ICOS+ Tfh cells (f) and CXCR5+PD-1+ Tfh cells (g) in the spleen. Representative plots of flow cytometry. (h) Quantification of the percentages of CXCR5+ICOS+ and CXCR5+PD-1+ Tfh cells among splenic CD4+ T cells (n= 5). (i) Quantification of the MFI of ICOS, CXCR5, and PD-1 on splenic Tfh cells (n= 5).
Tfh cells are a crucial subset of CD4+ T cells primarily located in the germinal centers of lymph nodes, where they play a pivotal role in immune regulation [38]. Tfh cells in CD4+ T cells were identified using CXCR5, ICOS, and PD-1 markers. Our results revealed that the proportions of CXCR5+ICOS+ or CXCR5+PD-1+ Tfh cells were significantly higher in T cells from Dock8 mutant mice compared to those from the control group (Fig. 5f-h). And the expression of CXCR5 as well as ICOS was elevated in Tfh cells (Fig. 5i). Tfh cells promote B cell differentiation into IgE-producing cells by providing co-stimulatory signals and cytokines, such as IL-4 and IL-21. IL-4 is essential for IgE class switching, while IL-21 enhances B cell survival and proliferation [39,40]. Therefore, the Dock8 mutation may influence IgE secretion by modulating both the quantity and function of Tfh and Th2 cells.
3.6. ANXA1 promotes Th2 cell differentiation in CD4+ T cells with Dock8 mutation
Existing research has demonstrated that ANXA1 plays a crucial role in T cell differentiation [23]. In the current study, flow cytometric analysis demonstrated increased ANXA1 expression within T cell populations from Dock8 mutant mice when compared to WT counterparts (Fig. 6a-b). This observation was supported by an increasing trend in Anxa1 mRNA transcript levels in the mutant group as well (Fig. 6c). Moreover, co-immunoprecipitation (Co-IP) assays provided evidence for a direct interaction between the DOCK8 and ANXA1 proteins (Fig. 6d-e). Ac2–26, an active peptide fragment of ANXA1, can modulate Th2 differentiation [41]. Naïve CD4+ T cells from control and mutant mice were differentiated in vitro towards a Th2 phenotype using anti-CD3, anti-CD28, anti-IFN-γ, recombinant IL-4, and recombinant IL-2. Concurrently, a parallel set of cultures was treated with 5 µM Ac2–26. Following a 5-day incubation period at 37 °C (with a half-medium exchange on day 3), cells were analyzed. Treatment with Ac2–26 resulted in a substantial increase in the proportion of Th2 (IL-4+) cells compared to cells cultured under Th2-polarizing conditions alone (untreated group) (Fig. 6f-g, 6i-l). These findings indicate that ANXA1 promotes Th2 cell differentiation.
Fig. 6.
ANXA1 promotes induction of Dock8 mutant Th2 cells. (a) Representative flow cytometry plots showing ANXA1 expression in T cell subsets (TCR-β+, CD4+, CD8+, and Treg cells) from wild-type mice. (b) Quantification of ANXA1 MFI in T cell subsets (TCR-β+, CD4+, CD8+, and Treg cells). (n= 5). (c) qPCR analysis of Anxa1 mRNA levels in sorted CD4+ T cells from WT and Dock8 mutant mice (n= 3). (d-e) Immunoblot (IB) analysis of DOCK8 and ANXA1 protein expression (d) and Co-immunoprecipitation (Co-IP) analysis of the DOCK8-ANXA1 interaction (e) in T cell lysates of WT mice. (f-h) Sorted CD4+ T cells from WT mice were cultured under Th-polarizing conditions alone (anti-CD3/28, rm IL-4, anti-IFN-γ and rm IL-2) (f, Basic), or with the addition of Ac2–26 (ANXA1 mimetic peptide) (g), or Boc (ANXA1 receptor inhibitor) (h). After five days, cells were re-stimulated with PMA, Ionomycin, and GolgiStop for five hours, followed by intracellular staining for IL-4, IFN-γ, IL-2, and IL-17A and flow cytometric analysis. Representative plots are shown. (n= 5). (i-l) Quantification of the proportion of Th1 (IFN-γ+), Th2 (IL-4+), and Th17 (IL-17A+) cells among CD4+ T cells from the three treatment groups described in (f-h). (Basic: Th-polarizing conditions; Ac2–26: Th-polarizing conditions + Ac2–26; Boc: Th-polarizing conditions + Boc) (n= 5).
Additionally, the ANXA1 receptor inhibitor Boc was employed to treat the cells. In the control group, the proportion of induced Th2 cells decreased following 12.5 μM Boc treatment (Fig. 6h-l). Moreover, the proportion of Th2 cells in the Boc-treated condition was significantly lower compared to the Boc-untreated group in both Dock8-mutant and WT groups, suggesting that ANXA1 inhibition can restore the Th2 cell proportion (Fig. 6i). These findings indicate that ANXA1 promotes the differentiation of T cells with Dock8 mutations into Th2 cells, and that inhibiting ANXA1 can reverse Th2 differentiation in these mutant T cells. This discovery offers a theoretical basis for regulating immune balance in patients with DOCK8 mutations.
4. Discussion
In summary, by constructing a Dock81281&1282 TG deletion mouse model using CRISPR/Cas9 technology, we investigated the impact of DOCK8 on T cell homeostasis and IgE production. Our results revealed that the Dock8 mutation affects peripheral T cell homeostasis, leading to immune suppression, and promotes IgE secretion by influencing Th2 and Tfh cell dynamics. In this Dock8 mutant mouse model with a mutation occurring in the DHR1 domain, we also found that such a mutation leads to a significant reduction of Tregs in both the thymus and the peripheral spleen, with no difference in the CD4+CD25+Foxp3- Treg precursor cells. Furthermore, by restoring Th2 cells through ANXA1 inhibition, we provide the first mechanistic evidence that DOCK8 suppresses Th2 cell differentiation through ANXA1, thereby regulating IgE production.
Studies on patients with different DOCK8 mutation sites have shown that DOCK8 deficiency severely disrupts the differentiation and proliferation of naive and memory human T cells [13]. In both humans and mice, DOCK8 deficiency affects CD8+ T cells in a cell-autonomous manner, leading to profound immunological defects. The abnormal behavior of CD8+ T cells is associated with a reduced response to antigenic stimulation. In humans, this manifests as exhaustion, whereas in mice, it results in the failure to mount a recall response after an initial infection (such as influenza). Moreover, the major distinction lies in the naïve T cell depletion in humans, while mice primarily exhibit problems with the persistence and recall ability of memory CD8+ T cells after initial exposure to an antigen. The exhaustion phenotype is more prominent in humans, while in mice, the defect is primarily associated with memory response failure [13].
The propensity of Dock8 mutations to induce Th2 skewing has been substantiated by several studies [7,11]. Mechanistic insights into this phenomenon have been widely explored, ranging from the early-described IL-1β-mediated Th2 skewing effect in the context of C. neoformans infection to the caspase-dependent cell death as key signals driving type-2 immunity [12,42]. Our previous study also found that Dock8 mutation upregulates glycolysis levels in CD4+ T cells via the Akt/mTOR/S6/HIF-1α pathway, thereby promoting Th2 polarization and a subsequent increase in IgE secretion [43]. In our current Dock8 mutant mouse model, the proportion of CD44+IL4+ T cells was significantly increased in secondary lymphoid organs, and these cells exhibited marked polarization towards a Th2 phenotype under in vitro stimulation, which in turn led to increased IgE secretion. However, the impact of different Dock8 mutation sites on T cell differentiation and development is not completely consistent. Our previous work demonstrated that the Dock8A1949D knock-in mutation led to a marked reduction in the proportions of CD4+ and CD8+ T cells in the spleen, pLn, and mLn of Dock8 mutant mice, while T cell populations in the thymus remained unaffected. Furthermore, the spleen and pLn of Dock8 mutant mice exhibited a decrease in naïve T cells (CD44lowCD62Lhigh) and an increase in activated T cells (CD44highCD62Llow) [43].
Additionally, in our study, similar to other Dock8 mutation sites, we identified that the Dock81281&1282 TG deletion can lead to T cell polarization towards Th2 differentiation and an imbalance between Th1 and Th2 cells. Furthermore, such a mutation also disrupts peripheral T cell homeostasis, particularly affecting the migration and function of peripheral Treg cells, while the CD4+CD25+Foxp3- precursors of Tregs remain unaffected. Furthermore, we found that the Dock81281&1282 TG deletion mutation promotes IgE secretion by regulating both Th2 and Tfh cells, thereby enriching the theoretical foundation for the association between DOCK8 mutation and allergic diseases, particularly in the context of AR-HIES. Additionally, the impact of Dock8 mutation on Tfh cells and the resulting phenotypic changes have been scarcely studied [44]. Shiozawa et al. found that repeated stimulation of the T cell receptor (TCR) beyond the host's steady-state response threshold can induce systemic lupus erythematosus (SLE) in mice normally not prone to autoimmunity, leading to the generation of Tfh cells expressing the guanine nucleotide exchange factor DOCK8. The DOCK8+ Tfh cells induced various autoantibodies and lupus lesions, and were present in the splenic red pulp and peripheral blood of active SLE patients, suggesting that DOCK8 may serve as a potential therapeutic target for treating Tfh cell imbalance and immune dysregulation [45].
IL-4 is a critical B cell survival factor expressed by Tfh cells during various immune responses. However, it is important to note that these responses do not always lead to IgE secretion, indicating that additional factors or signals may be required for IgE production. While Tfh cell-derived IL-4 is necessary for IgE production, it alone is insufficient to fully induce IgE synthesis. Utilizing single-cell RNA-sequence analysis (scRNA-seq), Gowthaman et al. identified a novel subset of Tfh cells (IL-13hiIL4hiIL-5hiIL-21lo), termed “Tfh13”, which are required for the production of high-affinity but not low-affinity IgE, and play a key role in subsequent allergen-induced anaphylaxis [46]. Both Tfh2- and Tfh13-derived IL-4 and IL-13 promote class switching to IgE, highlighting the importance of specific Tfh subsets in regulating IgE production [47]. The pathways regulating Tfh2 differentiation remain poorly understood. Haque et al. investigated Loeys-Dietz syndrome (LDS), a condition caused by mutations in a single gene that partially attenuate canonical TGF-β signaling. Their study demonstrated that LDS mutations lead to an increase in Tfh2 cells, enhanced humoral immune responses, and elevated production of allergen-specific IgE. Furthermore, TGF-β plays a conserved, T cell-intrinsic, and nonredundant role in restraining Tfh2 development through the PI3Kγ/mTOR signaling pathway, thereby offering protection against allergic diseases [48]. In this study, within Dock8-deficient mice, an increased proportion of splenic Tfh cells and elevated expression of molecules such as CXCR5 and ICOS relative to the control group revealed that the Dock8 mutation promotes IgE secretion by regulating both Th2 and Tfh cells. However, we did not perform in vivo induction of Tfh2 cells to further investigate the effects of the Dock8 mutation on Tfh2 or Tfh13 cells. Overall, our research uncovered novel phenotypic alterations in Tfh cells induced by the Dock81281&1282 TG deletion mutation, providing a foundation for future investigations into the role of DOCK8 in regulating Tfh cell function and its potential impact on IgE production.
While the role of DOCK8 in regulating IgE production has been reported [49], the underlying mechanisms remain to be further explored. A previous study has shown that ANXA1 is an important non-redundant regulator of mast cell reactivity, particularly in allergen-mediated allergic reactions [50]. In this study, we found that ANXA1 promotes Th2 cell differentiation in CD4+ T cells with the Dock81281&1282 TG deletion mutation, thereby enhancing IgE production. However, the exact mechanism by which DOCK8 regulates ANXA1 to promote IgE production warrants further investigation. Since DOCK8 is not a transcription factor, it cannot regulate ANXA1 at the transcriptional level. While the exact mechanism by which DOCK8 regulates ANXA1 requires further investigation, the interaction between DOCK8 and ANXA1 likely occurs through a combination of protein-protein interactions, post-translational modifications, and modulation of cellular processes related to T cell differentiation and immune responses. Further studies are needed to fully elucidate this potential mechanism and its implications for diseases linked to DOCK8 mutations, such as immunodeficiency and allergies.
Our results indicated that in our Dock8 mutation high-IgE model mouse, ANXA1 levels are elevated, and there is also an increase in Th2 cells. Notably, the administration of an ANXA1 agonist (Ac2–26) led to an enhanced increase in Th2 cells, suggesting a direct association between the expansion of Th2 cells and ANXA1 in the Dock8 mutant mice. In contrast, the use of a pharmacological inhibitor for ANXA1 receptor successfully suppressed the increased Th2 cell numbers in the Dock8 mutant mice, further supporting the hypothesis that ANXA1 plays a pivotal role in the expansion of Th2 cells. These findings suggest that ANXA1 may serve as a potential therapeutic target for managing high-IgE syndromes, such as allergic diseases and other immune dysregulations characterized by elevated IgE levels. Moreover, the observed modulation of Th2 responses by ANXA1 in the context of Dock8 mutation highlights the broader role of ANXA1 in immune regulation and its potential to influence the immune profile in diseases associated with Th2-driven inflammation. Given its regulatory effects on both T cell differentiation and IgE production, ANXA1 could be explored as a novel therapeutic target in the treatment of allergic diseases, especially those involving abnormal IgE responses.
5. Conclusion
In this study, we generated a Dock81281&1282TG deletion mouse model to investigate the immunological consequences of Dock8 exon 11 deficiency, which aims to replicate the clinical phenotype of HIES associated with DOCK8 mutations. Our findings demonstrate that Dock8 plays a critical regulatory role in maintaining the peripheral homeostasis of various T cell subsets, including Tfh, Th2, and Treg cells. In Dock8-deficient mice, we observed an elevation of both Th2 and Tfh cells, which act synergistically to promote excessive IgE production, a hallmark of HIES. Additionally, we identified ANXA1 as a key factor that enhances Th2 cell differentiation in the absence of functional Dock8. This finding suggests that modulating ANXA1 may offer a novel therapeutic approach to restore immune balance in DOCK8-related immunodeficiencies. These results contribute to a deeper understanding of the immune dysregulation underlying AR-HIES and provide insights into potential strategies for managing this debilitating disorder.
Data availability
The data sets and any other raw data that support the findings of this study are available from the corresponding author upon reasonable request.
CRediT authorship contribution statement
Ju Liu: Validation, Methodology, Investigation, Writing – original draft, Formal analysis, Data curation. Jianing Tang: Writing – original draft, Methodology. Peiyao Jin: Methodology, Resources. Zhenzhen Li: Resources, Methodology. Chunrui Wu: Methodology, Resources. Xi Luo: Resources, Methodology. Xin Dai: Resources. Yinming Liang: Resources. Lichen Zhang: Resources. Liaoxun Lu: Methodology. Masato Kubo: Methodology, Supervision, Resources. Chaohong Liu: Supervision, Project administration, Writing – review & editing, Validation.
Declaration of competing interest
The authors declare that they have no conflicts of interest in this work.
Acknowledgments
This study was supported by International scientific and technological innovation cooperation between governments from Ministry of Science and Technology of the People's Republic of China (2021YFE0108200), National Key R&D Program of China 2023YFC2507900, 2023YFC2507900, the National Natural Science Foundation of China (32311530061, 31970839 and 82371784) and the Fundamental Research Funds for the Central Universities. We are grateful to the Medical Subcenter of HUST Analytical & Testing Center for data collection.
Biographies
Ju Liu is a PhD candidate from Department of Pathogen Biology, School of Basic Medicine, Tongji Medical College and State Key Laboratory for Diagnosis and Treatment of Severe Zoonotic Infectious Diseases, Huazhong University of Science and Technology.
Chaohong Liu (BRID:05159.00.59521) is a professor from Department of Pathogen Biology, School of Basic Medicine, Huazhong University of Science and Technology.
Footnotes
Peer review under the responsibility of Editorial Board of Fundamental Research.
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.fmre.2025.05.012.
Appendix. Supplementary materials
References
- 1.Meller N., Merlot S., Guda C. CZH proteins: A new family of Rho-GEFs. J. Cell Sci. 2005;118(Pt 21):4937–4946. doi: 10.1242/jcs.02671. [DOI] [PubMed] [Google Scholar]
- 2.Kearney C.J., Randall K.L., Oliaro J. DOCK8 regulates signal transduction events to control immunity. Cell Mol. Immunol. 2017;14(5):406–411. doi: 10.1038/cmi.2017.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Singh A.K., Eken A., Fry M., et al. DOCK8 regulates protective immunity by controlling the function and survival of rorγt+ ILCs. Nat. Commun. 2014;5:4603. doi: 10.1038/ncomms5603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Matsubara K., Kunimura K., Yamane N., et al. DOCK8 deficiency causes a skewing to type 2 immunity in the gut with expansion of group 2 innate lymphoid cells. Biochem. Biophys. Res. Commun. 2021;559:135–140. doi: 10.1016/j.bbrc.2021.04.094. [DOI] [PubMed] [Google Scholar]
- 5.Du Z., Chen A., Huang L., et al. STAT3 couples with 14-3-3σ to regulate BCR signaling, B-cell differentiation, and IgE production. J. Allergy Clin. Immunol. 2021;147(5) doi: 10.1016/j.jaci.2020.09.033. 1907–23.e6. [DOI] [PubMed] [Google Scholar]
- 6.Engelhardt K.R., Gertz M.E., Keles S., et al. The extended clinical phenotype of 64 patients with dedicator of cytokinesis 8 deficiency. J. Allergy Clin. Immunol. 2015;136(2):402–412. doi: 10.1016/j.jaci.2014.12.1945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Aydin S.E., Kilic S.S., Aytekin C., et al. DOCK8 deficiency: Clinical and immunological phenotype and treatment options - a review of 136 patients. J. Clin. Immunol. 2015;35(2):189–198. doi: 10.1007/s10875-014-0126-0. [DOI] [PubMed] [Google Scholar]
- 8.Su H.C. Dedicator of cytokinesis 8 (DOCK8) deficiency. Curr. Opin. Allergy Clin. Immunol. 2010;10(6):515–520. doi: 10.1097/ACI.0b013e32833fd718. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lambe T., Crawford G., Johnson A.L., et al. DOCK8 is essential for T-cell survival and the maintenance of CD8+ T-cell memory. Eur. J. Immunol. 2011;41(12):3423–3435. doi: 10.1002/eji.201141759. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Mou F., Praskova M., Xia F., et al. The Mst1 and Mst2 kinases control activation of rho family GTPases and thymic egress of mature thymocytes. J. Exp. Med. 2012;209(4):741–759. doi: 10.1084/jem.20111692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tangye S.G., Pillay B., Randall K.L., et al. Dedicator of cytokinesis 8-deficient CD4(+) T cells are biased to a T(H)2 effector fate at the expense of T(H)1 and T(H)17 cells. J. Allergy Clin. Immunol. 2017;139(3):933–949. doi: 10.1016/j.jaci.2016.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Schneider C., Shen C., Gopal A.A., et al. Migration-induced cell shattering due to DOCK8 deficiency causes a type 2-biased helper T cell response. Nat. Immunol. 2020;21(12):1528–1539. doi: 10.1038/s41590-020-0795-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Randall K.L., Chan S.S., Ma C.S., et al. DOCK8 deficiency impairs CD8 T cell survival and function in humans and mice. J. Exp. Med. 2011;208(11):2305–2320. doi: 10.1084/jem.20110345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Walker J.A., Mckenzie A.N.J. T(H)2 cell development and function. Nat. Rev. Immunol. 2018;18(2):121–133. doi: 10.1038/nri.2017.118. [DOI] [PubMed] [Google Scholar]
- 15.Ouyang L., Su G., Quan J., et al. Emerging roles and therapeutic implications of HDAC2 and IL-17A in steroid-resistant asthma. Chin Med J Pulm Crit Care Med. 2023;1(2):108–112. doi: 10.1016/j.pccm.2023.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Crotty S. Follicular helper CD4 T cells (TFH) Annu. Rev. Immunol. 2011;29:621–663. doi: 10.1146/annurev-immunol-031210-101400. [DOI] [PubMed] [Google Scholar]
- 17.Janssen E., Tohme M., Butts J., et al. DOCK8 is essential for LFA-1-dependent positioning of T follicular helper cells in germinal centers. JCI. Insight. 2020;5(15) doi: 10.1172/jci.insight.134508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Savage P.A., Klawon D.E.J., Miller C.H. Regulatory T cell development. Annu. Rev. Immunol. 2020;38:421–453. doi: 10.1146/annurev-immunol-100219-020937. [DOI] [PubMed] [Google Scholar]
- 19.Al-Herz W., Ragupathy R., Massaad M.J., et al. Clinical, immunologic and genetic profiles of DOCK8-deficient patients in Kuwait. Clin. Immunol. 2012;143(3):266–272. doi: 10.1016/j.clim.2012.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Singh A.K., Eken A., Hagin D., et al. DOCK8 regulates fitness and function of regulatory T cells through modulation of IL-2 signaling. JCI. Insight. 2017;2(19) doi: 10.1172/jci.insight.94275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Janssen E., Kumari S., Tohme M., et al. DOCK8 enforces immunological tolerance by promoting IL-2 signaling and immune synapse formation in tregs. JCI. Insight. 2017;2(19) doi: 10.1172/jci.insight.94298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Perretti M., D'acquisto F. Annexin A1 and glucocorticoids as effectors of the resolution of inflammation. Nat. Rev. Immunol. 2009;9(1):62–70. doi: 10.1038/nri2470. [DOI] [PubMed] [Google Scholar]
- 23.Araújo T.G., Mota S.T.S., Ferreira H.S.V., et al. Annexin A1 as a regulator of immune response in cancer. Cells. 2021;10(9):2245. doi: 10.3390/cells10092245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Voisinne G., Kersse K., Chaoui K., et al. Quantitative interactomics in primary T cells unveils TCR signal diversification extent and dynamics. Nat. Immunol. 2019;20(11):1530–1541. doi: 10.1038/s41590-019-0489-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhu Y., Gu H., Yang L., et al. Involvement of MST1/mTORC1/STAT1 activity in the regulation of B-cell receptor signalling by chemokine receptor 2. Clin. Transl. Med. 2022;12(7):e887. doi: 10.1002/ctm2.887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Engelhardt K.R., Mcghee S., Winkler S., et al. Large deletions and point mutations involving the dedicator of cytokinesis 8 (DOCK8) in the autosomal-recessive form of hyper-IgE syndrome. J. Allergy Clin. Immunol. 2009;124(6) doi: 10.1016/j.jaci.2009.10.038. 1289–302.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Su H.C. Insights into the pathogenesis of allergic disease from dedicator of cytokinesis 8 deficiency. Curr. Opin. Immunol. 2023;80 doi: 10.1016/j.coi.2022.102277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Shi R.Y., Zhou N., Xuan L., et al. Trafficking circuit of CD8(+) T cells between the intestine and bone marrow governs antitumour immunity. Nat. Cell Biol. 2024;26(8):1346–1358. doi: 10.1038/s41556-024-01462-3. [DOI] [PubMed] [Google Scholar]
- 29.Burzyn D., Kuswanto W., Kolodin D., et al. A special population of regulatory T cells potentiates muscle repair. Cell. 2013;155(6):1282–1295. doi: 10.1016/j.cell.2013.10.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Peng Y., Tao Y., Zhang Y., et al. CD25: A potential tumor therapeutic target. Int. J. Cancer. 2023;152(7):1290–1303. doi: 10.1002/ijc.34281. [DOI] [PubMed] [Google Scholar]
- 31.Lio C.W., Hsieh C.S. A two-step process for thymic regulatory T cell development. Immunity. 2008;28(1):100–111. doi: 10.1016/j.immuni.2007.11.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hosseini A., Gharibi T., Marofi F., et al. CTLA-4: From mechanism to autoimmune therapy. Int. Immunopharmacol. 2020;80 doi: 10.1016/j.intimp.2020.106221. [DOI] [PubMed] [Google Scholar]
- 33.Dong C., Juedes A.E., Temann U.A., et al. ICOS co-stimulatory receptor is essential for T-cell activation and function. Nature. 2001;409(6816):97–101. doi: 10.1038/35051100. [DOI] [PubMed] [Google Scholar]
- 34.Vignali D.A., Collison L.W., Workman C.J. How regulatory T cells work. Nat. Rev. Immunol. 2008;8(7):523–532. doi: 10.1038/nri2343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kumar S., Basto A.P., Ribeiro F., et al. Specialized Tfh cell subsets driving type-1 and type-2 humoral responses in lymphoid tissue. Cell Discov. 2024;10(1):64. doi: 10.1038/s41421-024-00681-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Olatunde A.C., Hale J.S., Lamb T.J. Cytokine-skewed tfh cells: Functional consequences for B cell help. Trends. Immunol. 2021;42(6):536–550. doi: 10.1016/j.it.2021.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kobayashi T., Iijima K., Dent A.L., et al. Follicular helper T cells mediate IgE antibody response to airborne allergens. J. Allergy Clin. Immunol. 2017;139(1) doi: 10.1016/j.jaci.2016.04.021. 300–13.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Kubo M. The role of IL-4 derived from follicular helper T (TFH) cells and type 2 helper T (TH2) cells. Int. Immunol. 2021;33(12):717–722. doi: 10.1093/intimm/dxab080. [DOI] [PubMed] [Google Scholar]
- 39.Gong F., Zheng T., Zhou P.T. Follicular helper cell subsets and the associated cytokine IL-21 in the pathogenesis and therapy of asthma. Front. Immunol. 2019;10:2918. doi: 10.3389/fimmu.2019.02918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Crotty S. T follicular helper cell differentiation, function, and roles in disease. Immunity. 2014;41(4):529–542. doi: 10.1016/j.immuni.2014.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wang L.M., Li W.H., Xu Y.C., et al. Annexin 1-derived peptide Ac2-26 inhibits eosinophil recruitment in vivo via decreasing prostaglandin D₂. Int. Arch. Allergy Immunol. 2011;154(2):137–148. doi: 10.1159/000320228. [DOI] [PubMed] [Google Scholar]
- 42.Janssen E., Wilkie H., Geha R.S. Macabre T(H)2 skewing in DOCK8 deficiency. J. Allergy Clin. Immunol. 2021;148(1):73–75. doi: 10.1016/j.jaci.2021.02.025. [DOI] [PubMed] [Google Scholar]
- 43.Jiang P., Zhao S., Li X., et al. Dedicator of cytokinesis 8 (DOCK8) mutation impairs the differentiation of helper T cells by regulating the glycolytic pathway of CD4(+) T cells. MedComm. (2020) 2024;5(10):e747. doi: 10.1002/mco2.747. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Alroqi F.J., Charbonnier L.M., Keles S., et al. DOCK8 Deficiency presenting as an IPEX-like disorder. J. Clin. Immunol. 2017;37(8):811–819. doi: 10.1007/s10875-017-0451-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Shiozawa S., Tsumiyama K., Miyazaki Y., et al. DOCK8-expressing T follicular helper cells newly generated beyond self-organized criticality cause systemic lupus erythematosus. iScience. 2022;25(1) doi: 10.1016/j.isci.2021.103537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Gowthaman U., Chen J.S., Zhang B., et al. Identification of a T follicular helper cell subset that drives anaphylactic IgE. Science. 2019;365(6456) doi: 10.1126/science.aaw6433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Noble A., Zhao J. Follicular helper T cells are responsible for IgE responses to der p 1 following house dust mite sensitization in mice. Clin. Exp. Allergy. 2016;46(8):1075–1082. doi: 10.1111/cea.12750. [DOI] [PubMed] [Google Scholar]
- 48.Haque T.T., Weissler K.A., Schmiechen Z., et al. TGFβ prevents IgE-mediated allergic disease by restraining T follicular helper 2 differentiation. Sci. Immunol. 2024;9(91):eadg8691. doi: 10.1126/sciimmunol.adg8691. [DOI] [PubMed] [Google Scholar]
- 49.Su H.C., Jing H., Zhang Q. DOCK8 deficiency. Ann. N. Y. Acad. Sci. 2011;1246:26–33. doi: 10.1111/j.1749-6632.2011.06295.x. [DOI] [PubMed] [Google Scholar]
- 50.Possebon L., Costa S.S., Souza H.R., et al. Mimetic peptide AC2-26 of annexin A1 as a potential therapeutic agent to treat COPD. Int. Immunopharmacol. 2018;63:270–281. doi: 10.1016/j.intimp.2018.08.011. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data sets and any other raw data that support the findings of this study are available from the corresponding author upon reasonable request.







